ID: 1101045743

View in Genome Browser
Species Human (GRCh38)
Location 12:100803977-100803999
Sequence CGGTAATGTGCAGGATGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1432
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 1371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101045737_1101045743 25 Left 1101045737 12:100803929-100803951 CCCCCTTAGCAGAGCTTTTTTTT 0: 1
1: 0
2: 6
3: 36
4: 390
Right 1101045743 12:100803977-100803999 CGGTAATGTGCAGGATGTGCAGG 0: 1
1: 0
2: 6
3: 54
4: 1371
1101045738_1101045743 24 Left 1101045738 12:100803930-100803952 CCCCTTAGCAGAGCTTTTTTTTT 0: 1
1: 1
2: 10
3: 98
4: 1084
Right 1101045743 12:100803977-100803999 CGGTAATGTGCAGGATGTGCAGG 0: 1
1: 0
2: 6
3: 54
4: 1371
1101045739_1101045743 23 Left 1101045739 12:100803931-100803953 CCCTTAGCAGAGCTTTTTTTTTT 0: 1
1: 2
2: 36
3: 248
4: 1809
Right 1101045743 12:100803977-100803999 CGGTAATGTGCAGGATGTGCAGG 0: 1
1: 0
2: 6
3: 54
4: 1371
1101045740_1101045743 22 Left 1101045740 12:100803932-100803954 CCTTAGCAGAGCTTTTTTTTTTT 0: 1
1: 6
2: 57
3: 496
4: 3171
Right 1101045743 12:100803977-100803999 CGGTAATGTGCAGGATGTGCAGG 0: 1
1: 0
2: 6
3: 54
4: 1371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101045743 Original CRISPR CGGTAATGTGCAGGATGTGC AGG Intronic
900627862 1:3617598-3617620 GGTCCATGTGCAGGATGTGCAGG - Intergenic
900686840 1:3954183-3954205 GGTCCATGTGCAGGATGTGCAGG + Intergenic
901289591 1:8113629-8113651 GGTACATGTGCAGGATGTGCAGG + Intergenic
901785587 1:11622460-11622482 CTGTACTGTGCAGGATGTGTGGG - Intergenic
902138590 1:14332903-14332925 GGTACATGTGCAGGATGTGCAGG + Intergenic
903589820 1:24446291-24446313 GGTACATGTGCAGGATGTGCAGG + Intronic
904111251 1:28128335-28128357 GGTACATGTGCAGGATGTGCAGG + Intergenic
904443392 1:30547829-30547851 GGTACATGTGCAGGATGTGCAGG - Intergenic
904980079 1:34492610-34492632 GGTACATGTGCAGGATGTGCAGG - Intergenic
905860384 1:41346734-41346756 GGTACATGTGCAGGATGTGCAGG + Intergenic
905953208 1:41970660-41970682 GGGTACTGTGCCAGATGTGCAGG - Intronic
906574020 1:46871365-46871387 GGTACATGTGCAGGATGTGCAGG - Intergenic
906574790 1:46878560-46878582 GGTATATGTGCAGGATGTGCAGG - Intergenic
906597183 1:47089344-47089366 GGTATATGTGCAGGATGTGCAGG + Intronic
907356806 1:53882289-53882311 GGGTCATGTGCAGGAGGTACAGG - Intronic
907695299 1:56720634-56720656 GGTACATGTGCAGGATGTGCAGG + Intronic
907922396 1:58925728-58925750 GGTACATGTGCAGGATGTGCAGG - Intergenic
908088674 1:60663517-60663539 GGTACATGTGCAGGATGTGCAGG - Intergenic
908283861 1:62572027-62572049 AGTACATGTGCAGGATGTGCAGG - Intronic
908586106 1:65571304-65571326 GGTACATGTGCAGGATGTGCAGG - Intronic
908592471 1:65648681-65648703 GGTGCATGTGCAGGATGTGCAGG + Intergenic
908616172 1:65925296-65925318 GGTACATGTGCAGGATGTGCAGG - Intronic
908723473 1:67150286-67150308 GATAAATGTGCAGGATGTGCAGG + Intronic
908879500 1:68714723-68714745 GGGACACGTGCAGGATGTGCAGG - Intergenic
908981335 1:69962949-69962971 GGTACATGTGCAGGATGTGCAGG - Intronic
909178012 1:72384373-72384395 GGTACATGTGCAGGATGTGCAGG + Intergenic
909312269 1:74167484-74167506 GGTACATGTGCAGGATGTGCAGG - Intronic
909412000 1:75365186-75365208 GGTACATGTGCAGGATGTGCAGG + Intronic
909429058 1:75564950-75564972 GGTACATGTGCAGGATGTGCAGG + Intronic
909438978 1:75676664-75676686 GGTATATGTGCAGGATGTGCAGG - Intergenic
909582770 1:77256682-77256704 GGTACATGTGCAGGATGTGCAGG + Intergenic
909587704 1:77309208-77309230 AGGACACGTGCAGGATGTGCAGG - Intronic
909624454 1:77700168-77700190 CATACATGTGCAGGATGTGCAGG - Intronic
909749948 1:79146985-79147007 GGTACATGTGCAGGATGTGCAGG + Intergenic
909878617 1:80844564-80844586 GGTACATGTGCAGGATGTGCAGG + Intergenic
910009534 1:82444145-82444167 GGTACATGTGCAGGATGTGCAGG + Intergenic
910084931 1:83389326-83389348 GGTATATGTGCAGGATGTGCAGG + Intergenic
910096694 1:83530659-83530681 GGTACATGTGCAGGATGTGCAGG - Intergenic
910167573 1:84343826-84343848 AGTACATGTGCAGGATGTGCAGG - Intronic
910452568 1:87361868-87361890 AGTACATGTGCAGGATGTGCAGG - Intergenic
910506954 1:87960096-87960118 TGGTACTGTAAAGGATGTGCAGG + Intergenic
910582347 1:88842495-88842517 GGTTCATGTGCAGGATGTGCAGG - Intergenic
910600522 1:89027094-89027116 GGTACATGTGCAGGATGTGCAGG + Intergenic
910601613 1:89038701-89038723 GGTACATGTGCAGGATGTGCAGG + Intergenic
910740246 1:90507904-90507926 GGTACATGTGCAGGATGTGCAGG + Intergenic
911342711 1:96658197-96658219 GGTACATGTGCAGGATGTGCAGG - Intergenic
911551835 1:99291884-99291906 GGTACATGTGCAGGATGTGCAGG - Intronic
911652480 1:100405410-100405432 GGTACATGTGCAGGATGTGCAGG + Intronic
911744373 1:101424052-101424074 GGTACATGTGCAGGATGTGCAGG + Intergenic
911795007 1:102064540-102064562 GGTACATGTGCAGGATGTGCAGG - Intergenic
911801367 1:102142527-102142549 GGATGATGTGCAGAATGTGCAGG - Intergenic
911892569 1:103391087-103391109 GGTACATGTGCAGGATGTGCAGG + Intergenic
912019870 1:105094368-105094390 TGTACATGTGCAGGATGTGCAGG - Intergenic
912077766 1:105898143-105898165 GGTACATGTGCAGGATGTGCAGG + Intergenic
912126918 1:106550901-106550923 GGTACATGTGCAGGATGTGCAGG + Intergenic
912223120 1:107700323-107700345 GGTACATGTGCAGGATGTGCAGG + Intronic
912404937 1:109429340-109429362 GGTGTATGTGCAGGATGTGCAGG + Intergenic
912610455 1:111037319-111037341 GGTATATGTGCAGGATGTGCAGG - Intergenic
913417067 1:118620491-118620513 AGTACATGTGCAGGATGTGCAGG + Intergenic
913717136 1:121547631-121547653 GGTACATGTGCAGGATGTGCAGG + Intergenic
914194235 1:145436671-145436693 GGTACATGTGCAGGATGTGCAGG - Intergenic
914201693 1:145490843-145490865 GGTACATGTGCAGGATGTGCAGG - Intergenic
914201910 1:145492702-145492724 GGCACATGTGCAGGATGTGCAGG - Intergenic
914235838 1:145810616-145810638 GGCACATGTGCAGGATGTGCAGG - Intronic
914475565 1:148019548-148019570 GGTACATGTGCAGGATGTGCAGG - Intergenic
914480818 1:148063967-148063989 GGTACATGTGCAGGATGTGCAGG - Intergenic
914481034 1:148065831-148065853 AGCACATGTGCAGGATGTGCAGG - Intergenic
914504437 1:148276511-148276533 GGTACATGTGCAGGATGTGCAGG + Intergenic
914946284 1:152069590-152069612 GGTACATGTGCAGGATGTGCAGG + Intergenic
915175940 1:154015077-154015099 GGTACATGTGCAGGATGTGCAGG + Intronic
915338643 1:155163654-155163676 GGTACATGTGCAGGATGTGCAGG + Intergenic
916288344 1:163135650-163135672 GGTACATGTGCAGGATGTGCAGG + Intronic
916484934 1:165250201-165250223 GGTACATGTGCAGGATGTGCAGG - Intronic
916487419 1:165272032-165272054 GGTACATGTGCAGGATGTGCAGG + Intronic
916500172 1:165380331-165380353 CTTTTATGTTCAGGATGTGCAGG - Intergenic
916928414 1:169548316-169548338 TACTTATGTGCAGGATGTGCAGG - Intronic
916985337 1:170185245-170185267 GGTACATGTGCAGGATGTGCAGG + Intergenic
917263793 1:173197800-173197822 GGTACATGTGCAGGATGTGCAGG - Intronic
917305878 1:173624069-173624091 GGTACATGTGCAGGATGTGCTGG - Intronic
917323705 1:173810485-173810507 GGTATATGTGCAGGATGTGCAGG - Intronic
917395232 1:174586511-174586533 GGTACATGTGCAGGATGTGCAGG - Intronic
917542785 1:175931317-175931339 GGTACATGTGCAGGATGTGCAGG + Intergenic
918163698 1:181924582-181924604 GGGAAATGTGCAGAACGTGCAGG - Intergenic
918536117 1:185576635-185576657 GGTACATGTGCAGGATGTGCAGG + Intergenic
918768496 1:188520670-188520692 GGGTCATGTGCACAATGTGCAGG - Intergenic
918958843 1:191244724-191244746 GGTACATGTGCAGGATGTGCAGG + Intergenic
919375763 1:196792498-196792520 GGTACATGTGCAGGATGTGCAGG - Intronic
919385459 1:196917387-196917409 GGTACATGTGCAGGATGTGCAGG - Intronic
920140918 1:203812140-203812162 GGTACATGTGCAGGATGTGCAGG + Intronic
920395141 1:205639700-205639722 TGGCAATGTGGAGGATGGGCTGG - Intergenic
920718415 1:208363768-208363790 GGTACATGTGCAGGATGTGCAGG - Intergenic
921260313 1:213380453-213380475 GGTACATGTGCAGGATGTGCAGG - Intergenic
921786466 1:219236776-219236798 GGTACATGTGCAGGATGTGCAGG + Intergenic
921919270 1:220648012-220648034 GGTACATGTGCAGGATGTGCAGG - Intronic
922081204 1:222298719-222298741 GGTACATGTGCAGGATGTGCAGG - Intergenic
923829550 1:237539809-237539831 GGTAAATGTGCAGGATGTGCAGG - Intronic
924001441 1:239557500-239557522 GGTACATGTGCAGGATGTGCAGG + Intronic
924392528 1:243578654-243578676 GGTACATGTGCAGGATGTGCAGG - Intronic
924670323 1:246117708-246117730 GGTACATGTGCAGGATGTGCAGG + Intronic
1063089275 10:2847827-2847849 GGTACATGTGCAGGATGTGCAGG + Intergenic
1063089279 10:2847862-2847884 GGTACATGTGCAGGATGTGCAGG + Intergenic
1063089283 10:2847897-2847919 GGTACATGTGCAGGATGTGCAGG + Intergenic
1063475635 10:6326411-6326433 GGTACATGTGCAGGATGTGCAGG - Intergenic
1063625835 10:7689176-7689198 GGTACATGTGCAGGATGTGCAGG - Intergenic
1063888269 10:10601756-10601778 GGTACATGTGCAGGATGTGCAGG + Intergenic
1064105379 10:12496754-12496776 GGTCCATGTGCAGGATGTGCAGG + Intronic
1064188160 10:13181647-13181669 GGTACATGTGCAGGATGTGCAGG - Intronic
1064241617 10:13634913-13634935 GGTATATGTGCAGGATGTGCAGG + Intronic
1064514893 10:16136480-16136502 GGTACATGTGCAGGATGTGCAGG + Intergenic
1064725523 10:18275574-18275596 GGTACATGTGCAGGATGTGCAGG - Intronic
1064735993 10:18382406-18382428 GGTACATGTGCAGGATGTGCAGG + Intronic
1064967999 10:21034827-21034849 GGTACATGTGCAGGATGTGCAGG + Intronic
1064974821 10:21102852-21102874 GGTACATGTGCAGGATGTGCAGG + Intronic
1065445719 10:25796166-25796188 GGTACATGTGCAGGATGTGCAGG - Intergenic
1065496124 10:26330145-26330167 GGTACATGTGCAGGATGTGCAGG - Intergenic
1065554264 10:26899063-26899085 GGTACATGTGCAGGATGTGCAGG - Intergenic
1065758424 10:28957419-28957441 GGTACATGTGCAGGATGTGCAGG - Intergenic
1066010554 10:31190321-31190343 GGGTACAGTGCAGGATGTGCAGG + Intergenic
1066186106 10:33012232-33012254 GGTACATGTGCAGGATGTGCAGG - Intergenic
1066197197 10:33112107-33112129 GGTACATGTGCAGGATGTGCAGG + Intergenic
1066280313 10:33910881-33910903 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1066494554 10:35929885-35929907 GGTACATGTGCAGGATGTGCAGG + Intergenic
1066505177 10:36035101-36035123 AGTAGATGTGCAGGATGTGCAGG + Intergenic
1066509255 10:36077628-36077650 AGTACATGTGCAGGATGTGCAGG + Intergenic
1066551829 10:36567428-36567450 GATTCATGTGCAGGATGTGCAGG + Intergenic
1067319323 10:45202838-45202860 GGTACATGTGCAGGATGTGCAGG + Intergenic
1067732861 10:48824978-48825000 GGTACATGTGCAGGATGTGCAGG + Intronic
1068001406 10:51338377-51338399 GGTACATGTGCAGGATGTGCAGG - Intronic
1068023191 10:51609957-51609979 GGTACATGTGCAGGATGTGCAGG - Intronic
1068338014 10:55663177-55663199 GGTACATGTGCAGGATGTGCAGG + Intergenic
1068364127 10:56022510-56022532 GGGTAATGTGCACAATGTGCAGG + Intergenic
1068511443 10:57971144-57971166 GGTACATGTGCAGGATGTGCAGG - Intergenic
1068984136 10:63091446-63091468 GGTAAATGTGCAGGATGTGCAGG - Intergenic
1069051502 10:63799589-63799611 GGGAAATGTACAGGATGTGCAGG + Intergenic
1069131004 10:64702577-64702599 GGTACATGTGCAGGATGTGCAGG - Intergenic
1069361179 10:67643436-67643458 AGTACATGTGCAGGATGTGCAGG - Intronic
1070546867 10:77459214-77459236 AGGTGATGTGCAGGAAGGGCTGG - Intronic
1070709853 10:78672923-78672945 GGGTAAAGTGCAGGATGTGCAGG - Intergenic
1070816408 10:79327463-79327485 CTCTGCTGTGCAGGATGTGCTGG + Intergenic
1070943645 10:80370367-80370389 GGTACATGTGCAGGATGTGCAGG - Intergenic
1071073552 10:81725079-81725101 GGTACATGTGCAGGATGTGCAGG + Intergenic
1071173319 10:82894761-82894783 GGTGAATGTGCAGAATGTGCAGG + Intronic
1071410652 10:85389858-85389880 GGTACATGTGCAGGATGTGCAGG - Intergenic
1071412339 10:85409175-85409197 GGTACATGTGCAGGATGTGCAGG + Intergenic
1071558095 10:86621910-86621932 GGTACATGTGCAGGATGTGCAGG - Intergenic
1071668428 10:87583996-87584018 GGTTCATGTGCAGAATGTGCAGG + Intergenic
1071755627 10:88535557-88535579 GGTACATGTGCAGGATGTGCAGG - Intronic
1071991693 10:91105808-91105830 GGTAAATGTGCAGGATGTGCAGG + Intergenic
1072181797 10:92990645-92990667 GGTACATGTGCAGGATGTGCAGG + Intronic
1072267641 10:93745780-93745802 GGTAAATGTGCAGGAGGTGCAGG + Intergenic
1072643699 10:97234379-97234401 GGTACATGTGCAGGATGTGCAGG - Intronic
1072904469 10:99439661-99439683 AGTACATGTGCAGGATGTGCAGG - Intergenic
1073163121 10:101418726-101418748 GGTACATGTGCAGGATGTGCAGG + Intronic
1073539009 10:104302971-104302993 GGTACATGTGCAGGATGTGCAGG + Intronic
1073702429 10:105943590-105943612 GGTACATGTGCAGGATGTGCAGG + Intergenic
1073989871 10:109250693-109250715 GGTACATGTGCAGGATGTGCAGG + Intergenic
1074556559 10:114496620-114496642 AGTACATGTGCAGGATGTGCAGG - Intronic
1074568016 10:114598868-114598890 GGTGCATGTGCAGGATGTGCAGG + Intronic
1074868378 10:117558258-117558280 CCGTAATGTTCATGAAGTGCTGG - Intergenic
1075006480 10:118834220-118834242 GGTACATGTGCAGGATGTGCAGG + Intergenic
1075288943 10:121211848-121211870 AGGACATGTGCAGGACGTGCGGG + Intergenic
1075899584 10:126029676-126029698 GGTACATGTGCAGGATGTGCAGG - Intronic
1076095237 10:127729265-127729287 GGTACATGTGCAGGATGTGCAGG + Intergenic
1076259184 10:129052031-129052053 AGTACATGTGCAGGATGTGCAGG - Intergenic
1077381299 11:2239928-2239950 GGTACATGTGCAGGATGTGCAGG - Intergenic
1077396213 11:2323959-2323981 GGTACATGTGCAGGATGTGCAGG - Intergenic
1077657552 11:4035885-4035907 GGTACATGTGCAGGATGTGCAGG + Intronic
1077734386 11:4773654-4773676 AGTACATGTGCAGGATGTGCAGG + Intronic
1077773979 11:5251265-5251287 GGTACATGTGCAGGATGTGCAGG - Intronic
1077779750 11:5314073-5314095 GGCACATGTGCAGGATGTGCAGG - Intronic
1077781664 11:5336711-5336733 GGTACATGTGCAGGATGTGCAGG + Intronic
1078039594 11:7847478-7847500 GGTAACTGTGCAGGATGTGCAGG + Intergenic
1078266745 11:9760533-9760555 CCCAAATGTGCAGAATGTGCAGG + Intergenic
1079261101 11:18882210-18882232 GGATAATGTGTAGAATGTGCAGG + Intergenic
1079277290 11:19053079-19053101 GGTACATGTGCAGGATGTGCAGG + Intergenic
1079437281 11:20470265-20470287 GGTTCATGTGCAGGATGTGCAGG + Intronic
1079822950 11:25154572-25154594 GGTACATGTGCAGGATGTGCAGG + Intergenic
1080040669 11:27756478-27756500 GGATAATGTGCAGAATGTGCAGG + Intergenic
1080055244 11:27900162-27900184 GGTACATGTGCAGGATGTGCAGG - Intergenic
1080234024 11:30048061-30048083 GGGTCATGTGCAGGATGTGCAGG + Intergenic
1080271258 11:30452959-30452981 GGGCAAGGTGCAGTATGTGCTGG - Intronic
1080416366 11:32073167-32073189 CAGTGATGTGCAGGATGAGGTGG - Intronic
1080487789 11:32729040-32729062 GGTACATGTGCAGGATGTGCAGG + Intronic
1080744633 11:35097789-35097811 GGTACATGTGCAGGATGTGCTGG - Intergenic
1080770473 11:35336289-35336311 GGTACATGTGCAGGATGTGCAGG - Intronic
1080807542 11:35668231-35668253 GGTACATGTGCAGGATGTGCAGG + Intronic
1081009162 11:37786211-37786233 GGTACATGTGCAGGATGTGCAGG - Intergenic
1081508002 11:43738239-43738261 GGTCCATGTGCAGGATGTGCAGG + Intronic
1081954891 11:47082901-47082923 GGTACATGTGCAGGATGTGCAGG + Intronic
1082115822 11:48327155-48327177 GGTACATGTGCAGGATGTGCAGG + Intronic
1082181592 11:49126622-49126644 AGTACATGTGCAGGATGTGCAGG - Intergenic
1083062167 11:59885355-59885377 GGTACATGTGCAGGATGTGCAGG + Intergenic
1083328205 11:61884435-61884457 GGGAAACGTGCAGAATGTGCAGG - Intronic
1083361944 11:62115225-62115247 AGTAAATGTGCAGGATGTGCAGG - Intergenic
1083552870 11:63603590-63603612 GGTACATGTGCAGGATGTGCAGG - Intronic
1085445049 11:76595907-76595929 GGCACATGTGCAGGATGTGCAGG - Intergenic
1085452480 11:76643310-76643332 GGTACATGTGCAGGATGTGCAGG + Intergenic
1085667036 11:78423083-78423105 GGTACATGTGCAGGATGTGCAGG - Intergenic
1085948734 11:81304125-81304147 GGTATATGTGCAGGATGTGCAGG + Intergenic
1086050408 11:82582247-82582269 GGTACATGTGCAGGATGTGCAGG - Intergenic
1086066104 11:82746663-82746685 GGTACATGTGCAGGATGTGCTGG - Intergenic
1086117171 11:83265067-83265089 GGGTCATGTGCACAATGTGCAGG - Intronic
1086188830 11:84053395-84053417 GGTATATGTGCAGGATGTGCAGG - Intronic
1086221085 11:84444343-84444365 GGTACATGTGCAGGATGTGCAGG - Intronic
1086521475 11:87673063-87673085 GGTACATGTGCAGGATGTGCAGG + Intergenic
1086522968 11:87691711-87691733 GGTACATGTGCAGGATGTGCAGG - Intergenic
1086683903 11:89708223-89708245 AGTACATGTGCAGGATGTGCAGG + Intergenic
1086962734 11:92996327-92996349 GGTACATGTGCAGGATGTGCAGG + Intergenic
1087259625 11:95996022-95996044 GGTACATGTGCAGGATGTGCAGG - Intronic
1087399086 11:97641283-97641305 CCTTCATGTGCAGAATGTGCAGG - Intergenic
1087549743 11:99634085-99634107 CAGTAATATGCAGGATGTATTGG + Intronic
1087607205 11:100391197-100391219 GGTATATGTGCAGGATGTGCAGG - Intergenic
1087719837 11:101650389-101650411 GGTACATGTGCAGGATGTGCAGG - Intronic
1087720682 11:101662147-101662169 GGTACATGTGCAGGATGTGCAGG + Intronic
1087730872 11:101777360-101777382 GGTGCATGTGCAGGATGTGCAGG - Intronic
1087935712 11:104032116-104032138 GGTACATGTGCAGGATGTGCAGG - Intronic
1088018278 11:105086880-105086902 GATTAATGTGCAGCATGTGCAGG + Intronic
1088020842 11:105117069-105117091 GATTAATGTGCAGCATGTGCAGG + Intergenic
1088150751 11:106742205-106742227 CTTTTATGTGCAGGATGTGCAGG + Intronic
1088238730 11:107752243-107752265 GGTACATGTGCAGGATGTGCAGG + Intergenic
1088501412 11:110486993-110487015 GGTACATGTGCAGGATGTGCAGG + Intergenic
1088527384 11:110771792-110771814 GGTGCATGTGCAGGATGTGCAGG - Intergenic
1088527981 11:110777038-110777060 CATACATGTGCAGGATGTGCAGG - Intergenic
1088638644 11:111849498-111849520 GGTACATGTGCAGGATGTGCAGG + Intronic
1088772792 11:113052715-113052737 GGTACATGTGCAGGATGTGCAGG + Intronic
1089054492 11:115574521-115574543 GGTACATGTGCAGGATGTGCAGG - Intergenic
1089147338 11:116338986-116339008 GGCACATGTGCAGGATGTGCAGG - Intergenic
1089430213 11:118417402-118417424 GGTACATGTGCAGGATGTGCAGG - Intronic
1089758752 11:120707411-120707433 CACAAATGTGCAGGATCTGCTGG - Intronic
1090101787 11:123805327-123805349 GGTACATGTGCAGGATGTGCAGG - Exonic
1090586909 11:128222927-128222949 GGTGCATGTGCAGGATGTGCAGG + Intergenic
1090686938 11:129131961-129131983 GGTACATGTGCAGGATGTGCAGG + Intronic
1091066813 11:132521733-132521755 CTGGAATGTGCAGGATGTGCAGG - Intronic
1091811594 12:3403436-3403458 GGTACATGTGCAGGATGTGCAGG - Intronic
1092325028 12:7521916-7521938 GGTATATGTGCAGGATGTGCAGG + Intergenic
1092343952 12:7700041-7700063 GGTACATGTGCAGGATGTGCAGG - Intergenic
1092396481 12:8131862-8131884 GGTACATGTGCAGGATGTGCAGG + Intronic
1092443894 12:8535530-8535552 GGTACATGTGCAGGATGTGCAGG - Intronic
1092511018 12:9156957-9156979 GGTACATGTGCAGGATGTGCAGG + Intronic
1092511618 12:9162797-9162819 GGGACATGTGCAGGAGGTGCAGG + Intronic
1092646513 12:10579792-10579814 GATTCATGTGCAGGATGTGCAGG - Intergenic
1092969271 12:13676312-13676334 GGTACATGTGCAGGATGTGCAGG - Intronic
1093210765 12:16305783-16305805 GGTACATGTGCAGGATGTGCAGG + Intergenic
1093248353 12:16768365-16768387 AGTATATGTGCAGGATGTGCAGG - Intergenic
1093427701 12:19047227-19047249 GGTACATGTGCAGGATGTGCAGG - Intergenic
1093940345 12:25047483-25047505 GGTACATGTGCAGGATGTGCAGG + Intronic
1094254427 12:28406110-28406132 GGTACATGTGCAGGATGTGCAGG + Intronic
1094420584 12:30266770-30266792 GGTACATGTGCAGGATGTGCAGG - Intergenic
1094569993 12:31633139-31633161 GGTACATGTGCAGGATGTGCAGG - Intergenic
1095134433 12:38582528-38582550 GGTACATGTGCAGGATGTGCAGG + Intergenic
1095202470 12:39400306-39400328 GGTACATGTGCAGGATGTGCTGG + Intronic
1095589340 12:43886649-43886671 GGTACATGTGCAGGATGTGCAGG + Intronic
1095803234 12:46290814-46290836 GGTACATGTGCAGGATGTGCAGG - Intergenic
1095829676 12:46570591-46570613 GGTACATGTGCAGGATGTGCGGG + Intergenic
1095853528 12:46836113-46836135 GGTACATGTGCAGGATGTGCAGG + Intergenic
1095885046 12:47179964-47179986 GGTACATGTGCAGGATGTGCAGG + Intronic
1096011920 12:48225032-48225054 GGTTCATGTGCAGGATGTGCAGG - Intergenic
1096015544 12:48270586-48270608 GGTACATGTGCAGGATGTGCAGG + Intergenic
1096443283 12:51664748-51664770 GGTACATGTGCAGGATGTGCAGG + Intronic
1096913324 12:55006050-55006072 GGTACATGTGCAGGATGTGCAGG + Intergenic
1096928974 12:55182995-55183017 GGTATATGTGCAGGATGTGCAGG - Intergenic
1097367801 12:58739505-58739527 AGTATATGTGCAGGATGTGCAGG + Intronic
1097488997 12:60240710-60240732 AGATAATGTGCAGAAGGTGCAGG - Intergenic
1097565868 12:61267293-61267315 GGTACATGTGCAGGATGTGCGGG - Intergenic
1097600641 12:61688351-61688373 GGTGCATGTGCAGGATGTGCAGG + Intergenic
1097632591 12:62081811-62081833 AGTACATGTGCAGGATGTGCAGG + Intronic
1097864958 12:64552329-64552351 GGTACATGTGCAGGATGTGCAGG + Intergenic
1097940314 12:65297343-65297365 GGCACATGTGCAGGATGTGCAGG - Intronic
1097992852 12:65854596-65854618 GGTGCATGTGCAGGATGTGCAGG + Intronic
1098047509 12:66416039-66416061 GGTACATGTGCAGGATGTGCAGG - Intronic
1098056343 12:66509917-66509939 GGTACATGTGCAGGATGTGCAGG - Intronic
1098230435 12:68367632-68367654 GGTACATGTGCAGGATGTGCAGG + Intergenic
1098263734 12:68697593-68697615 GATAAATGTGCAGGATGTGCAGG - Intronic
1098829127 12:75338618-75338640 GGTACATGTGCAGGATGTGCAGG + Intronic
1099148534 12:79078559-79078581 GGTTCATGTGCAGGATGTACAGG + Intronic
1099374465 12:81882037-81882059 GGTAAATGTGCAGGATGTGCAGG + Intergenic
1099480160 12:83155957-83155979 GGTACATGTGCAGGATGTGCAGG - Intergenic
1099715402 12:86287388-86287410 GGATTATGTGCAGAATGTGCAGG + Intronic
1099753368 12:86807143-86807165 TGTACATGTGCAGGATGTGCAGG + Intronic
1099839709 12:87950168-87950190 GGTACATGTGCAGGATGTGCAGG - Intergenic
1099944568 12:89229451-89229473 GGTACATGTGCAGGATGTGCAGG - Intergenic
1100154656 12:91783659-91783681 GGTACATGTGCAGGATGTGCAGG - Intergenic
1100195309 12:92238648-92238670 GGTACATGTGCAGGATGTGCAGG - Intergenic
1100377995 12:94035206-94035228 GGTACATGTGCAGGATGTGCAGG - Intergenic
1100482225 12:94990196-94990218 GGTACATGTGCAGGATGTGCAGG - Intronic
1100665222 12:96744730-96744752 GGTACATGTGCAGGATGTGCAGG + Intronic
1100685662 12:96984016-96984038 GGTACATGTGCAGGATGTGCAGG - Intergenic
1100820729 12:98427154-98427176 GGTACATGTGCAGGATGTGCAGG + Intergenic
1100942771 12:99741851-99741873 GGGAAACGTGCAGAATGTGCAGG - Intronic
1101045743 12:100803977-100803999 CGGTAATGTGCAGGATGTGCAGG + Intronic
1101096937 12:101351562-101351584 GGTACATGTGCAGGATGTGCAGG + Intronic
1101202301 12:102449502-102449524 GGGAAACGTGCAGAATGTGCAGG - Intronic
1101683717 12:106995677-106995699 GGTACATGTGCAGGATGTGCAGG + Intronic
1101852327 12:108413740-108413762 GGTACATGTGCAGGATGTGCAGG - Intergenic
1101979221 12:109391102-109391124 GGTACATGTGCAGGATGTGCAGG + Intronic
1102423962 12:112825961-112825983 GGTACATGTGCAGGATGTGCAGG + Intronic
1102648428 12:114418972-114418994 GGTACATGTGCAGGATGTGCAGG - Intergenic
1102745745 12:115247462-115247484 GGTACATGTGCAGGATGTGCAGG - Intergenic
1102818394 12:115887400-115887422 GGTACATGTGCAGGATGTGCAGG + Intergenic
1103074449 12:117970654-117970676 GGTAAATGTGCAGGATGTGCAGG + Intergenic
1103260177 12:119580619-119580641 GGTACATGTGCAGGATGTGCAGG - Intergenic
1103282009 12:119766198-119766220 GGTACATGTGCAGGATGTGCAGG - Intronic
1103863316 12:124031363-124031385 GGTACATGTGCAGGATGTGCAGG + Intronic
1104217720 12:126750594-126750616 GGTACATGTGCAGGATGTGCAGG + Intergenic
1104236175 12:126939281-126939303 GGTACATGTGCAGGATGTGCAGG - Intergenic
1104338249 12:127921383-127921405 GGTGCATGTGCAGGATGTGCAGG - Intergenic
1104457250 12:128925203-128925225 GGTACATGTGCAGGATGTGCAGG + Intronic
1104488979 12:129177789-129177811 GGTACATGTGCAGGATGTGCAGG + Intronic
1105206594 13:18230918-18230940 GGTACATGTGCAGGATGTGCAGG + Intergenic
1105495749 13:20929556-20929578 GGTACATGTGCAGGATGTGCAGG + Intergenic
1105935230 13:25092330-25092352 GGTACATGTGCAGGATGTGCAGG + Intergenic
1106156328 13:27160819-27160841 GGTACATGTGCAGGATGTGCAGG + Intronic
1106267625 13:28124332-28124354 GGTACATGTGCAGGATGTGCAGG - Intergenic
1106388311 13:29309552-29309574 AGTACATGTGCAGGATGTGCAGG - Intronic
1106428652 13:29658260-29658282 GGTACATGTGCAGGATGTGCAGG + Intergenic
1106711052 13:32333633-32333655 GGTACATGTGCAGGATGTGCAGG + Intronic
1107071743 13:36277437-36277459 GGTACATGTGCAGGATGTGCAGG - Intronic
1107157382 13:37184986-37185008 GGTACATGTGCAGGATGTGCAGG - Intergenic
1107189547 13:37562512-37562534 CAGGCATGTGCAGGACGTGCAGG - Intergenic
1107315135 13:39122886-39122908 GGTACATGTGCAGGATGTGCAGG - Intergenic
1107489036 13:40862605-40862627 GGTTCATGTGCAGGATGTGCAGG + Intergenic
1107584926 13:41835207-41835229 GGTACATGTGCAGGATGTGCAGG - Intronic
1107610798 13:42111022-42111044 GGTGCATGTGCAGGATGTGCAGG - Intronic
1107820993 13:44285589-44285611 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1108094619 13:46888036-46888058 GGTACATGTGCAGGATGTGCAGG - Intronic
1108173410 13:47767553-47767575 CGTACATGTGCAGGATGTGCAGG + Intergenic
1108268716 13:48737576-48737598 GGTACATGTGCAGGATGTGCAGG - Intergenic
1108480235 13:50862014-50862036 GGTACATGTGCAGGATGTGCAGG - Intergenic
1108483979 13:50906311-50906333 AGTATATGTGCAGGATGTGCAGG + Intergenic
1108497883 13:51043075-51043097 GGTACATGTGCAGGATGTGCAGG + Intergenic
1108545797 13:51492096-51492118 GGTACATGTGCAGGATGTGCAGG + Intergenic
1108925431 13:55736400-55736422 GGATAATGTGCAGAACGTGCAGG - Intergenic
1109022292 13:57113297-57113319 AGTACATGTGCAGGATGTGCAGG - Intergenic
1109085304 13:57963554-57963576 GGTACATGTGCAGGATGTGCAGG - Intergenic
1109229180 13:59735808-59735830 GGTACATGTGCAGGATGTGCAGG + Intronic
1109847532 13:68015088-68015110 GGTACATGTGCAGGATGTGCAGG - Intergenic
1109952444 13:69516229-69516251 GGTACATGTGCAGGATGTGCAGG - Intergenic
1110077605 13:71268498-71268520 GGTGCATGTGCAGGATGTGCAGG - Intergenic
1110265655 13:73534682-73534704 GGTACATGTGCAGGATGTGCAGG + Intergenic
1110297607 13:73886594-73886616 GGTGCATGTGCAGGATGTGCAGG - Intronic
1110661584 13:78064140-78064162 GGTACATGTGCAGGATGTGCAGG + Intergenic
1110838608 13:80114374-80114396 GGTACATGTGCAGGATGTGCAGG - Intergenic
1111150829 13:84252071-84252093 GGAATATGTGCAGGATGTGCAGG + Intergenic
1111192676 13:84830911-84830933 GGTACATGTGCAGGATGTGCAGG - Intergenic
1111332335 13:86776060-86776082 GGTACATGTGCAGGATGTGCAGG + Intergenic
1111373069 13:87342531-87342553 GGTACATGTGCAGGATGTGCAGG + Intergenic
1111454843 13:88466925-88466947 GGTACATGTGCAGGATGTGCAGG - Intergenic
1111501863 13:89131510-89131532 GGTACATGTGCAGGATGTGCAGG - Intergenic
1111801162 13:92982683-92982705 GGTACATGTGCAGGATGTGCTGG - Intergenic
1112084150 13:96010384-96010406 TGTACATGTGCAGGATGTGCAGG - Intronic
1112102745 13:96207954-96207976 TGTACATGTGCAGGATGTGCAGG - Intronic
1112614999 13:100995404-100995426 GGTATATGTGCAGGATGTGCAGG + Intergenic
1112913285 13:104516438-104516460 GGTACATGTGCAGGATGTGCGGG + Intergenic
1113247777 13:108417699-108417721 GGTACATGTGCAGGATGTGCAGG - Intergenic
1114831581 14:26148900-26148922 GGTATATGTGCAGGATGTGCAGG - Intergenic
1114842560 14:26282373-26282395 AGTACATGTGCAGGATGTGCAGG - Intergenic
1114885795 14:26849514-26849536 GGTACATGTGCAGGATGTGCAGG + Intergenic
1114921858 14:27342513-27342535 GGTACATGTGCAGGATGTGCAGG - Intergenic
1114939612 14:27591866-27591888 GGTACATGTGCAGGATGTGCAGG - Intergenic
1114971621 14:28036813-28036835 GGTAATTGTGCAGGATGTGCAGG - Intergenic
1115364221 14:32538816-32538838 GGTACATGTGCAGGATGTGCAGG - Intronic
1115958376 14:38808163-38808185 GGTACATGTGCAGGATGTGCAGG - Intergenic
1116148125 14:41101194-41101216 GGTACATGTGCAGGATGTGCAGG + Intergenic
1116273607 14:42803225-42803247 AGTGATTGTGCAGGATGTGCAGG - Intergenic
1116337397 14:43674973-43674995 GGGTAATGTGCAGAACATGCAGG + Intergenic
1116500770 14:45618343-45618365 GGCACATGTGCAGGATGTGCAGG - Intergenic
1116506772 14:45692395-45692417 GGTATATGTGCAGGATGTGCAGG - Intergenic
1116671848 14:47852087-47852109 GGTACATGTGCAGGATGTGCAGG - Intergenic
1116692836 14:48132520-48132542 GGTACATGTGCAGGATGTGCCGG - Intergenic
1116874601 14:50098473-50098495 GGTACATGTGCAGGATGTGCAGG + Intergenic
1116943734 14:50816328-50816350 GGTACATGTGCAGGATGTGCAGG - Intronic
1117080590 14:52148171-52148193 GGTACATGTGCAGGATGTGCAGG - Intergenic
1117310449 14:54517645-54517667 GGTACATGTGCAGGATGTGCAGG + Intronic
1117591976 14:57279651-57279673 GGTACATGTGCAGGATGTGCAGG - Intronic
1117650682 14:57901640-57901662 GGTACATGTGCAGGATGTGCAGG - Intronic
1117829773 14:59739123-59739145 GGTACATGTGCAGGATGTGCAGG - Intronic
1117856989 14:60045293-60045315 AGTACATGTGCAGGATGTGCAGG + Intronic
1117889546 14:60404217-60404239 CCGGGATGTGCAGAATGTGCAGG + Intronic
1118009102 14:61591634-61591656 GGTACATGTGCAGGATGTGCAGG - Intronic
1118060302 14:62130735-62130757 CGTACATGTGCAGAATGTGCAGG + Intergenic
1118129487 14:62946540-62946562 GGTACATGTGCAGGATGTGCAGG + Intronic
1118644779 14:67827499-67827521 GGTACATGTGCAGGATGTGCAGG + Intronic
1118660245 14:68001564-68001586 GGTGCATGTGCAGGATGTGCAGG + Intronic
1118824201 14:69365747-69365769 GGTACATGTGCAGGATGTGCAGG - Intergenic
1119115550 14:72017804-72017826 GGTACATGTGCAGGATGTGCAGG + Intronic
1119987069 14:79149975-79149997 GGTACATGTGCAGGATGTGCAGG - Intronic
1120093065 14:80356227-80356249 GGTATATGTGCAGGATGTGCAGG - Intronic
1120405226 14:84085892-84085914 CGTACATGAGCAGGATGTGCAGG + Intergenic
1120817709 14:88881119-88881141 GGTGTATGTGCAGGATGTGCAGG + Intergenic
1121008724 14:90507367-90507389 GGTACATGTGCAGGATGTGCAGG + Intergenic
1121182868 14:91942609-91942631 GGTACATGTGCAGGATGTGCAGG - Intronic
1121546065 14:94764641-94764663 AGGAAAAGTGCAGGGTGTGCGGG - Intergenic
1122043253 14:99005404-99005426 TGTACATGTGCAGGATGTGCAGG - Intergenic
1122049395 14:99045177-99045199 GGGACATGTGCAGAATGTGCAGG - Intergenic
1122096114 14:99374221-99374243 GGTACATGTGCAGGATGTGCAGG - Intergenic
1123477550 15:20600714-20600736 GGTACATGTGCAGGATGTGCAGG + Intergenic
1123640466 15:22399668-22399690 GGTACATGTGCAGGATGTGCAGG - Intergenic
1124175402 15:27419188-27419210 CTGGAAGGTGCAGGAGGTGCAGG - Intronic
1124398025 15:29321946-29321968 GGTACATGTGCAGGATGTGCAGG - Intronic
1125053823 15:35334421-35334443 GGTAAATGTGCAGGATGTGCAGG + Intronic
1125119501 15:36137732-36137754 GGTACATGTGCAGGATGTGCAGG + Intergenic
1125271609 15:37944891-37944913 GGTACATGTGCAGGATGTGCAGG + Intronic
1125373877 15:39007131-39007153 GGCATATGTGCAGGATGTGCAGG - Intergenic
1125588176 15:40836909-40836931 GGTACATGTGCAGGATGTGCAGG - Intergenic
1126013318 15:44325047-44325069 GGTACATGTGCAGGATGTGCAGG + Intronic
1126176637 15:45742052-45742074 GGTACATGTGCAGGATGTGCAGG - Intergenic
1126379886 15:48035428-48035450 AGAGGATGTGCAGGATGTGCCGG + Intergenic
1126848275 15:52782068-52782090 GGTACATGTGCAGGATGTGCAGG + Intronic
1127054141 15:55114406-55114428 GGTACATGTGCAGGATGTGCAGG + Intergenic
1127202400 15:56670223-56670245 GGAACATGTGCAGGATGTGCAGG + Intronic
1127313663 15:57774744-57774766 TGTAAATGTGCAGGATGTTCAGG + Intronic
1128302846 15:66577858-66577880 GGTATATGTGCAGGATGTGCAGG + Intergenic
1128442186 15:67721161-67721183 GGTACATGTGCAGGATGTGCAGG + Intronic
1128817373 15:70622121-70622143 GGTACATGTGCAGGATGTGCAGG - Intergenic
1128986659 15:72226989-72227011 GGGTGATGTGCAGCATCTGCTGG - Intronic
1129068205 15:72927764-72927786 GGTACATGTGCAGGATGTGCAGG + Intergenic
1129224488 15:74160295-74160317 GGTTCATGTGCAGGATGTTCAGG + Intergenic
1129565722 15:76620973-76620995 AGTACATGTGCAGGATGTGCAGG - Intronic
1129611678 15:77064900-77064922 CTCGAATGTGTAGGATGTGCTGG + Intronic
1129774139 15:78223403-78223425 GGTACATGTGCAGGATGTGCAGG - Intronic
1130408011 15:83619536-83619558 GGTACATGTGCAGGATGTGCAGG - Intergenic
1130515054 15:84619968-84619990 GGTACATGTGCAGGATGTGCAGG + Intronic
1130784218 15:87077949-87077971 GGTACATGTGCAGGATGTGCAGG + Intergenic
1131591400 15:93752774-93752796 AGTACATGTGCAGGATGTGCAGG - Intergenic
1131626054 15:94122059-94122081 GGTACATGTGCAGGATGTGCAGG + Intergenic
1131903821 15:97118610-97118632 GGTACATGTGCAGGATGTGCAGG - Intergenic
1132240642 15:100254971-100254993 GGCACATGTGCAGGATGTGCAGG - Intronic
1132315068 15:100883690-100883712 GGTACATGTGCAGGATGTGCAGG + Intronic
1132315147 15:100884613-100884635 GGTACATGTGCAGGATGTGCAGG + Intronic
1133407749 16:5539156-5539178 AGGGAAAGTGCAGGAAGTGCTGG + Intergenic
1133704377 16:8339526-8339548 GGTATATGTGCAGGATGTGCAGG + Intergenic
1133750506 16:8721588-8721610 CGGTAATCTGCAGGATTGGCTGG - Intronic
1133828859 16:9303266-9303288 GGTACATGTGCAGGATGTGCAGG - Intergenic
1133959070 16:10476524-10476546 GGTACATGTGCAGGATGTGCAGG + Intronic
1134297523 16:12960313-12960335 GGTACATGTGCAGGATGTGCAGG + Intronic
1134321311 16:13166945-13166967 GGTACATGTGCAGGATGTGCAGG - Intronic
1134321758 16:13170607-13170629 GGTACATGTGCAGGATGTGCAGG - Intronic
1134336970 16:13309315-13309337 GGTACATGTGCAGGATGTGCAGG - Intergenic
1134397588 16:13879257-13879279 GGTACATGTGCAGGATGTGCAGG + Intergenic
1134905295 16:17974623-17974645 GGTACATGTGCAGGATGTGCAGG - Intergenic
1135143019 16:19937715-19937737 AGTACATGTGCAGGATGTGCAGG - Intergenic
1135155971 16:20052883-20052905 AGTACATGTGCAGGATGTGCAGG + Intronic
1135838617 16:25852326-25852348 GGTACATGTGCAGGATGTGCAGG + Intronic
1135849684 16:25951938-25951960 GGTACATGTGCAGGATGTGCAGG - Intronic
1135875896 16:26199834-26199856 GGTACATGTGCAGGATGTGCAGG + Intergenic
1135944123 16:26850065-26850087 GGTACATGTGCAGGATGTGCAGG - Intergenic
1135953990 16:26940382-26940404 GGTACATGTGCAGGATGTGCAGG + Intergenic
1136145920 16:28316674-28316696 GGTACATGTGCAGGATGTGCAGG - Intronic
1137064317 16:35823756-35823778 AGTACATGTGCAGGATGTGCAGG + Intergenic
1137359688 16:47802496-47802518 GGTACATGTGCAGGATGTGCAGG - Intergenic
1137464474 16:48695884-48695906 GGTATATGTGCAGGATGTGCAGG + Intergenic
1138121839 16:54406386-54406408 AGTACATGTGCAGGATGTGCAGG - Intergenic
1138176422 16:54902233-54902255 AGTACATGTGCAGGATGTGCAGG + Intergenic
1138233576 16:55359796-55359818 GGTATATGTGCAGGATGTGCAGG - Intergenic
1138691901 16:58776309-58776331 GGTACATGTGCAGGATGTGCAGG - Intergenic
1138702952 16:58883767-58883789 GGTACATGTGCAGGATGTGCAGG + Intergenic
1138795953 16:59969170-59969192 GGTACATGTGCAGGATGTGCAGG + Intergenic
1139067117 16:63331076-63331098 GGTACATGTGCAGGATGTGCAGG + Intergenic
1140256869 16:73345258-73345280 GGAACATGTGCAGGATGTGCAGG + Intergenic
1140301562 16:73762948-73762970 GGTACATGTGCAGGATGTGCAGG - Intergenic
1140343177 16:74185517-74185539 GGTACATGTGCAGGATGTGCAGG + Intergenic
1140655756 16:77137680-77137702 GGTACATGTGCAGGATGTGCAGG + Intergenic
1140758999 16:78094504-78094526 AGTATATGTGCAGGATGTGCAGG + Intergenic
1140808251 16:78553249-78553271 GGTACATGTGCAGGATGTGCAGG - Intronic
1141055992 16:80814956-80814978 GGTACATGTGCAGGATGTGCAGG + Intergenic
1141550527 16:84803829-84803851 GGTACATGTGCAGGATGTGCAGG - Intergenic
1141655951 16:85416602-85416624 CTGAAATGTACAGGATGTGATGG - Intergenic
1142922804 17:3205884-3205906 GGTACATGTGCAGGATGTGCAGG - Intergenic
1142946061 17:3428233-3428255 GGCAAATGTGCAGGATGTACAGG - Intergenic
1143441756 17:6980028-6980050 GGTACATGTGCAGGATGTGCAGG - Intronic
1143829551 17:9640260-9640282 GGTACATGTGCAGGATGTGCAGG + Intronic
1144097598 17:11915736-11915758 TGGTAATTTGCAGGATGAGTAGG - Intronic
1144098878 17:11926276-11926298 GGTACATGTGCAGGATGTGCAGG + Intronic
1144172944 17:12677377-12677399 GGCACATGTGCAGGATGTGCAGG - Intronic
1144616080 17:16774714-16774736 GGTACATGTGCAGGATGTGCAGG + Intronic
1144706604 17:17372553-17372575 GGTACATGTGCAGGATGTGCAGG - Intergenic
1144896625 17:18540948-18540970 GGTACATGTGCAGGATGTGCAGG - Intergenic
1145124353 17:20287828-20287850 GGTACATGTGCAGGATGTGCAGG + Intronic
1145135591 17:20403274-20403296 GGTACATGTGCAGGATGTGCAGG + Intergenic
1145413941 17:22697211-22697233 CAGTAATATGCAGAATGTGCAGG - Intergenic
1145849143 17:28074299-28074321 GGTACATGTGCAGGATGTGCAGG - Intronic
1146462412 17:33056577-33056599 CTGTAATGTGCTGGGTGTTCAGG + Intronic
1146488880 17:33265628-33265650 GGTTCATGTGCAGGACGTGCAGG - Intronic
1149230845 17:54532282-54532304 GGTACATGTGCAGGATGTGCAGG + Intergenic
1149633956 17:58151284-58151306 GGTACATGTGCAGGATGTGCAGG + Intergenic
1150531901 17:65992959-65992981 GGTACATGTGCAGGATGTGCAGG + Intronic
1150846187 17:68660633-68660655 GGTACATGTGCAGGATGTGCAGG - Intergenic
1150856501 17:68758336-68758358 GGTATATGTGCAGGATGTGCAGG - Intergenic
1150939080 17:69670645-69670667 GGTACATGTGCAGGATGTGCAGG + Intergenic
1151049174 17:70957329-70957351 GGTACATGTGCAGGATGTGCAGG + Intergenic
1151146205 17:72043875-72043897 GGTACATGTGCAGGATGTGCAGG + Intergenic
1152046438 17:77939304-77939326 GGTACATGTGCAGGATGTGCAGG - Intergenic
1152466921 17:80471711-80471733 AGGTACTGTGCTGGATGTGGTGG - Exonic
1153146861 18:2043166-2043188 GGTACATGTGCAGGATGTGCAGG - Intergenic
1153328096 18:3842431-3842453 CTATAATGTGCAGGATGAACTGG + Intronic
1153358125 18:4161102-4161124 GGTACATGTGCAGGATGTGCAGG + Intronic
1153507060 18:5811624-5811646 GGGGCATGTGCAGGATGTGCAGG - Intergenic
1153545125 18:6197131-6197153 GGTAGATGTGCAGGATGTGCAGG + Intronic
1153607083 18:6845444-6845466 GGTACATGTGCAGGATGTGCAGG + Intronic
1153870479 18:9314849-9314871 GGTACATGTGCAGGATGTGCAGG - Intergenic
1154023699 18:10687150-10687172 GGTACATGTGCAGGATGTGCAGG + Intronic
1155041395 18:22068256-22068278 AGGTATTGTGGAGGATGTGTGGG + Intergenic
1155499602 18:26473527-26473549 GGTGCATGTGCAGGATGTGCAGG - Intronic
1155624260 18:27816341-27816363 GGTACATGTGCAGGATGTGCAGG + Intergenic
1155676207 18:28432095-28432117 GGTACATGTGCAGGATGTGCAGG + Intergenic
1155876267 18:31093162-31093184 GGTACATGTGCAGGATGTGCAGG + Intronic
1155919069 18:31584883-31584905 GGTACATGTGCAGGATGTGCAGG + Intergenic
1155949130 18:31888883-31888905 TGTACATGTGCAGGATGTGCAGG - Intronic
1156085168 18:33389110-33389132 GGTACATGTGCAGGATGTGCTGG - Intronic
1156208898 18:34917029-34917051 GGGACATGTGCAGGATGTGCAGG - Intergenic
1156328840 18:36100551-36100573 GGTACATGTGCAGGATGTGCAGG + Intergenic
1156433661 18:37102393-37102415 GGTGCATGTGCAGGATGTGCAGG - Intronic
1156550895 18:38015524-38015546 GGTACATGTGCAGGATGTGCAGG + Intergenic
1156685947 18:39646809-39646831 GGAACATGTGCAGGATGTGCAGG + Intergenic
1156695265 18:39758424-39758446 AGTACATGTGCAGGATGTGCAGG - Intergenic
1156885598 18:42131953-42131975 GGTACATGTGCAGGATGTGCAGG + Intergenic
1156964567 18:43075018-43075040 GGTACATGTGCAGGATGTGCAGG - Intronic
1157065657 18:44347282-44347304 CAGTTCTGTGCAGGATGTGCAGG + Intergenic
1157468817 18:47971773-47971795 GGTACATGTGCAGGATGTGCAGG + Intergenic
1158087405 18:53668443-53668465 GGTACATGTGCAGGATGTGCAGG - Intergenic
1158307701 18:56124904-56124926 GGTACATGTGCAGGATGTGCAGG + Intergenic
1158569784 18:58588438-58588460 GGTACATGTGCAGGATGTGCAGG + Intronic
1158754091 18:60301257-60301279 GGTACATGTGCAGGATGTGCAGG - Intergenic
1158765067 18:60441041-60441063 GGTATATGTGCAGGATGTGCAGG + Intergenic
1159327892 18:66947791-66947813 GGTACATGTGCAGGATGTGCAGG - Intergenic
1159385058 18:67712381-67712403 GGTACATGTGCAGGATGTGCGGG - Intergenic
1159772039 18:72557878-72557900 TGTACATGTGCAGGATGTGCAGG - Intronic
1160180587 18:76631918-76631940 GGTACATGTGCAGGATGTGCAGG + Intergenic
1160370644 18:78369790-78369812 GGGTAATGTGCACAACGTGCAGG + Intergenic
1160853846 19:1207093-1207115 CGGCAAGGTGAAGGAGGTGCTGG + Exonic
1161385855 19:3992470-3992492 GGTACATGTGCAGGATGTGCAGG + Intergenic
1161825659 19:6562790-6562812 GGTACATGTGCAGGATGTGCAGG + Intergenic
1161840506 19:6677491-6677513 GGTACATGTGCAGGATGTGCAGG - Intergenic
1163076326 19:14895131-14895153 GGTACATGTGCAGGATGTGCAGG - Intergenic
1163678585 19:18667964-18667986 CGGCGATCTGCAGGAAGTGCCGG - Exonic
1164730285 19:30498562-30498584 GGTACATGTGCAGGATGTGCAGG - Intronic
1165044198 19:33091718-33091740 GGTACATGTGCAGGATGTGCAGG - Intronic
1165225000 19:34348636-34348658 GGTACATGTGCAGGATGTGCAGG + Intronic
1165970501 19:39624743-39624765 GGTACATGTGCAGGATGTGCAGG - Intergenic
1165976009 19:39677468-39677490 AGTACATGTGCAGGATGTGCAGG + Intergenic
1166588748 19:43975658-43975680 GGTACATGTGCAGGATGTGCAGG - Intronic
1166674791 19:44733507-44733529 GGTATATGTGCAGGATGTGCAGG + Intergenic
1167672841 19:50864505-50864527 GGTACATGTGCAGGATGTGCAGG + Intronic
1167691294 19:50984977-50984999 GGTACATGTGCAGGATGTGCAGG + Intergenic
925415002 2:3663544-3663566 GGTACATGTGCAGGATGTGCAGG - Intronic
925420842 2:3710223-3710245 AGTACATGTGCAGGATGTGCAGG + Intronic
925441206 2:3887331-3887353 GGTACATGTGCAGGATGTGCAGG + Intergenic
925487994 2:4357682-4357704 CTGTCATGTGCAAGATGTTCTGG + Intergenic
925508879 2:4602572-4602594 GGTACATGTGCAGGATGTGCAGG + Intergenic
926104831 2:10143572-10143594 CGGTAACGTGCAGGTTGCACTGG + Intronic
926820735 2:16848963-16848985 GGTACATGTGCAGGATGTGCAGG + Intergenic
927298918 2:21487897-21487919 GGTACATGTGCAGGATGTGCAGG + Intergenic
927345437 2:22033320-22033342 GGCACATGTGCAGGATGTGCAGG - Intergenic
929422396 2:41806317-41806339 GGTACATGTGCAGGATGTGCGGG - Intergenic
929677323 2:43950244-43950266 GGTACATGTGCAGGATGTGCAGG + Intronic
929935983 2:46295095-46295117 GGTACATGTGCAGGATGTGCAGG + Intronic
930067055 2:47335671-47335693 GGTACATGTGCAGGATGTGCAGG + Intergenic
930193323 2:48482801-48482823 GGTAAATGTGCAGGATGTGCAGG + Intronic
930249634 2:49021062-49021084 GGTACATGTGCAGGATGTGCAGG - Intronic
930423827 2:51188293-51188315 AGTATATGTGCAGGATGTGCAGG + Intergenic
930463361 2:51712343-51712365 GGTACATGTGCAGGATGTGCAGG + Intergenic
930827715 2:55711030-55711052 GGTACATGTGCAGGATGTGCAGG + Intergenic
930954340 2:57186873-57186895 GGTACATGTGCAGGATGTGCAGG - Intergenic
930977433 2:57480572-57480594 GGTACATGTGCAGGATGTGCAGG + Intergenic
930985680 2:57584919-57584941 GGTACATGTGCAGGATGTGCAGG + Intergenic
931006841 2:57859377-57859399 GGTACATGTGCAGGATGTGCAGG - Intergenic
931100153 2:58989784-58989806 GGTACATGTGCAGGATGTGCTGG - Intergenic
931734783 2:65183901-65183923 GGGTAATGTGCACAATGTGCAGG - Intergenic
931857042 2:66313808-66313830 GGCACATGTGCAGGATGTGCAGG + Intergenic
932272314 2:70421231-70421253 GGTACATGTGCAGGATGTGCAGG - Intergenic
932278177 2:70467162-70467184 GGTACATGTGCAGGATGTGCAGG - Intronic
932512929 2:72313341-72313363 GGTACATGTGCAGGATGTGCAGG - Intronic
932529084 2:72507539-72507561 GGTACATGTGCAGGATGTGCAGG - Intronic
932809460 2:74812127-74812149 GGTACATGTGCAGGATGTGCAGG + Intergenic
932865265 2:75334994-75335016 GGTACATGTGCAGGATGTGCAGG - Intergenic
932883538 2:75526878-75526900 CAGAAGTGTGCAGGATGTGTTGG + Intronic
933137284 2:78753535-78753557 GGTATATGTGCAGGATGTGCAGG - Intergenic
933137537 2:78757089-78757111 GGAACATGTGCAGGATGTGCAGG - Intergenic
933372916 2:81440234-81440256 GGTACATGTGCAGGATGTGCAGG - Intergenic
933404123 2:81836594-81836616 GGTACATGTGCAGGATGTGCAGG + Intergenic
933483090 2:82881844-82881866 GGTACATGTGCAGGATGTGCAGG - Intergenic
933630400 2:84649895-84649917 GGTACATGTGCAGGATGTGCAGG - Intronic
933869641 2:86553161-86553183 GGTGTATGTGCAGGATGTGCCGG - Intronic
934015124 2:87872542-87872564 GGTATATGTGCAGGATGTGCAGG + Intergenic
934793000 2:97078781-97078803 GGTACATGTGCAGGATGTGCAGG + Intergenic
934813187 2:97301702-97301724 GGTACATGTGCAGGATGTGCAGG - Intergenic
934824508 2:97406778-97406800 GGTACATGTGCAGGATGTGCAGG + Intergenic
935618086 2:105106159-105106181 GGGTAATGTGCACAACGTGCAGG - Intergenic
935821620 2:106898569-106898591 GGTACATGTGCAGGATGTGCAGG + Intergenic
935961103 2:108426317-108426339 GGTACATGTGCAGGATGTGCAGG - Intergenic
936633336 2:114228277-114228299 GGTATATGTGCAGGATGTGCAGG + Intergenic
936659781 2:114529706-114529728 GGTAGATGTGCAGGATGTGCAGG + Intronic
936673679 2:114689100-114689122 GGTACATGTGCAGGATGTGCAGG + Intronic
936832463 2:116664383-116664405 GGTACATGTGCAGGATGTGCAGG - Intergenic
936876539 2:117196574-117196596 GGTATATGTGCAGGATGTGCAGG + Intergenic
936974243 2:118203437-118203459 GGTACATGTGCAGGATGTGCAGG + Intergenic
937664533 2:124469597-124469619 GGTAAATGTGCAGGATGTGCAGG + Intronic
937679870 2:124632674-124632696 GGTACATGTGCAGGATGTGCAGG - Intronic
937831378 2:126428161-126428183 TGTACATGTGCAGGATGTGCAGG + Intergenic
937840881 2:126523406-126523428 GGTACATGTGCAGGATGTGCAGG - Intergenic
938136287 2:128760226-128760248 GGTACATGTGCAGGATGTGCAGG + Intergenic
938301367 2:130216208-130216230 GGTAAATGTGCAGAATGTGCAGG - Intergenic
938450131 2:131411144-131411166 TACAAATGTGCAGGATGTGCAGG - Intergenic
938506531 2:131890011-131890033 GGTACATGTGCAGGATGTGCAGG - Intergenic
938675560 2:133630106-133630128 GGTCCATGTGCAGGATGTGCAGG - Intergenic
938996305 2:136682488-136682510 GGTGCATGTGCAGGATGTGCAGG - Intergenic
939119546 2:138100130-138100152 GGTACATGTGCAGGATGTGCAGG - Intergenic
939162411 2:138605905-138605927 GGTTCATGTGCAGGATATGCAGG - Intergenic
939179583 2:138788605-138788627 GGTACATGTGCAGGATGTGCAGG + Intergenic
939521674 2:143239152-143239174 GGTACATGTGCAGGATGTGCAGG - Intronic
939639021 2:144617080-144617102 GGTACATGTGCAGGATGTGCAGG + Intergenic
939975583 2:148713922-148713944 GGTACATGTGCAGGATGTGCAGG + Intronic
940022948 2:149174904-149174926 GGTACATGTGCAGGATGTGCAGG - Intronic
940189097 2:151019885-151019907 GGTACATGTGCAGGATGTGCAGG + Intronic
940194350 2:151076862-151076884 GGTATATGTGCAGGATGTGCAGG - Intergenic
940326329 2:152429145-152429167 GGTACATGTGCAGGATGTGCAGG - Intronic
940326397 2:152430017-152430039 GGTACATGTGCAGGATGTGCAGG - Intronic
940379951 2:153002694-153002716 GGTACATGTGCAGGATGTGCAGG - Intergenic
940417532 2:153439986-153440008 TAGTTCTGTGCAGGATGTGCAGG + Intergenic
940656747 2:156496255-156496277 GGTACATGTGCAGGATGTGCAGG + Intronic
940920661 2:159302840-159302862 GGTACATGTGCAGGATGTGCAGG + Intergenic
941630069 2:167874674-167874696 GGTACATGTGCAGGATGTGCAGG + Intergenic
941927237 2:170908420-170908442 GGTACATGTGCAGGATGTGCAGG - Intergenic
942003825 2:171677875-171677897 TGTATATGTGCAGGATGTGCAGG - Intergenic
942387384 2:175456675-175456697 GGTACATGTGCAGGATGTGCAGG - Intergenic
942581508 2:177423970-177423992 GGTACATGTGCAGGATGTGCAGG + Intronic
943158437 2:184215266-184215288 AGTACATGTGCAGGATGTGCAGG + Intergenic
943353904 2:186826771-186826793 GGTACATGTGCAGGATGTGCAGG - Intergenic
943507892 2:188785086-188785108 AGTGCATGTGCAGGATGTGCAGG + Intronic
943533307 2:189114825-189114847 GGTTTATGTGGAGGATGTGCAGG - Intronic
943645347 2:190403983-190404005 GGTACATGTGCAGGATGTGCAGG + Intergenic
943805949 2:192125992-192126014 GGTACATGTGCAGGATGTGCGGG - Intronic
943936391 2:193921371-193921393 GGTACATGTGCAGGATGTGCGGG - Intergenic
944029856 2:195222302-195222324 AGTACATGTGCAGGATGTGCAGG - Intergenic
944036097 2:195296397-195296419 GGTACATGTGCAGGATGTGCAGG - Intergenic
944116027 2:196187065-196187087 AGTACATGTGCAGGATGTGCAGG + Intergenic
944277620 2:197857103-197857125 GGTACATGTGCAGGATGTGCAGG - Intronic
944342403 2:198617499-198617521 GGTACATGTGCAGGATGTGCAGG - Intergenic
944356719 2:198798375-198798397 GGTGCATGTGCAGGATGTGCAGG - Intergenic
944527167 2:200630969-200630991 GGTACATGTGCAGGATGTGCAGG - Intronic
945159023 2:206870066-206870088 GGTACATGTGCAGGATGTGCAGG - Intergenic
945216488 2:207439786-207439808 AGTACATGTGCAGGATGTGCAGG + Intergenic
945227247 2:207544580-207544602 GGTACATGTGCAGGATGTGCAGG + Intronic
945327926 2:208504785-208504807 CGTACATGTGCAGGATGTTCAGG + Intronic
945343666 2:208687163-208687185 GGGTAATGTGTAGGATGTCCAGG + Intronic
945559121 2:211316213-211316235 GGTGTATGTGCAGGATGTGCAGG - Intergenic
945635080 2:212339032-212339054 GGTACATGTGCAGGATGTGCAGG + Intronic
946125559 2:217559526-217559548 GGTCCATGTGCAGGATGTGCAGG - Intronic
946807948 2:223491081-223491103 GGTACATGTGCAGGATGTGCAGG + Intergenic
947210693 2:227705830-227705852 GGTACATGTGCAGGATGTGCAGG - Intronic
947334338 2:229066414-229066436 TTGAAATGTGAAGGATGTGCAGG + Intronic
947465700 2:230343112-230343134 GGTACATGTGCAGGATGTGCAGG + Intronic
947486582 2:230555431-230555453 GGTACATGTGCAGGATGTGCAGG - Intergenic
947879917 2:233499018-233499040 GGTACATGTGCAGGATGTGCAGG + Intronic
947897909 2:233692606-233692628 CTGTTATGTCCATGATGTGCGGG - Intronic
948226599 2:236315967-236315989 GGTACATGTGCAGGATGTGCAGG - Intergenic
948245185 2:236476767-236476789 GGTATATGTGCAGGATGTGCAGG + Intronic
948260349 2:236599863-236599885 GGTACATGTGCAGGATGTGCAGG + Intergenic
948336260 2:237209551-237209573 GGTACATGTGCAGGATGTGCAGG + Intergenic
948337783 2:237224030-237224052 GGTACATGTGCAGGATGTGCAGG + Intergenic
948606984 2:239142111-239142133 CGGGAATGTGCAGAGTGAGCAGG + Intronic
948669229 2:239556464-239556486 GGTACATGTGCAGGATGTGCAGG + Intergenic
1168744463 20:226382-226404 GGTATATGTGCAGGATGTGCTGG - Intergenic
1169604092 20:7295999-7296021 AGTACATGTGCAGGATGTGCAGG + Intergenic
1169773747 20:9229721-9229743 GGCATATGTGCAGGATGTGCAGG + Intronic
1169897326 20:10518136-10518158 GGTACATGTGCAGGATGTGCAGG - Intronic
1170005222 20:11661377-11661399 GGTACATGTGCAGGATGTGCAGG + Intergenic
1170051033 20:12145489-12145511 GGTACATGTGCAGGATGTGCAGG + Intergenic
1170062276 20:12271796-12271818 GGTACATGTGCAGGATGTGCAGG + Intergenic
1170398620 20:15955923-15955945 GGTACATGTGCAGGATGTGCAGG - Intronic
1170769107 20:19316859-19316881 GGTACATGTGCAGGATGTGCAGG + Intronic
1172848891 20:37946338-37946360 GGTGCATGTGCAGGATGTGCAGG + Intergenic
1173462564 20:43255187-43255209 GGTGCATGTGCAGGATGTGCAGG - Intergenic
1173698312 20:45042869-45042891 GGCACATGTGCAGGATGTGCTGG + Intronic
1173773920 20:45687038-45687060 GGTACATGTGCAGGATGTGCAGG + Intronic
1173777299 20:45720819-45720841 GGTACATGTGCAGGATGTGCAGG - Intergenic
1174880516 20:54274245-54274267 GGTACATGTGCAGGATGTGCAGG + Intergenic
1174887952 20:54356379-54356401 GGTACATGTGCAGGATGTGCAGG - Intergenic
1174902019 20:54510077-54510099 GGTACATGTGCAGGATGTGCAGG - Intronic
1174964626 20:55198359-55198381 GGTACATGTGCAGGATGTGCAGG - Intergenic
1175014658 20:55776645-55776667 AGTACATGTGCAGGATGTGCAGG + Intergenic
1175321818 20:58093502-58093524 GGTACATGTGCAGGATGTGCAGG + Intergenic
1176413737 21:6463020-6463042 CGGAAAAGTGCAGGCTGGGCCGG + Intergenic
1176521102 21:7825139-7825161 GGAACATGTGCAGGATGTGCAGG - Intronic
1176997250 21:15569946-15569968 GGTACATGTGCAGGATGTGCAGG - Intergenic
1177448134 21:21225373-21225395 GGTACATGTGCAGGATGTGCAGG - Intronic
1177721534 21:24913407-24913429 GGTGCATGTGCAGGATGTGCAGG - Intergenic
1177769576 21:25499510-25499532 GGTACATGTGCAGGATGTGCAGG - Intergenic
1177856010 21:26400883-26400905 GGTACATGTGCAGGATGTGCAGG + Intergenic
1177971339 21:27793602-27793624 GGTGCATGTGCAGGATGTGCAGG - Intergenic
1177985708 21:27972366-27972388 GGTACATGTGCAGGATGTGCAGG + Intergenic
1178125142 21:29508006-29508028 GGTACATGTGCAGGATGTGCAGG + Intronic
1178388242 21:32174491-32174513 GGTACATGTGCAGGATGTGCAGG - Intergenic
1178655122 21:34455151-34455173 GGAACATGTGCAGGATGTGCAGG - Intergenic
1178812930 21:35899923-35899945 GGTACATGTGCAGGATGTGCAGG - Intronic
1179119966 21:38534979-38535001 GGGACATGTGCAGGATGTGCAGG + Intronic
1179204974 21:39267974-39267996 CTGCTGTGTGCAGGATGTGCAGG - Intronic
1179355176 21:40652278-40652300 GGCACATGTGCAGGATGTGCAGG - Intronic
1179440711 21:41391851-41391873 GGTACATGTGCAGGATGTGCAGG + Intronic
1179559030 21:42200953-42200975 GGTACATGTGCAGGATGTGCAGG + Intronic
1179689235 21:43071342-43071364 CGGAAAAGTGCAGGCTGGGCCGG + Intronic
1179813623 21:43888502-43888524 GGTACATGTGCAGGATGTGCAGG - Intronic
1179918169 21:44491523-44491545 GGTACATGTGCAGGATGTGCAGG + Intergenic
1180046176 21:45306770-45306792 CGGTGAGGTGCAGGCTCTGCTGG + Intergenic
1180173718 21:46077235-46077257 GGTACATGTGCAGGATGTGCAGG - Intergenic
1180759349 22:18187786-18187808 GGTACATGTGCAGGATGTGCAGG - Intergenic
1180769657 22:18372082-18372104 GGTACATGTGCAGGATGTGCAGG - Intergenic
1180776671 22:18490584-18490606 GGTACATGTGCAGGATGTGCAGG + Intergenic
1180809400 22:18747950-18747972 GGTACATGTGCAGGATGTGCAGG + Intergenic
1180827597 22:18875043-18875065 GGTACATGTGCAGGATGTGCAGG - Intergenic
1181145964 22:20847248-20847270 GGTTCATGTGCAGGATGTGCAGG - Intronic
1181195390 22:21181870-21181892 GGTACATGTGCAGGATGTGCAGG + Intergenic
1181214057 22:21310904-21310926 GGTACATGTGCAGGATGTGCAGG - Intergenic
1181524502 22:23472535-23472557 GGTACATGTGCAGGATGTGCAGG - Intergenic
1181917290 22:26291563-26291585 GGCCTATGTGCAGGATGTGCAGG - Intronic
1182777519 22:32841807-32841829 GGTACATGTGCAGGATGTGCAGG - Intronic
1182980094 22:34661694-34661716 GGTACATGTGCAGGATGTGCAGG + Intergenic
1182980642 22:34667584-34667606 GGGAAACGTGCAGAATGTGCAGG + Intergenic
1183794905 22:40108798-40108820 GGTACATGTGCAGGATGTGCAGG + Intronic
1184220019 22:43094084-43094106 AGGTATTGTCCAGGATGTGGAGG - Intergenic
1184524346 22:45012990-45013012 TGGTAATGTGAAGGATATGGTGG + Intergenic
1203231488 22_KI270731v1_random:113269-113291 GGTACATGTGCAGGATGTGCAGG - Intergenic
1203277694 22_KI270734v1_random:101035-101057 GGTACATGTGCAGGATGTGCAGG - Intergenic
949240886 3:1870101-1870123 GGTACATGTGCAGGATGTGCAGG - Intergenic
949711941 3:6881159-6881181 GGTACATGTGCAGGATGTGCAGG + Intronic
949896715 3:8772768-8772790 AGTTCATGTGCAGTATGTGCAGG + Intronic
950323159 3:12077340-12077362 GGCACATGTGCAGGATGTGCAGG + Intronic
950401227 3:12770487-12770509 GGTACATGTGCAGGATGTGCAGG - Intergenic
950684471 3:14606601-14606623 GGTACATGTGCAGGATGTGCAGG - Intergenic
950929742 3:16776395-16776417 GGTACATGTGCAGGATGTGCGGG - Intergenic
951008710 3:17650250-17650272 GGTACATGTGCAGGATGTGCAGG - Intronic
951310471 3:21119335-21119357 GGGACATGTGCAGGATGTGCAGG - Intergenic
951747911 3:25999596-25999618 GGTACATGTGCAGGATGTGCAGG + Intergenic
951755414 3:26086165-26086187 GGTACATGTGCAGGATGTGCTGG + Intergenic
951859497 3:27236256-27236278 TGTACATGTGCAGGATGTGCAGG - Intronic
951897115 3:27620125-27620147 CGTATATATGCAGGATGTGCAGG + Intergenic
951919146 3:27834443-27834465 GGTACATGTGCAGGATGTGCAGG + Intergenic
951921426 3:27858919-27858941 GGTACATGTGCAGGATGTGCAGG - Intergenic
951930241 3:27957662-27957684 GGTACATGTGCAGGATGTGCAGG + Intergenic
952199990 3:31116283-31116305 AGTACATGTGCAGGATGTGCAGG - Intergenic
952396444 3:32924861-32924883 GGTACATGTGCAGGATGTGCAGG + Intergenic
952525123 3:34202068-34202090 GGTACATGTGCAGGATGTGCAGG + Intergenic
952614591 3:35254706-35254728 GGTACATGTGCAGGATGTGCAGG - Intergenic
952695585 3:36262033-36262055 GGTATATGTGCAGGATGTGCAGG + Intergenic
953187822 3:40654721-40654743 GGTACATGTGCAGGATGTGCAGG + Intergenic
953261703 3:41345749-41345771 TGTACATGTGCAGGATGTGCAGG - Intronic
953446894 3:42976137-42976159 CAGTAATGTGCAGGATGGATTGG + Intronic
954107636 3:48417975-48417997 CCAGCATGTGCAGGATGTGCTGG - Exonic
954474636 3:50732380-50732402 GGTACATGTGCAGGATGTGCAGG - Intronic
954506064 3:51074821-51074843 GGTACATGTGCAGGATGTGCAGG - Intronic
955053356 3:55433589-55433611 GGTACATGTGCAGGATGTGCAGG - Intergenic
955275305 3:57541424-57541446 CTGTAGTGTGCAAGATGTGATGG - Intronic
955801542 3:62691897-62691919 GGTACATGTGCAGGATGTGCAGG - Intronic
955898193 3:63723450-63723472 GGTACATGTGCAGGATGTGCAGG - Intergenic
956124544 3:65999093-65999115 GGTACATGTGCAGGATGTGCAGG + Intronic
956187219 3:66574184-66574206 GGTACATGTGCAGGATGTGCAGG + Intergenic
956299540 3:67755393-67755415 GGTACATGTGCAGGATGTGCAGG - Intergenic
956434397 3:69219642-69219664 GGCACATGTGCAGGATGTGCAGG + Intronic
956535793 3:70274723-70274745 GGTACATGTGCAGGATGTGCAGG - Intergenic
956876000 3:73463913-73463935 GGGTAACGTGCAGGATGTGCAGG - Intronic
957212464 3:77277320-77277342 TGTACATGTGCAGGATGTGCAGG + Intronic
957232718 3:77540699-77540721 TGTGCATGTGCAGGATGTGCGGG - Intronic
957507144 3:81136696-81136718 GGTACATGTGCAGGATGTGCAGG + Intergenic
957914100 3:86663654-86663676 GGTAAATGTGCAGGATATGCAGG - Intergenic
958004009 3:87789551-87789573 GGTACATGTGCAGGATGTGCAGG - Intergenic
958515279 3:95107516-95107538 GGTGCATGTGCAGGATGTGCAGG + Intergenic
958643368 3:96837897-96837919 GGTAAATATGCAGGATGTGCAGG + Intronic
958769935 3:98414201-98414223 GGTACATGTGCAGGATGTGCAGG + Intergenic
958793069 3:98674605-98674627 GGTACATGTGCAGGATGTGCAGG + Intergenic
958861457 3:99449747-99449769 GGTACATGTGCAGGATGTGCAGG + Intergenic
959097894 3:101975449-101975471 GGTACATGTGCAGGATGTGCAGG - Intergenic
959349857 3:105248543-105248565 GGGACATATGCAGGATGTGCAGG - Intergenic
959766729 3:110039776-110039798 GGTACATGTGCAGGATGTGCAGG + Intergenic
959890647 3:111551583-111551605 GGTACATGTGCAGGATGTGCAGG + Intronic
960192941 3:114729038-114729060 GGCACATGTGCAGGATGTGCAGG - Intronic
960234769 3:115269188-115269210 AGTGCATGTGCAGGATGTGCAGG - Intergenic
960235209 3:115274023-115274045 GGTACATGTGCAGGATGTGCAGG + Intergenic
960332324 3:116377096-116377118 GGTACATGTGCAGGATGTGCAGG + Intronic
960432498 3:117586474-117586496 GGTACATGTGCAGGATGTGCAGG - Intergenic
960447393 3:117764882-117764904 AGTACATGTGCAGGATGTGCAGG + Intergenic
960745834 3:120887218-120887240 GGGATATGTGCAGAATGTGCAGG - Intergenic
960874102 3:122279822-122279844 GGTACATGTGCAGGATGTGCAGG + Intronic
960905087 3:122592563-122592585 GGTACATGTGCAGGATGTGCAGG - Intronic
961834091 3:129642186-129642208 GGTACATGTGCAGGATGTGCAGG + Intergenic
961901189 3:130213472-130213494 GGTACATGTGCAGGATGTGCAGG + Intergenic
962002676 3:131315577-131315599 GGTACATGTGCAGGATGTGCAGG + Intronic
962010920 3:131390006-131390028 GGTTCATGTGCAGAATGTGCAGG - Intergenic
962164607 3:133036299-133036321 GGTACATGTGCAGGATGTGCAGG - Intergenic
962667804 3:137673133-137673155 GGTACATGTGCAGGATGTGCAGG + Intergenic
963312721 3:143726194-143726216 GGTGCATGTGCAGGATGTGCAGG - Intronic
963415602 3:144992151-144992173 GGTACATGTGCAGGATGTGCAGG + Intergenic
963612196 3:147484382-147484404 GGTACATGTGCAGGATGTGCGGG + Intronic
963680778 3:148372976-148372998 GGTACATGTGCAGGATGTGCAGG + Intergenic
963755069 3:149226518-149226540 GGTACATGTGCAGGATGTGCAGG + Intergenic
963988489 3:151626033-151626055 TGCAGATGTGCAGGATGTGCAGG + Intergenic
964137863 3:153365710-153365732 CATATATGTGCAGGATGTGCAGG + Intergenic
964153428 3:153556834-153556856 GGTACATGTGCAGGATGTGCAGG + Intergenic
964243025 3:154617789-154617811 GGTACATGTGCAGGATGTGCAGG - Intergenic
964302237 3:155301304-155301326 GGTACATGTGCAGGATGTGCAGG - Intergenic
964458606 3:156896319-156896341 GGTACATGTGCAGGATGTGCAGG - Intronic
964606179 3:158562665-158562687 GGTACATGTGCAGGATGTGCAGG - Intergenic
964608079 3:158580259-158580281 GGTACATGTGCAGGATGTGCAGG - Intronic
964815038 3:160707894-160707916 GGTACATGTGCAGGATGTGCAGG - Intergenic
965240324 3:166188760-166188782 GGTAAATGTGCAGGATGTGTAGG - Intergenic
965256352 3:166418490-166418512 TGTATATGTGCAGGATGTGCAGG + Intergenic
965387642 3:168063842-168063864 GGTACATGTGCAGGATGTGCAGG - Intronic
965805260 3:172535467-172535489 GGTACATGTGCAGGATGTGCAGG + Intergenic
965808405 3:172566650-172566672 GGTATATGTGCAGGATGTGCAGG + Intergenic
965809229 3:172575262-172575284 GGTACATGTGCAGGATGTGCAGG + Intergenic
966049196 3:175593031-175593053 AGGTACAGTGCAGGATGTGCAGG + Intronic
966080485 3:175994107-175994129 GGTACATGTGCAGGATGTGCAGG + Intergenic
966082994 3:176028375-176028397 GGTACATGTGCAGGATGTGCAGG + Intergenic
966228598 3:177625832-177625854 GGTACATGTGCAGGATGTGCAGG + Intergenic
966329851 3:178798848-178798870 GGTACATGTGCAGGATGTGCAGG - Intronic
966331340 3:178818293-178818315 GGTACATGTGCAGGATGTGCAGG + Intronic
966377145 3:179307886-179307908 GGTACATGTGCAGGATGTGCAGG - Intergenic
966673642 3:182560501-182560523 GGTACATGTGCAGGATGTGCAGG + Intergenic
967077775 3:186020026-186020048 GGTACATGTGCAGGATGTGCAGG - Intergenic
967105257 3:186250449-186250471 GGTACATGTGCAGGATGTGCAGG - Intronic
967396012 3:189009818-189009840 GGTACATGTGCAGGATGTGCAGG + Intronic
967405052 3:189106016-189106038 GGTACATGTGCAGGATGTGCAGG - Intronic
967501294 3:190201127-190201149 GGTACATGTGCAGGATGTGCAGG - Intergenic
967575318 3:191083033-191083055 CGTACATGTACAGGATGTGCAGG - Intergenic
967593527 3:191304691-191304713 GGTACATGTGCAGGATGTGCAGG + Intronic
967767490 3:193297085-193297107 GGTACATGTGCAGGATGTGCAGG - Intronic
969834618 4:9830486-9830508 GGTACATGTGCAGGATGTGCAGG - Intronic
969913244 4:10464272-10464294 GGTACATGTGCAGGATGTGCAGG + Intergenic
970000243 4:11357760-11357782 GGTACATGTGCAGGATGTGCAGG + Intergenic
970290879 4:14570955-14570977 GGTACATGTGCAGGATGTGCAGG + Intergenic
970321156 4:14876904-14876926 GGTACATGTGCAGGATGTGCAGG - Intergenic
970328017 4:14948510-14948532 GGTACATGTGCAGGATGTGCAGG - Intergenic
970473835 4:16402411-16402433 GGGTAATGTGCACAATGTGCAGG + Intergenic
970557829 4:17253497-17253519 GGTACATGTGCAGGATGTGCAGG + Intergenic
970736354 4:19173561-19173583 GGTACATGTGCAGGATGTGCAGG - Intergenic
970874247 4:20851063-20851085 GGTACATGTGCAGGATGTGCAGG + Intronic
971038638 4:22724934-22724956 GGTACATGTGCAGGATGTGCAGG + Intergenic
971214988 4:24654399-24654421 GGTACATGTGCAGGATGTGCAGG + Intergenic
971507518 4:27382375-27382397 GGTACATGTGCAGGATGTGCAGG + Intergenic
971620163 4:28845501-28845523 GGTGCATGTGCAGGATGTGCAGG + Intergenic
972318778 4:37952752-37952774 GGTACATGTGCAGGATGTGCAGG - Intronic
972330480 4:38059746-38059768 GGTACATGTGCAGGATGTGCAGG + Intronic
972721681 4:41705734-41705756 GGAACATGTGCAGGATGTGCAGG - Intergenic
972838371 4:42902806-42902828 GGTACATGTGCAGGATGTGCAGG - Intronic
972989636 4:44808806-44808828 GGTACATGTGCAGGATGTGCGGG + Intergenic
973284236 4:48397529-48397551 GGTACATGTGCAGGATGTGCAGG + Intronic
973544541 4:51967272-51967294 GGTACATGTGCAGGATGTGCAGG + Intergenic
973857405 4:55026823-55026845 GGTACATGTGCAGGATGTGCAGG - Intergenic
974104949 4:57459191-57459213 GGTACATGTGCAGGATGTGCAGG - Intergenic
974233250 4:59145606-59145628 GGTACATGTGCAGGATGTGCAGG + Intergenic
974668676 4:64999912-64999934 GGTACATGTGCAGGATGTGCAGG - Intergenic
974901701 4:68007186-68007208 GGTACATGTGCAGGATGTGCAGG - Intergenic
974979788 4:68940654-68940676 GGTACATGTGCAGGATGTGCAGG - Intronic
975023140 4:69515865-69515887 GGTACATGTGCAGGATGTGCAGG + Intronic
975153918 4:71049879-71049901 GGTACATGTGCAGGATGTGCAGG - Intergenic
975370867 4:73585865-73585887 GGGTAATGTGCACAATGTGCAGG + Intronic
975660051 4:76679740-76679762 TGGTTATGTGCAGGATGGACAGG - Intronic
975680549 4:76871232-76871254 GGTACATGTGCAGGATGTGCAGG - Intergenic
975751431 4:77527811-77527833 TGGTAATGTGCATAACGTGCAGG + Intronic
975889723 4:79012825-79012847 GGGAGATGTGCAGGATGTGCAGG - Intergenic
976164294 4:82237645-82237667 GGTACATGTGCAGGATGTGCAGG - Intergenic
976219612 4:82745532-82745554 GGTACATGTGCAGGATGTGCAGG + Intronic
976396083 4:84557134-84557156 GGTACATGTGCAGGATGTGCAGG - Intergenic
976714071 4:88104627-88104649 GGTACATGTGCAGGATGTGCAGG - Intronic
976752284 4:88461494-88461516 AGATATTGTGCAGGATGTGGTGG - Intronic
977140184 4:93361857-93361879 AGGAAACGTGCAGGATGTGCAGG + Intronic
977141426 4:93376943-93376965 GGTACATGTGCAGGATGTGCAGG - Intronic
977167156 4:93713960-93713982 GGTATATGTGCAGGATGTGCAGG + Intronic
977385456 4:96333481-96333503 GGTACATGTGCAGGATGTGCAGG - Intergenic
977520184 4:98072516-98072538 GGTACATGTGCAGGATGTGCAGG - Intronic
977578313 4:98698212-98698234 GGTAAATGTGCAGGATGTGCAGG + Intergenic
977582146 4:98737077-98737099 GGTACATGTGCAGGATGTGCAGG + Intergenic
977619814 4:99123832-99123854 GGTACATGTGCAGGATGTGCAGG + Exonic
977656982 4:99534004-99534026 GGTACATGTGCAGGATGTGCAGG + Intronic
977775300 4:100912361-100912383 GGTATATGTGCAGGATGTGCAGG - Intergenic
977912869 4:102558058-102558080 GTTTTATGTGCAGGATGTGCAGG + Intronic
977999804 4:103543494-103543516 GGTACATGTGCAGGATGTGCAGG - Intergenic
978063471 4:104366950-104366972 GGTACATGTGCAGGATGTGCAGG - Intergenic
978112905 4:104984475-104984497 GGTACATGTGCAGGATGTGCAGG - Intergenic
978166069 4:105608729-105608751 GGTACATGTGCAGGATGTGCAGG + Intronic
978492949 4:109328221-109328243 GGTACATGTGCAGGATGTGCAGG - Intergenic
978800573 4:112751837-112751859 AGGGGATGTGGAGGATGTGCTGG + Intergenic
978998672 4:115189031-115189053 GGTACATGTGCAGGATGTGCAGG + Intergenic
979174781 4:117650206-117650228 AGTACATGTGCAGGATGTGCAGG - Intergenic
979310441 4:119197205-119197227 GGTACATGTGCAGGATGTGCAGG - Intronic
979338153 4:119487653-119487675 GGTACATGTGCAGGATGTGCAGG - Intergenic
979493016 4:121351063-121351085 TGTACATGTGCAGGATGTGCAGG - Intronic
979517192 4:121623237-121623259 GGTACATGTGCAGGATGTGCAGG + Intergenic
979842653 4:125464551-125464573 GGGTAATGTGCACAACGTGCAGG + Intronic
979853676 4:125605542-125605564 GGTACATGTGCAGGATGTGCAGG + Intergenic
979967610 4:127094253-127094275 GGTGCATGTGCAGGATGTGCAGG - Intergenic
980021583 4:127717016-127717038 GGTACATGTGCAGGATGTGCAGG + Exonic
980472997 4:133273817-133273839 GGTACATGTGCAGGATGTGCAGG + Intergenic
980647038 4:135654941-135654963 GGGTAATGTGCACAACGTGCAGG - Intergenic
980665537 4:135929038-135929060 GGTACATGTGCAGGATGTGCAGG + Intergenic
980851589 4:138388908-138388930 GGTACATGTGCAGGATGTGCAGG + Intergenic
980952119 4:139391447-139391469 TGGTAATGTACAGGAGGTTCTGG + Intronic
981410162 4:144420552-144420574 AGTACATGTGCAGGATGTGCAGG + Intergenic
981790455 4:148530466-148530488 GGTACATGTGCAGGATGTGCAGG + Intergenic
981866080 4:149420600-149420622 GGTCCATGTGCAGGATGTGCAGG - Intergenic
981885578 4:149668617-149668639 GGGAAACGTGCAGAATGTGCAGG - Intergenic
982213655 4:153061592-153061614 GGTACATGTGCAGGATGTGCAGG - Intergenic
982525644 4:156474356-156474378 GGTACATGTGCAGGATGTGCAGG - Intergenic
982572025 4:157062320-157062342 AGTACATGTGCAGGATGTGCAGG - Intergenic
982674679 4:158361996-158362018 GGTACATGTGCAGGATGTGCAGG - Intronic
983123445 4:163917643-163917665 GGTACATGTGCAGGATGTGCAGG + Intronic
983383640 4:167028945-167028967 GGTACATGTGCAGGATGTGCAGG + Intronic
983478506 4:168244217-168244239 GGCACATGTGCAGGATGTGCAGG - Intronic
984202319 4:176739718-176739740 GGTTCATGTGCAGGATGTGTAGG - Intronic
984602417 4:181743837-181743859 GGTACATGTGCAGGATGTGCAGG + Intergenic
984894234 4:184522441-184522463 GGTACATGTGCAGGATGTGCAGG + Intergenic
985232506 4:187836251-187836273 GGTACATGTGCAGGATGTGCAGG + Intergenic
985272203 4:188204491-188204513 GGTGCATGTGCAGGATGTGCAGG - Intergenic
985806860 5:2052077-2052099 GGGACGTGTGCAGGATGTGCAGG + Intergenic
985990329 5:3552505-3552527 GGTACATGTGCAGGATGTGCAGG - Intergenic
985991011 5:3561306-3561328 GGCACATGTGCAGGATGTGCAGG + Intergenic
986408275 5:7448504-7448526 GGTACATGTGCAGGATGTGCAGG + Intronic
986548792 5:8929489-8929511 GGTACATGTGCAGGATGTGCAGG + Intergenic
986598676 5:9449536-9449558 GGTACATGTGCAGGATGTGCAGG - Intronic
986725897 5:10596187-10596209 GGCACATGTGCAGGATGTGCAGG + Intronic
987256487 5:16158728-16158750 GGTACATGTGCAGGATGTGCAGG + Intronic
987290467 5:16503923-16503945 GGTACATGTGCAGGATGTGCAGG + Intronic
987431244 5:17836209-17836231 CATACATGTGCAGGATGTGCAGG + Intergenic
987471219 5:18331003-18331025 GGTACATGTGCAGGATGTGCAGG + Intergenic
987596914 5:20013032-20013054 AGTACATGTGCAGGATGTGCAGG - Intronic
987738350 5:21873655-21873677 AGGACATGTGCAGGATGTGCAGG + Intronic
987852137 5:23369723-23369745 GGTACATGTGCAGGATGTGCAGG + Intergenic
987855020 5:23410509-23410531 TTTTAATGTGCAGGATGTGCAGG + Intergenic
988110974 5:26818878-26818900 GGTACATGTGCAGGATGTGCAGG - Intergenic
988434929 5:31163133-31163155 GGTACATGTGCAGGATGTGCGGG - Intergenic
988657142 5:33224992-33225014 AGTACATGTGCAGGATGTGCAGG + Intergenic
988699133 5:33655672-33655694 GGATAATGTGCAGAATGTGCAGG + Intronic
989085685 5:37673634-37673656 GGTACATGTGCAGGATGTGCAGG + Intronic
989243171 5:39223079-39223101 GGTACATGTGCAGGATGTGCAGG - Intronic
989251074 5:39316372-39316394 GGTACATGTGCAGGATGTGCAGG + Intronic
989618463 5:43360849-43360871 GGTACATGTGCAGGATGTGCAGG + Intergenic
989722489 5:44545983-44546005 GGTACATGTGCAGGATGTGCAGG - Intergenic
989822725 5:45814541-45814563 GGTACATGTGCAGGATGTGCAGG - Intergenic
990006831 5:50953964-50953986 GGTACATGTGCAGGATGTGCAGG - Intergenic
990228964 5:53689728-53689750 GGTACATGTGCAGGATGTGCAGG - Intergenic
990317845 5:54600952-54600974 AGTACATGTGCAGGATGTGCAGG - Intergenic
990325979 5:54675654-54675676 GGTACATGTGCAGGATGTGCAGG - Intergenic
990630051 5:57658901-57658923 GGGACATGTGCAGGATATGCTGG + Intergenic
990738965 5:58893012-58893034 GGTACATGTGCAGGATGTGCAGG - Intergenic
990752357 5:59030861-59030883 GGTACATGTGCAGGATGTGCAGG + Intronic
990858492 5:60299418-60299440 GGTACATGTGCAGGATGTGCAGG + Intronic
991166940 5:63574594-63574616 GGTACATGTGCAGGATGTGCAGG + Intergenic
991228208 5:64297924-64297946 GGTACATGTGCAGGATGTGCAGG + Intronic
991243270 5:64483203-64483225 CGGTAATGTGCACAATGTGCAGG - Intergenic
991326781 5:65442697-65442719 GGTACATGTGCAGGATGTGCAGG + Intronic
991347058 5:65680298-65680320 GGTAAATGTGCAGGATGTGCAGG - Intronic
991539772 5:67714600-67714622 GTTTAATGTACAGGATGTGCAGG + Intergenic
992265704 5:75016277-75016299 ACATAATATGCAGGATGTGCAGG - Intergenic
992582043 5:78189194-78189216 GGTACATGTGCAGGATGTGCAGG - Intronic
992672229 5:79071785-79071807 GGTACATGTGCAGGATGTGCAGG - Intronic
992864682 5:80945903-80945925 GGTACATGTGCAGGATGTGCAGG + Intergenic
993006815 5:82437453-82437475 GGGACATGTGCAGGATGCGCAGG + Intergenic
993286549 5:86006681-86006703 GGTAATTGTGCAGGATGTGCAGG + Intergenic
993460497 5:88175936-88175958 GGTACATGTGCAGGATGTGCAGG + Intergenic
993556734 5:89348682-89348704 AGTACATGTGCAGGATGTGCAGG - Intergenic
994388120 5:99157343-99157365 GGTACATGTGCAGGATGTGCAGG + Intergenic
995101003 5:108305442-108305464 AGTACATGTGCAGGATGTGCAGG - Intronic
995329149 5:110927531-110927553 GGTACATGTGCAGGATGTGCAGG + Intergenic
995630896 5:114131151-114131173 GGTACATGTGCAGGATGTGCAGG + Intergenic
995665817 5:114541019-114541041 GGTACATGTGCAGGATGTGCAGG + Intergenic
995804595 5:116037387-116037409 CTGTGATATGCAGGATGTGTGGG - Intronic
995939762 5:117567572-117567594 GGTACATGTGCAGGATGTGCAGG - Intergenic
996006449 5:118426630-118426652 GGTAAATGTGCAAGATGTGCAGG - Intergenic
996263908 5:121511428-121511450 GGTACATGTGCAGGATGTGCAGG + Intergenic
996700354 5:126444720-126444742 GGTATATGTGCAGGATGTGCAGG + Intronic
997051274 5:130383508-130383530 GGTACATGTGCAGGATGTGCAGG - Intergenic
997754394 5:136382658-136382680 GGTACATGTGCAGGATGTGCAGG + Intronic
998577477 5:143332520-143332542 GGTACATGTGCAGGATGTGCAGG - Intronic
998604808 5:143622658-143622680 GGCACATGTGCAGGATGTGCAGG - Intergenic
998740417 5:145194435-145194457 GGTACATGTGCAGGATGTGCAGG + Intergenic
998760388 5:145425808-145425830 CATATATGTGCAGGATGTGCAGG - Intergenic
998898938 5:146831582-146831604 GGTACATGTGCAGGATGTGCAGG - Intronic
998905524 5:146900653-146900675 AGGATGTGTGCAGGATGTGCAGG + Intronic
998910180 5:146951375-146951397 TGTATATGTGCAGGATGTGCAGG + Intronic
999194419 5:149772284-149772306 CGGTAGTGTGCGTGATGTGCTGG + Intronic
999828183 5:155293938-155293960 AGGTAATATGAAGGTTGTGCTGG + Intergenic
999948265 5:156620870-156620892 GTGTACTGTGCAGGATGTGGTGG + Intronic
1000203055 5:159030840-159030862 CTGTAGTGTGCATGATGGGCTGG + Intronic
1000293811 5:159895628-159895650 AGTACATGTGCAGGATGTGCAGG - Intergenic
1000430394 5:161144570-161144592 GGTTCAAGTGCAGGATGTGCAGG - Intergenic
1000845776 5:166278934-166278956 GGTATATGTGCAGGATGTGCAGG + Intergenic
1000908063 5:166987680-166987702 CGGTCATTTTTAGGATGTGCCGG + Intergenic
1001136393 5:169106171-169106193 GGTTCAGGTGCAGGATGTGCAGG - Intronic
1001302645 5:170547396-170547418 GGTACATGTGCAGGATGTGCAGG + Intronic
1001857312 5:175024246-175024268 GGTACATGTGCAGGATGTGCAGG + Intergenic
1002938103 6:1691478-1691500 GGACCATGTGCAGGATGTGCAGG - Intronic
1002967777 6:1984346-1984368 GGTACATGTGCAGGATGTGCAGG - Intronic
1003229771 6:4241541-4241563 GGTACATGTGCAGGATGTGCAGG + Intergenic
1003479795 6:6520427-6520449 GGTACATGTGCAGGATGTGCAGG - Intergenic
1003492256 6:6633423-6633445 GGTACATGTGCAGGATGTGCAGG + Intronic
1003815512 6:9835999-9836021 AGTACATGTGCAGGATGTGCAGG + Intronic
1003856744 6:10284034-10284056 GGTACATGTGCAGGATGTGCAGG - Intergenic
1003883656 6:10501197-10501219 GGTACATGTGCAGGATGTGCAGG - Intronic
1004209824 6:13627938-13627960 GGTACATGTGCAGGATGTGCAGG - Intronic
1004239809 6:13910396-13910418 GGTACATGTGCAGGATGTGCAGG - Intergenic
1004352409 6:14901886-14901908 GGTATATGTGCAGGATGTGCAGG - Intergenic
1004610013 6:17231076-17231098 GGTACATGTGCAGGATGTGCAGG - Intergenic
1004776432 6:18851045-18851067 GGTAAATGTGCAGGATGTGTAGG - Intergenic
1004983598 6:21055403-21055425 GGTACATGTGCAGGATGTGCAGG + Intronic
1005151787 6:22760043-22760065 GGTACATGTGCAGGATGTGCAGG + Intergenic
1006211450 6:32398950-32398972 GGTACATGTGCAGGATGTGCAGG + Intronic
1006251378 6:32789263-32789285 GGTACATGTGCAGGATGTGCAGG - Intergenic
1006557889 6:34884557-34884579 GGTACATGTGCAGGATGTGCAGG - Intronic
1007632335 6:43279406-43279428 CCCTACTGGGCAGGATGTGCTGG + Intronic
1007964986 6:45996090-45996112 GGTACATGTGCAGGATGTGCAGG - Intronic
1008255114 6:49289266-49289288 GGTAAATGTGCAAGATGTGCAGG + Intergenic
1008261919 6:49377168-49377190 GGCACATGTGCAGGATGTGCAGG - Intergenic
1008298963 6:49810856-49810878 GGTACATGTGCAGGATGTGCAGG - Intergenic
1008299754 6:49820926-49820948 GGTACATGTGCAGGATGTGCAGG - Intergenic
1008473194 6:51907612-51907634 GGTACATGTGCAGGATGTGCAGG - Intronic
1008616700 6:53233258-53233280 GGTACATGTGCAGGATGTGCAGG + Intergenic
1009346718 6:62621715-62621737 AGCACATGTGCAGGATGTGCAGG - Intergenic
1009382605 6:63051657-63051679 CATACATGTGCAGGATGTGCAGG + Intergenic
1009620809 6:66073785-66073807 GGTACATGTGCAGGATGTGCAGG - Intergenic
1009708520 6:67287150-67287172 GGTACATGTGCAGGATGTGCAGG - Intergenic
1009939541 6:70274227-70274249 GGTACATGTGCAGGATGTGCAGG + Intronic
1009957357 6:70471690-70471712 GGTACATGTGCAGGATGTGCAGG - Intronic
1010007335 6:71010379-71010401 TGGTAGAGTGCAGGATGAGCTGG + Intergenic
1010022018 6:71171086-71171108 GGTATATGTGCAGGATGTGCAGG - Intergenic
1010037034 6:71337755-71337777 GGTACATGTGCAGGATGTGCAGG - Intergenic
1010143789 6:72642353-72642375 GGTACATGTGCAGGATGTGCAGG + Intronic
1010467847 6:76189985-76190007 GGTACATGTGCAGGATGTGCAGG - Intergenic
1010477913 6:76312139-76312161 GGTTCATGTGCAGGATGTGCAGG + Intergenic
1010493489 6:76503261-76503283 GGTACATGTGCAGGATGTGCAGG + Intergenic
1010659010 6:78547188-78547210 GGTACATGTGCAGGATGTGCAGG + Intergenic
1011112223 6:83851370-83851392 GGTACATGTGCAGGATGTGCAGG + Intergenic
1011117372 6:83908305-83908327 GGTATATGTGCAGGATGTGCAGG + Intronic
1011207223 6:84913082-84913104 CGGTAATGTCCAACATGTGGTGG + Intergenic
1011214744 6:84993593-84993615 GGTACATGTGCAGGATGTGCAGG - Intergenic
1011216727 6:85013378-85013400 GGTACATGTGCAGGATGTGCAGG - Intergenic
1011404731 6:87007047-87007069 GGTACATGTGCAGGATGTGCAGG - Intronic
1011458818 6:87581624-87581646 GGTACATGTGCAGGATGTGCAGG + Intronic
1011576591 6:88807211-88807233 GGTACATGTGCAGGATGTGCAGG - Intronic
1012135821 6:95554459-95554481 GGTACATGTGCAGGATGTGCAGG + Intergenic
1012158496 6:95852216-95852238 GGTACATGTGCAGGATGTGCAGG + Intergenic
1012688811 6:102287819-102287841 GGAACATGTGCAGGATGTGCAGG - Intergenic
1012693473 6:102347883-102347905 GGTAAATGTGCAGGATGTGCAGG - Intergenic
1012710865 6:102602484-102602506 GGTATATGTGCAGGATGTGCAGG - Intergenic
1012822396 6:104102515-104102537 AGTACATGTGCAGGATGTGCAGG - Intergenic
1012836631 6:104277610-104277632 GGTACATGTGCAGGATGTGCAGG - Intergenic
1012919054 6:105202020-105202042 GGTTCATGTGCAGGATGTGCAGG - Intergenic
1012979315 6:105812992-105813014 GGTCCATGTGCAGGATGTGCAGG - Intergenic
1013046801 6:106493923-106493945 GGTATATGTGCAGGATGTGCAGG - Intergenic
1013215532 6:108023940-108023962 GGTACATGTGCAGGATGTGCAGG - Intergenic
1013716709 6:112970875-112970897 GGTACATGTGCAGGATGTGCAGG - Intergenic
1013726799 6:113107984-113108006 GGTACATGTGCAGGATGTGCAGG + Intergenic
1014023057 6:116613341-116613363 GGTACATGTGCAGGATGTGCAGG - Intergenic
1014235784 6:118952998-118953020 GGTACATGTGCAGGATGTGCAGG + Intergenic
1014315317 6:119857187-119857209 GGTACATGTGCAGGATGTGCAGG - Intergenic
1014328098 6:120024936-120024958 GGTACATGTGCAGGATGTGCAGG - Intergenic
1014340527 6:120200640-120200662 GGTACATGTGCAGGATGTGCAGG + Intergenic
1014393047 6:120889026-120889048 GGTACATGTGCAGGATGTGCAGG + Intergenic
1014464171 6:121735542-121735564 GGTACATGTGCAGGATGTGCAGG + Intergenic
1014563991 6:122926242-122926264 GGTACATGTGCAGGATGTGCAGG + Intergenic
1014594397 6:123314967-123314989 TGTACATGTGCAGGATGTGCAGG - Intronic
1014811197 6:125887953-125887975 GGTACATGTGCAGGATGTGCAGG + Intronic
1014917278 6:127167153-127167175 GGTACATGTGCAGGATGTGCAGG + Intronic
1015000242 6:128205386-128205408 GGTACATGTGCAGGATGTGCAGG - Intronic
1015322243 6:131889249-131889271 GGTACATGTGCAGGATGTGCAGG + Intronic
1015381668 6:132577129-132577151 GGTACATGTGCAGGATGTGCAGG + Intergenic
1015686355 6:135867448-135867470 GGTACATGTGCAGGATGTGCAGG + Intronic
1015806356 6:137113225-137113247 GGTACATGTGCAGGATGTGCAGG + Intergenic
1015857804 6:137644091-137644113 GGTACATGTGCAGGATGTGCAGG - Intergenic
1015885319 6:137911732-137911754 CTCTAATGTGGAGGCTGTGCTGG - Intergenic
1015963447 6:138674338-138674360 GGTACATGTGCAGGATGTGCAGG + Intronic
1016189223 6:141240396-141240418 GGTACATGTGCAGGATGTGCAGG - Intergenic
1016339277 6:143044250-143044272 GGTACATGTGCAGGATGTGCAGG + Intergenic
1016423205 6:143906807-143906829 GGTACATGTGCAGGATGTGCAGG + Intronic
1016460028 6:144272285-144272307 GGTAAATGTGCAGGATGTGCAGG - Intergenic
1016634017 6:146266911-146266933 GGTACATGTGCAGGATGTGCAGG + Intronic
1016695172 6:146985869-146985891 GGTACATGTGCAGGATGTGCAGG + Intergenic
1016889712 6:148993880-148993902 CAGTGATCTGCAGGCTGTGCAGG - Intronic
1017713207 6:157188167-157188189 GGTACATGTGCAGGATGTGCAGG - Intronic
1017741194 6:157408324-157408346 GGTACATGTGCAGGATGTGCAGG + Intronic
1017956286 6:159180498-159180520 GGTACATGTGCAGGATGTGCAGG + Intronic
1017982419 6:159412427-159412449 GGAACATGTGCAGGATGTGCAGG + Intergenic
1018080093 6:160251995-160252017 GGTACATGTGCAGGATGTGCAGG + Intronic
1018211247 6:161484144-161484166 GGTACATGTGCAGGATGTGCAGG - Intronic
1018247978 6:161840467-161840489 GGTACATGTGCAGGATGTGCAGG + Intronic
1019136767 6:169913629-169913651 GGTACATGTGCAGGATGTGCAGG + Intergenic
1019497821 7:1348608-1348630 CGGTAATGAGCAGGATGCAGAGG + Intergenic
1019792099 7:3021693-3021715 GGTACATGTGCAGGATGTGCAGG - Intronic
1019826341 7:3287470-3287492 GGTACATGTGCAGGATGTGCAGG + Intergenic
1020689354 7:11335589-11335611 GGGACATGTGCAGGATGCGCAGG - Intergenic
1020805355 7:12783930-12783952 GGTATATGTGCAGGATGTGCAGG + Intergenic
1020910806 7:14128058-14128080 GGGTCATGTGCAGGATGGGGAGG + Intergenic
1021086426 7:16425495-16425517 GGTACATGTGCAGGATGTGCAGG + Intergenic
1021391229 7:20095230-20095252 GGTACATGTGCAGGATGTGCAGG - Intergenic
1021916442 7:25438058-25438080 GGTACATGTGCAGGATGTGCAGG + Intergenic
1022001315 7:26228974-26228996 GGTACATGTGCAGGATGTGCAGG + Intergenic
1022219452 7:28298096-28298118 GGTACATGTGCAGGATGTGCAGG + Intergenic
1022228393 7:28387769-28387791 GGTCCATGTGCAGGATGTGCAGG - Intronic
1022317895 7:29262903-29262925 GGTATATGTGCAGGATGTGCAGG - Intronic
1022656096 7:32320480-32320502 GGTACATGTGCAGGATGTGCAGG - Intergenic
1022764679 7:33397942-33397964 GGTACATGTGCAGGATGTGCAGG - Intronic
1022791028 7:33689325-33689347 GGTACATGTGCAGGATGTGCAGG - Intergenic
1023195696 7:37636367-37636389 GGTACATGTGCAGGATGTGCAGG + Intergenic
1023586290 7:41733537-41733559 GGTACATGTGCAGGATGTGCAGG + Intergenic
1024496404 7:50051923-50051945 GGGTAACATGCAGGATGTGCAGG - Intronic
1024514552 7:50234589-50234611 AGTACATGTGCAGGATGTGCAGG + Intergenic
1024688618 7:51775487-51775509 GGCACATGTGCAGGATGTGCAGG + Intergenic
1024860085 7:53828730-53828752 TGTACATGTGCAGGATGTGCAGG - Intergenic
1024989981 7:55225776-55225798 GGTACATGTGCAGGATGTGCAGG + Intronic
1026329561 7:69339836-69339858 GGTACATGTGCAGGATGTGCAGG - Intergenic
1026334904 7:69385556-69385578 GGTACATGTGCAGGATGTGCAGG - Intergenic
1026491852 7:70870342-70870364 GGTTCACGTGCAGGATGTGCAGG + Intergenic
1026618497 7:71929148-71929170 GGTACATGTGCAGGATGTGCAGG + Intronic
1026635242 7:72076256-72076278 GGTACATGTGCAGGATGTGCAGG - Intronic
1026638445 7:72104421-72104443 GGTCCATGTGCAGGATGTGCAGG + Intronic
1026664627 7:72331720-72331742 GGTACATGTGCAGGATGTGCAGG + Intronic
1026823568 7:73566510-73566532 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1027019344 7:74800769-74800791 GGTCCATGTGCAGGATGTGCAGG - Intronic
1027068682 7:75145172-75145194 GGTCCATGTGCAGGATGTGCAGG + Intronic
1027301751 7:76845421-76845443 GGTATATGTGCAGGATGTGCAGG + Intergenic
1027418768 7:77999694-77999716 GTGTTATATGCAGGATGTGCAGG - Intergenic
1027425399 7:78056787-78056809 GGTCCATGTGCAGGATGTGCAGG - Intronic
1027608484 7:80329555-80329577 GGTACATGTGCAGGATGTGCAGG - Intergenic
1027700593 7:81465307-81465329 GGTACATGTGCAGGATGTGCAGG - Intergenic
1027747847 7:82100029-82100051 GGTACATGTGCAGGATGTGCAGG - Intronic
1028008552 7:85611009-85611031 GGTACATGTGCAGGATGTGCAGG - Intergenic
1028306842 7:89276291-89276313 GGTACATGTGCAGGATGTGCAGG - Intronic
1028444899 7:90910798-90910820 GGTACATGTGCAGGATGTGCAGG + Intronic
1028584379 7:92438530-92438552 GGTACATGTGCAGGATGTGCAGG - Intergenic
1028977575 7:96931301-96931323 GGTACATGTGCAGGATGTGCAGG - Intergenic
1029010058 7:97250319-97250341 GGTACATGTGCAGGATGTGCAGG + Intergenic
1029964630 7:104726354-104726376 GGTACATGTGCAGGATGTGCAGG + Intronic
1030454356 7:109754493-109754515 GGTACATGTGCAGGATGTGCAGG - Intergenic
1030498882 7:110334233-110334255 AGTACATGTGCAGGATGTGCAGG + Intergenic
1030532662 7:110729884-110729906 AGTACATGTGCAGGATGTGCAGG - Intronic
1031720997 7:125176387-125176409 GGTACATGTGCAGGATGTGCAGG + Intergenic
1031856429 7:126928333-126928355 GGCACATGTGCAGGATGTGCAGG - Intronic
1032301589 7:130692270-130692292 GGTACATGTGCAGGATGTGCAGG + Intergenic
1032396466 7:131593510-131593532 GGTACATGTGCAGGATGTGCAGG + Intergenic
1032399855 7:131617161-131617183 CGGAAATGTGAAGGAGATGCAGG + Intergenic
1032562379 7:132905552-132905574 GGTACATGTGCAGGATGTGCAGG - Intronic
1032911681 7:136439509-136439531 GGTACATGTGCAGGATGTGCAGG + Intergenic
1033378444 7:140788109-140788131 GGTACATGTGCAGGATGTGCAGG - Intronic
1033780676 7:144665203-144665225 GATTCATGTGCAGGATGTGCAGG - Intronic
1034255181 7:149720845-149720867 CTGTGAGGTGCAGGCTGTGCCGG - Exonic
1034387259 7:150750304-150750326 GGTACATGTGCAGGATGTGCAGG + Intergenic
1034755847 7:153618611-153618633 GGTACATGTGCAGGATGTGCAGG + Intergenic
1034854662 7:154531151-154531173 GGTACATGTGCAGGATGTGCAGG - Intronic
1034917657 7:155054213-155054235 GGTACATGTGCAGGATGTGCAGG + Intergenic
1035821816 8:2600998-2601020 TGTACATGTGCAGGATGTGCAGG + Intergenic
1035857156 8:2987911-2987933 CATACATGTGCAGGATGTGCAGG + Intronic
1035910878 8:3565047-3565069 GGTCCATGTGCAGGATGTGCAGG - Intronic
1036433246 8:8708804-8708826 GGTACATGTGCAGGATGTGCAGG + Intergenic
1036581147 8:10077014-10077036 GGTACATGTGCAGGATGTGCAGG - Intronic
1036643120 8:10596316-10596338 GGGAAATGTGCAGAACGTGCCGG - Intergenic
1036713125 8:11095005-11095027 GGTACATGTGCAGGATGTGCAGG - Intronic
1037112098 8:15175661-15175683 GGTACATGTGCAGGATGTGCAGG - Intronic
1037429356 8:18793454-18793476 GGTCTATGTGCAGGATGTGCAGG - Intronic
1037663642 8:20948530-20948552 GGTATATGTGCAGGATGTGCAGG - Intergenic
1037909007 8:22732528-22732550 GGTACATGTGCAGGATGTGCAGG - Intronic
1038100258 8:24365579-24365601 GGTACATGTGCAGGATGTGCAGG + Intergenic
1038457480 8:27686814-27686836 GGTACATGTGCAGGATGTGCAGG + Intergenic
1038502772 8:28059632-28059654 GGTACATGTGCAGGATGTGCAGG - Intronic
1038678246 8:29643247-29643269 GGTACATGTGCAGGATGTGCAGG + Intergenic
1038705544 8:29890186-29890208 GGTACATGTGCAGGATGTGCAGG + Intergenic
1038852208 8:31290626-31290648 GGTGCATGTGCAGGATGTGCAGG + Intergenic
1038890761 8:31720346-31720368 GGTACATGTGCAGGATGTGCAGG + Intronic
1038989781 8:32855556-32855578 GGTACATGTGCAGGATGTGCAGG + Intergenic
1039314996 8:36361217-36361239 GGTACATGTGCAGGATGTGCAGG - Intergenic
1039460843 8:37742780-37742802 GGTACATGTGCAGGATGTGCAGG - Intronic
1039728328 8:40246918-40246940 GGTACATGTGCAGGATGTGCAGG + Intergenic
1040090943 8:43398262-43398284 GGTACATGTGCAGGATGTGCAGG + Intergenic
1040360815 8:46662553-46662575 AGTACATGTGCAGGATGTGCAGG + Intergenic
1040535972 8:48310090-48310112 GGTACATGTGCAGGATGTGCAGG - Intergenic
1040597928 8:48858336-48858358 CGGCAATGTGTAGGACCTGCTGG + Intergenic
1040964179 8:53067461-53067483 GGTACATGTGCAGGATGTGCAGG + Intergenic
1041041238 8:53848417-53848439 GGTACATGTGCAGGATGTGCAGG + Intergenic
1041115847 8:54535802-54535824 GGTACATGTGCAGGATGTGCAGG + Intergenic
1041129688 8:54684756-54684778 GGTACATGTGCAGGATGTGCAGG + Intergenic
1041214347 8:55585057-55585079 GGTACATGTGCAGGATGTGCAGG - Intergenic
1041482390 8:58336353-58336375 GGTATATGTGCAGGATGTGCAGG - Intergenic
1041487559 8:58395841-58395863 GGCACATGTGCAGGATGTGCAGG - Intergenic
1041615821 8:59905484-59905506 GGTACATGTGCAGGATGTGCAGG - Intergenic
1041625456 8:60020795-60020817 GGTAAATATGCAGGATGTGCAGG + Intergenic
1041639537 8:60181626-60181648 GGTAGATGTGCAGGATGTGCAGG - Intergenic
1041657259 8:60366119-60366141 GGTACATGTGCAGGATGTGCAGG + Intergenic
1041888885 8:62846346-62846368 GGTACATGTGCAGGATGTGCAGG + Intronic
1042094277 8:65195192-65195214 GGTACATGTGCAGGATGTGCAGG + Intergenic
1042173193 8:66012339-66012361 GGTACATGTGCAGGATGTGCAGG - Intergenic
1042339396 8:67663390-67663412 GGTACATGTGCAGGATGTGCAGG + Intronic
1042464758 8:69115570-69115592 GGTACATGTGCAGGATGTGCAGG - Intergenic
1042490106 8:69387509-69387531 GGTCCATGTGCAGGATGTGCAGG - Intergenic
1042626238 8:70760733-70760755 GGTACATGTGCAGGATGTGCAGG + Intronic
1042643247 8:70957402-70957424 GGTACATGTGCAGGATGTGCAGG + Intergenic
1042702287 8:71628495-71628517 GGGTACATTGCAGGATGTGCAGG - Intergenic
1042774176 8:72411285-72411307 GGTACATGTGCAGGATGTGCAGG - Intergenic
1042936322 8:74062261-74062283 GGTACATGTGCAGGATGTGCAGG + Intergenic
1043088726 8:75871294-75871316 GGTATATGTGCAGGATGTGCAGG + Intergenic
1043180042 8:77077178-77077200 GGTACATGTGCAGGATGTGCAGG + Intergenic
1043282778 8:78489198-78489220 GGTACATGTGCAGGATGTGCAGG + Intergenic
1043325074 8:79040045-79040067 GGTACATGTGCAGGATGTGCAGG - Intergenic
1043419836 8:80087170-80087192 GGTACATGTGCAGGATGTGCAGG + Intronic
1043529872 8:81137442-81137464 ATTTCATGTGCAGGATGTGCAGG - Intergenic
1043554579 8:81416256-81416278 GGTACATGTGCAGGATGTGCAGG - Intergenic
1043668863 8:82855252-82855274 GGTACATGTGCAGGATGTGCAGG - Intergenic
1043728611 8:83645971-83645993 GGTACATGTGCAGGATGTGCAGG + Intergenic
1043775525 8:84263626-84263648 GGTACATGTGCAGGATGTGCAGG + Intronic
1043859593 8:85300414-85300436 GGTAGATGTGCAGGATGTGCAGG - Intergenic
1043928598 8:86065551-86065573 GGTACATGTGCAGGATGTGCAGG - Intronic
1043934329 8:86126291-86126313 TGTACATGTGCAGGATGTGCAGG + Intronic
1044116548 8:88343039-88343061 GGTACATGTGCAGGATGTGCAGG + Intergenic
1044127848 8:88480321-88480343 GGTGTATGTGCAGGATGTGCAGG - Intergenic
1044259770 8:90104612-90104634 GGTAGATGTGCAGGATGTGCAGG + Intergenic
1044294705 8:90514001-90514023 AGTACATGTGCAGGATGTGCAGG - Intergenic
1044447017 8:92290767-92290789 GGTACATGTGCAGGATGTGCAGG + Intergenic
1044753964 8:95442841-95442863 GGTGCATGTGCAGGATGTGCAGG - Intergenic
1045014433 8:97987405-97987427 GGTGTATGTGCAGGATGTGCAGG - Intronic
1045165020 8:99594041-99594063 GGTACATGTGCAGGATGTGCAGG - Intronic
1045404241 8:101849323-101849345 GGTACATGTGCAGGATGTGCAGG - Intronic
1045666953 8:104498244-104498266 GGTACATGTGCAGGATGTGCAGG + Intronic
1045732423 8:105257529-105257551 GGTATATGTGCAGGATGTGCAGG + Intronic
1046077497 8:109331011-109331033 GGTACATGTGCAGGATGTGCAGG - Intronic
1046096143 8:109563609-109563631 GGGACATGTGCAGGATGTGCAGG + Intronic
1046116118 8:109785681-109785703 GGTACATGTGCAGGATGTGCAGG - Intergenic
1046242281 8:111511934-111511956 GGAACATGTGCAGGATGTGCGGG - Intergenic
1046273989 8:111932792-111932814 ATATGATGTGCAGGATGTGCAGG + Intergenic
1046795858 8:118370908-118370930 AGTACATGTGCAGGATGTGCAGG - Intronic
1046979591 8:120322346-120322368 AGTGCATGTGCAGGATGTGCAGG - Intronic
1047091331 8:121578902-121578924 GGTACATGTGCAGGATGTGCAGG + Intergenic
1047267309 8:123318172-123318194 GGTAAATGTGCAAGATGTGCAGG + Intergenic
1047366856 8:124219258-124219280 GGTACATGTGCAGGATGTGCAGG - Intergenic
1047638164 8:126789598-126789620 GGTACATGTGCAGGATGTGCAGG + Intergenic
1047752987 8:127896647-127896669 GGTACATGTGCAGGATGTGCAGG + Intergenic
1047871086 8:129082916-129082938 GGTATATGTGCAGGATGTGCAGG - Intergenic
1047877088 8:129150510-129150532 GGTACATGTGCAGGATGTGCGGG - Intergenic
1047899266 8:129402228-129402250 GGCACATGTGCAGGATGTGCAGG - Intergenic
1048043879 8:130755336-130755358 GGTACATGTGCAGGATGTGCAGG - Intergenic
1048132941 8:131717639-131717661 GGTACATGTGCAGGATGTGCAGG + Intergenic
1048584340 8:135758784-135758806 GGGGCATGTGCAGAATGTGCAGG + Intergenic
1048594843 8:135855513-135855535 GGTACATGTGCAGGATGTGCAGG + Intergenic
1048919971 8:139219231-139219253 GGTACATGTGCAGGATGTGCAGG - Intergenic
1049048762 8:140174347-140174369 GGTACATGTGCAGGATGTGCAGG - Intronic
1049054305 8:140223037-140223059 AGTACATGTGCAGGATGTGCAGG + Intronic
1049230667 8:141479604-141479626 CGGCTATGAGCAGGCTGTGCCGG + Intergenic
1050080278 9:1908624-1908646 GGTACATGTGCAGGATGTGCAGG - Intergenic
1050134123 9:2443427-2443449 GGTACATGTGCAGGATGTGCAGG + Intergenic
1050177463 9:2883229-2883251 GGTACATGTGCAGGATGTGCAGG + Intergenic
1050224957 9:3443221-3443243 GGTATATGTGCAGGATGTGCAGG + Intronic
1050238982 9:3614067-3614089 GGTACATGTGCAGGATGTGCAGG + Intergenic
1050248001 9:3712308-3712330 GGCACATGTGCAGGATGTGCAGG - Intergenic
1050346249 9:4691198-4691220 GGTACATGTGCAGGATGTGCAGG + Intronic
1050394421 9:5179967-5179989 AGTACATGTGCAGGATGTGCAGG - Intronic
1050398667 9:5227831-5227853 GGTACATGTGCAGGATGTGCAGG - Intergenic
1050433125 9:5582181-5582203 GGTACATGTGCAGGATGTGCAGG - Intergenic
1050619234 9:7435152-7435174 GGTACATGTGCAGGATGTGCAGG + Intergenic
1050883035 9:10727939-10727961 GGTACATGTGCAGGATGTGCAGG + Intergenic
1051221248 9:14850687-14850709 GGTACATGTGCAGGATGTGCAGG - Intronic
1051568546 9:18528217-18528239 GGTTCATGTGCAGGATATGCAGG + Intronic
1051703491 9:19851360-19851382 AGTACATGTGCAGGATGTGCAGG + Intergenic
1051939616 9:22490155-22490177 TGGGAATGTGCAGAATGTGCAGG + Intergenic
1051975211 9:22940800-22940822 GGTATATGTGCAGGATGTGCAGG + Intergenic
1052274036 9:26658071-26658093 GGCACATGTGCAGGATGTGCAGG + Intergenic
1052511649 9:29429143-29429165 CATACATGTGCAGGATGTGCAGG - Intergenic
1052695749 9:31875709-31875731 GGTATATGTGCAGGATGTGCAGG + Intergenic
1052713575 9:32087958-32087980 GGTACATGTGCAGGATGTGCAGG - Intergenic
1052885599 9:33644784-33644806 AGTACATGTGCAGGATGTGCAGG - Intergenic
1053059422 9:35018829-35018851 GGCACATGTGCAGGATGTGCAGG + Intergenic
1053108580 9:35436844-35436866 GGCACATGTGCAGGATGTGCAGG + Intergenic
1053415230 9:37943214-37943236 GGGGAATGTGAAGGATGAGCAGG - Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1055005538 9:71501330-71501352 TGCACATGTGCAGGATGTGCAGG - Intergenic
1055255453 9:74364869-74364891 GGTATATGTGCAGGATGTGCAGG + Intergenic
1055733716 9:79305784-79305806 AGTACATGTGCAGGATGTGCAGG + Intergenic
1056057688 9:82844858-82844880 GGTACATGTGCAGGATGTGCAGG + Intergenic
1056430020 9:86518226-86518248 GGTACATGTGCAGGATGTGCAGG - Intergenic
1056490259 9:87099236-87099258 GGTACATGTGCAGGATGTGCAGG - Intergenic
1056515052 9:87342379-87342401 TGTACATGTGCAGGATGTGCAGG - Intergenic
1056524557 9:87431201-87431223 GGTACATGTGCAGGATGTGCAGG + Intergenic
1056561995 9:87738676-87738698 GATTCATGTGCAGGATGTGCAGG - Intergenic
1057010344 9:91595856-91595878 GGTACATGTGCAGGATGTGCAGG + Intronic
1057020628 9:91694579-91694601 GGTAAATGTGCAGGATGTGCAGG + Intronic
1057057399 9:91974292-91974314 GGTACATGTGCAGGATGTGCAGG - Intergenic
1057158189 9:92863388-92863410 GGTACATGTGCAGGATGTGCAGG - Intronic
1057324066 9:94044327-94044349 GGTACATGTGCAGGATGTGCAGG + Intronic
1057412564 9:94830061-94830083 GGTACATGTGCAGGATGTGCAGG + Intronic
1057695388 9:97319262-97319284 GGTACATGTGCAGGATGTGCAGG - Intronic
1057767706 9:97937242-97937264 GGTTCATGTGCAGGATATGCAGG + Intronic
1058180034 9:101786287-101786309 AGTACATGTGCAGGATGTGCAGG - Intergenic
1058556269 9:106170862-106170884 GGGACATGTGCAGAATGTGCAGG - Intergenic
1058758674 9:108107746-108107768 GGCACATGTGCAGGATGTGCAGG - Intergenic
1059043592 9:110841113-110841135 AGTATATGTGCAGGATGTGCAGG + Intergenic
1059077224 9:111206331-111206353 GGTACATGTGCAGGATGTGCAGG - Intergenic
1059077534 9:111210043-111210065 GGTACATGTGCAGGATGTGCAGG - Intergenic
1059146174 9:111901654-111901676 GGTACATGTGCAGGATGTGCAGG - Intronic
1059225953 9:112673123-112673145 GGTACATGTGCAGGATGTGCAGG + Intergenic
1059371081 9:113836847-113836869 GGTACATGTGCAGGATGTGCAGG + Intergenic
1059526966 9:115000970-115000992 GGTAAATGTGCAGGATGTGCAGG + Intergenic
1059600887 9:115777333-115777355 TGTACATGTGCAGGATGTGCAGG - Intergenic
1059608784 9:115869222-115869244 GGTACATGTGCAGGATGTGCAGG - Intergenic
1059830209 9:118086762-118086784 GGTACATGTGCAGGATGTGCAGG + Intergenic
1059915914 9:119100025-119100047 GGTACATGTGCAGGATGTGCAGG + Intergenic
1059971428 9:119672820-119672842 GGTACATGTGCAGGATGTGCAGG + Intergenic
1060019906 9:120120281-120120303 CGGCAATGGGCAGGATCTACAGG - Intergenic
1060315924 9:122510519-122510541 GGTACATGTGCAGGATGTGCAGG + Intergenic
1060316671 9:122517740-122517762 GGTACATGTGCAGGATGTGCAGG + Intergenic
1060342657 9:122790644-122790666 AGTACATGTGCAGGATGTGCAGG - Intergenic
1060564962 9:124582541-124582563 GGTACATGTGCAGGATGTGCTGG - Intronic
1060975121 9:127760552-127760574 CGTTCATGTGCAGAATGTGCAGG - Intronic
1061189490 9:129073617-129073639 GGTGCATGTGCAGGATGTGCAGG - Intergenic
1203481790 Un_GL000224v1:15031-15053 GGTATATGTGCAGGATGTGCAGG + Intergenic
1185798515 X:2987442-2987464 GGTACATGTGCAGGATGTGCAGG + Intergenic
1185946540 X:4383374-4383396 GGTATATGTGCAGGATGTGCAGG + Intergenic
1185949950 X:4421838-4421860 GGCACATGTGCAGGATGTGCAGG - Intergenic
1186007795 X:5093536-5093558 GGCACATGTGCAGGATGTGCAGG - Intergenic
1186101224 X:6158664-6158686 GGTACATGTGCAGGATGTGCAGG + Intronic
1186172711 X:6894221-6894243 GGTACATGTGCAGGATGTGCAGG - Intergenic
1186252108 X:7679508-7679530 GGTACATGTGCAGGATGTGCAGG + Intergenic
1186322665 X:8446646-8446668 GGTACATGTGCAGGATGTGCAGG + Intergenic
1186344297 X:8675725-8675747 GGTACATGTGCAGGATGTGCAGG + Intronic
1186624178 X:11274648-11274670 GGTACATGTGCAGGATGTGCAGG + Intronic
1186776476 X:12869707-12869729 GGTACATGTGCAGGATGTGCAGG - Intronic
1186963892 X:14766709-14766731 GGTACATGTGCAGGATGTGCAGG + Intergenic
1187013709 X:15305790-15305812 GGTACATGTGCAGGATGTGCAGG + Intronic
1187078325 X:15958923-15958945 GGTACATGTGCAGGATGTGCAGG + Intergenic
1187108436 X:16269717-16269739 GGTACATGTGCAGGATGTGCAGG + Intergenic
1187286354 X:17907867-17907889 GGTATATGTGCAGGATGTGCAGG + Intergenic
1187302241 X:18061962-18061984 GGTACATGTGCAGGATGTGCAGG - Intergenic
1187414851 X:19084435-19084457 GGTACATGTGCAGGATGTGCAGG - Intronic
1187605737 X:20880686-20880708 GGTACATGTGCAGGATGTGCAGG - Intergenic
1188036719 X:25326332-25326354 GGTACATGTGCAGGATGTGCAGG + Intergenic
1188171981 X:26938722-26938744 GGTACATGTGCAGGATGTGCAGG - Intergenic
1188180926 X:27054542-27054564 GGGTAATGTGCACAATGTGCAGG + Intergenic
1188341974 X:29013836-29013858 GGTACATGTGCAGGATGTGCAGG - Intronic
1188570844 X:31583663-31583685 GGTACATGTGCAGGATGTGCAGG + Intronic
1188744301 X:33823777-33823799 GGTACATGTGCAGGATGTGCAGG + Intergenic
1188849851 X:35118133-35118155 GGTACATGTGCAGGATGTGCAGG - Intergenic
1188863744 X:35288625-35288647 GGTACATGTGCAGGATGTGCAGG - Intergenic
1188920110 X:35963503-35963525 GGTACATGTGCAGGATGTGCAGG + Intronic
1189486334 X:41435497-41435519 GGAAAATGTGCAGAATGTGCAGG + Intergenic
1189536807 X:41943616-41943638 GGTACATGTGCAGGATGTGCAGG - Intergenic
1189552175 X:42104410-42104432 GGTACATGTGCAGGATGTGCAGG - Intergenic
1189916646 X:45862363-45862385 GGTACATGTGCAGGATGTGCAGG - Intergenic
1190467127 X:50736275-50736297 GGTTCATGTGCAGGATATGCAGG + Intronic
1190502543 X:51094129-51094151 AGTACATGTGCAGGATGTGCAGG + Intergenic
1190552034 X:51593996-51594018 GGTACATGTGCAGGATGTGCAGG + Intergenic
1190637823 X:52453975-52453997 GGTACATGTGCAGGATGTGCAGG + Intergenic
1190678826 X:52806489-52806511 GGTACATGTGCAGGATGTGCAGG - Intergenic
1190803172 X:53811864-53811886 TGTACATGTGCAGGATGTGCAGG + Intergenic
1190821252 X:53975028-53975050 GGTACATGTGCAGGATGTGCAGG - Intronic
1190859598 X:54331183-54331205 GGTACATGTGCAGGATGTGCAGG - Intronic
1190862062 X:54354652-54354674 GGTACATGTGCAGGATGTGCAGG - Intronic
1190902757 X:54694617-54694639 GGTACATGTGCAGGATGTGCAGG - Intergenic
1190972496 X:55365097-55365119 GGTACATGTGCAGGATGTGCAGG - Intergenic
1191039692 X:56066416-56066438 TGGATATGTGCAGTATGTGCAGG + Intergenic
1191090266 X:56613130-56613152 GGTACATGTGCAGGATGTGCAGG + Intergenic
1191099090 X:56705456-56705478 GGTACATGTGCAGGATGTGCAGG + Intergenic
1191162114 X:57340918-57340940 GGTTCATGTGCAGGATGTGCAGG - Intronic
1191766045 X:64699287-64699309 AGTACATGTGCAGGATGTGCAGG + Intergenic
1192293384 X:69821366-69821388 GGCACATGTGCAGGATGTGCAGG - Intronic
1192626044 X:72729854-72729876 GGCACATGTGCAGGATGTGCAGG + Intergenic
1192692631 X:73380804-73380826 AGTACATGTGCAGGATGTGCAGG - Intergenic
1193169416 X:78318501-78318523 GGTACATGTGCAGGATGTGCAGG - Intronic
1193223206 X:78951785-78951807 GGTACATGTGCAGGATGTGCAGG + Intronic
1193410711 X:81159357-81159379 GGTACATGTGCAGGATGTGCAGG - Intronic
1193458508 X:81760625-81760647 GGTACATGTGCAGGATGTGCAGG - Intergenic
1193581679 X:83272505-83272527 CTTGTATGTGCAGGATGTGCAGG - Intergenic
1193734021 X:85135296-85135318 GGTACATGTGCAGGATGTGCAGG - Intergenic
1193787853 X:85782246-85782268 GGTACATGTGCAGGATGTGCAGG - Intergenic
1194030492 X:88807163-88807185 GGTACATGTGCAGGATGTGCAGG - Intergenic
1194301257 X:92189081-92189103 GGTACATGTGCAGGATGTGCAGG + Intronic
1194418584 X:93644447-93644469 GGAACATGTGCAGGATGTGCAGG + Intergenic
1194442361 X:93948304-93948326 GGTAAATGTGCAGTATGTGCAGG - Intergenic
1194496559 X:94623052-94623074 GGTACATGTGCAGGATGTGCAGG - Intergenic
1194554787 X:95342662-95342684 GGTACATGTGCAGGATGTGCTGG - Intergenic
1194989501 X:100531210-100531232 GGTACATGTGCAGGATGTGCAGG + Intergenic
1195212523 X:102663625-102663647 GGTACATGTGCAGGATGTGCAGG + Intergenic
1195216083 X:102704339-102704361 GATAAATGTGCAGGATGTGCAGG - Intergenic
1195588704 X:106598871-106598893 GGTACATGTGCAGGATGTGCAGG - Intergenic
1195715543 X:107814705-107814727 GGTACATGTGCAGGATGTGCAGG - Intergenic
1195906179 X:109846776-109846798 GGATAATATCCAGGATGTGCAGG + Intergenic
1196085980 X:111682367-111682389 GGTACATGTGCAGGATGTGCGGG + Intronic
1196168483 X:112561563-112561585 GGTACATGTGCAGGATGTGCGGG - Intergenic
1196216799 X:113062266-113062288 GGTACATGTGCAGGATGTGCAGG + Intergenic
1196225335 X:113158940-113158962 GGTACATGTGCAGGATGTGCAGG + Intergenic
1196332198 X:114485566-114485588 TGTACATGTGCAGGATGTGCAGG + Intergenic
1196357607 X:114811963-114811985 GGTACATGTGCAGGATGTGCAGG + Intronic
1196394472 X:115244437-115244459 GGTACATGTGCAGGATGTGCAGG - Intergenic
1196407823 X:115383875-115383897 GGTACATGTGCAGGATGTGCAGG + Intergenic
1196941315 X:120778813-120778835 GGTACATGTGCAGGATGTGCAGG - Intergenic
1196943077 X:120796997-120797019 GGTACATGTGCAGGATGTGCAGG + Intergenic
1197087162 X:122492492-122492514 GGGTACTGTGCAGAATGTACAGG + Intergenic
1197131417 X:123009735-123009757 GGTACATGTGCAGGATGTGCAGG + Intergenic
1197180353 X:123529036-123529058 GGTACATGTGCAGGATGTGCAGG + Intergenic
1197228530 X:123978190-123978212 GGTACATGTGCAGGATGTGCAGG + Intronic
1197328179 X:125120337-125120359 TGTAAATGTTCAGGATGTGCAGG + Intergenic
1197413316 X:126144991-126145013 GGCACATGTGCAGGATGTGCAGG + Intergenic
1197479970 X:126970558-126970580 GGCACATGTGCAGGATGTGCAGG - Intergenic
1197533076 X:127654768-127654790 GGTGTATGTGCAGGATGTGCAGG - Intergenic
1197564445 X:128064523-128064545 GGTACATGTGCAGGATGTGCAGG - Intergenic
1197732204 X:129820796-129820818 GGTACATGTGCAGGATGTGCAGG + Intronic
1197796288 X:130302005-130302027 GGTATATGTGCAGGATGTGCAGG - Intergenic
1197829174 X:130623398-130623420 GGTACATGTGCAGGATGTGCAGG + Exonic
1197878884 X:131143581-131143603 TGTACATGTGCAGGATGTGCAGG - Intergenic
1197905426 X:131419820-131419842 AGTACATGTGCAGGATGTGCAGG - Intergenic
1197946673 X:131846544-131846566 AGTACATGTGCAGGATGTGCAGG - Intergenic
1197958260 X:131976452-131976474 GGTACATGTGCAGGATGTGCAGG + Intergenic
1197961182 X:132007735-132007757 GGTACATGTGCAGGATGTGCAGG + Intergenic
1197976385 X:132170163-132170185 CGTACATGTGCAAGATGTGCAGG + Intergenic
1197977370 X:132180185-132180207 GGTACATGTGCAGGATGTGCAGG - Intergenic
1198227517 X:134659175-134659197 GGTACATGTGCAGGATGTGCAGG - Intronic
1198361259 X:135897694-135897716 GGTACATGTGCAGGATGTGCAGG + Intronic
1198372678 X:136006335-136006357 GGTACATGTGCAGGATGTGCAGG + Intronic
1198560347 X:137843149-137843171 AGTACATGTGCAGGATGTGCAGG + Intergenic
1198687598 X:139244133-139244155 GGTACATGTGCAGGATGTGCAGG - Intergenic
1199060182 X:143346633-143346655 GGTACATGTGCAGGATGTGCAGG + Intergenic
1199068189 X:143444953-143444975 TGTACATGTGCAGGATGTGCAGG + Intergenic
1199129354 X:144165966-144165988 GGTATATGTGCAGGATGTGCAGG - Intergenic
1199157199 X:144564373-144564395 GGTACATGTGCAGGATGTGCAGG + Intergenic
1199191965 X:144981266-144981288 CGATAAGGTCCAGGCTGTGCTGG + Intergenic
1199224381 X:145355138-145355160 GGTACATGTGCAGGATGTGCAGG - Intergenic
1199224495 X:145356723-145356745 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1199256406 X:145723285-145723307 GGTATATGTGCAGGATGTGCAGG - Intergenic
1199466403 X:148142294-148142316 GGTACATGTGCAGGATGTGCAGG - Intergenic
1199550176 X:149052300-149052322 GGTAAATGTGCAGGATATGCAGG - Intergenic
1199791361 X:151158314-151158336 GGGATATGTGCAGGATGTGCAGG + Intergenic
1199857367 X:151771184-151771206 GGTACATGTGCAGGATGTGCAGG - Intergenic
1199918696 X:152373156-152373178 GGTACATGTGCAGGATGTGCAGG + Intronic
1199925763 X:152461954-152461976 GGTATATGTGCAGGATGTGCTGG - Intergenic
1200325708 X:155236550-155236572 GGTACATGTGCAGGATGTGCAGG - Intronic
1200380991 X:155837053-155837075 GGTACATGTGCAGGATGTGCAGG - Intergenic
1200716904 Y:6557020-6557042 GGGTAATGTGCAGTATGTGCTGG - Intergenic
1200946463 Y:8845229-8845251 GGTACATGTGCAGGATGTGCAGG - Intergenic
1201373582 Y:13291671-13291693 AGTACATGTGCAGGATGTGCAGG - Intronic
1201388174 Y:13466286-13466308 GGTACATGTGCAGGATGTGCAGG - Intronic