ID: 1101046406

View in Genome Browser
Species Human (GRCh38)
Location 12:100810591-100810613
Sequence CAGGATAGTGATTCTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101046401_1101046406 1 Left 1101046401 12:100810567-100810589 CCAGAAAGGGAGGTGATGATGGA 0: 1
1: 0
2: 3
3: 25
4: 237
Right 1101046406 12:100810591-100810613 CAGGATAGTGATTCTGGAGGTGG 0: 1
1: 0
2: 3
3: 15
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101046406 Original CRISPR CAGGATAGTGATTCTGGAGG TGG Intronic
900331444 1:2136664-2136686 CAGGAGAGTGTGGCTGGAGGTGG + Intronic
902994249 1:20211533-20211555 CAGGACAGTGACCCTGGAGAGGG + Intergenic
905364036 1:37439134-37439156 CAGGCTTGTGGTCCTGGAGGTGG - Intergenic
905474727 1:38217927-38217949 CAGGCTGTTGATTCTGCAGGAGG + Intergenic
905599507 1:39237239-39237261 CAGGAAGGTGATACTGGAGCTGG - Intronic
907661947 1:56401400-56401422 CAGGAAGGAGATGCTGGAGGGGG - Intergenic
908340487 1:63173503-63173525 CTGGAGTGAGATTCTGGAGGGGG - Intergenic
909204459 1:72737767-72737789 CAGGATAGTGGTTGTAGAGTTGG + Intergenic
911029821 1:93474385-93474407 AAAGAGAGTGATTCTGGAGGAGG + Intronic
912963659 1:114218070-114218092 GAGGAGAGTGACTCTGAAGGAGG + Intergenic
913494396 1:119415036-119415058 GAGAAAAGGGATTCTGGAGGAGG + Exonic
916470679 1:165119344-165119366 CAGGATGGTGGTCCAGGAGGTGG - Intergenic
917682887 1:177385606-177385628 CATGAAAATGATGCTGGAGGAGG + Intergenic
917918626 1:179730103-179730125 CAGGATAGTGAATTAGGATGGGG - Intergenic
919677301 1:200396171-200396193 TAGGAAAGTGAATCTGGGGGAGG - Intergenic
920877202 1:209847907-209847929 CAAGAGAGTTATTCTGGATGAGG - Intronic
920939545 1:210468738-210468760 CAGGATGGTGGTCCTGGAGTTGG + Intronic
1064712154 10:18139382-18139404 CAGGATAGTGACTATGGTGAGGG - Intergenic
1064971279 10:21069501-21069523 CAGGAGAGTGATTCTCCTGGCGG - Intronic
1066309338 10:34180415-34180437 CAGGATAGCAATAATGGAGGCGG + Intronic
1070552929 10:77505119-77505141 CAGGTTAGTGATTCATGAGTAGG - Intronic
1071217884 10:83429047-83429069 CAGTCTAGTGCTTCTAGAGGAGG - Intergenic
1071846495 10:89526331-89526353 CAGGAGAGTGTTTCTAGAGAGGG - Intronic
1072048794 10:91683077-91683099 GAGGATAGTGATTCAGCATGGGG - Intergenic
1073177865 10:101567507-101567529 CAGGACAGTCTTCCTGGAGGAGG + Intergenic
1073746975 10:106480224-106480246 CAGGAAATTCATTCTGGAAGAGG - Intergenic
1074389861 10:113048033-113048055 CAGGATCTTGACTCTGCAGGGGG + Intronic
1075879888 10:125842084-125842106 AAGGATAGTGATTCTTGAGAGGG + Intronic
1076072446 10:127501426-127501448 CAGGAGAGTGAGTTTGGATGGGG - Intergenic
1076133415 10:128028905-128028927 CAGGATAGCGCTCCTCGAGGAGG - Intronic
1077318681 11:1930338-1930360 CAGGAAAGTGAGTCCGGAAGTGG + Intronic
1078087155 11:8240850-8240872 GAGCATAGTGATTCTGGAGCAGG + Intronic
1079129939 11:17741474-17741496 CAGGATGGTGAACATGGAGGTGG - Intronic
1080455929 11:32419277-32419299 CAGTAGAGAGATTGTGGAGGAGG - Intronic
1083158284 11:60839012-60839034 CAGGATTGTGGTTCCAGAGGTGG - Intergenic
1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG + Intergenic
1084466334 11:69325140-69325162 GATGGTAGTGATGCTGGAGGTGG + Intronic
1084753819 11:71222135-71222157 CAGGATGGTGGTGCTGGATGGGG - Intronic
1084977828 11:72813043-72813065 CAGGAAAGTTCTCCTGGAGGAGG + Intergenic
1085376752 11:76070276-76070298 TAGGATAGTGATTCAGTGGGAGG + Intronic
1087390581 11:97527225-97527247 CAGGATGGTGATGGTGGAGAAGG - Intergenic
1087920577 11:103862270-103862292 CAGGACAGTCATTCTGAATGTGG + Intergenic
1088908312 11:114171366-114171388 CCTGATAGAGATTCTGGATGGGG - Intronic
1089858456 11:121567772-121567794 CAGAAACGTGATGCTGGAGGCGG - Intronic
1090263994 11:125342756-125342778 CATGATAGTGTCTCTGGGGGAGG + Intronic
1091227951 11:133969182-133969204 GAGAATACAGATTCTGGAGGCGG - Intergenic
1092278882 12:7084909-7084931 CAGTATAGTGATGATGGAAGTGG + Intronic
1092358703 12:7818022-7818044 CATTATAGTGATTCTGTAAGAGG + Exonic
1092974791 12:13734276-13734298 GAGGATAGTGACTCTGCAGGTGG + Intronic
1093501930 12:19823263-19823285 CAAGTTAATGATTCTGGAGAAGG + Intergenic
1094556253 12:31503046-31503068 CAGAAGTGTGTTTCTGGAGGAGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1098168033 12:67718346-67718368 CAGGATAGTGTGTCTGGAATTGG + Intergenic
1101046406 12:100810591-100810613 CAGGATAGTGATTCTGGAGGTGG + Intronic
1101458867 12:104868456-104868478 CAGGGCAGTGATTCTGGGGTGGG - Intronic
1103654517 12:122459556-122459578 CAGGACACTGATGTTGGAGGGGG + Intergenic
1104142294 12:126000344-126000366 CAGAATGGGCATTCTGGAGGAGG - Intergenic
1104967568 12:132515371-132515393 CAGGTCAGAGATTCAGGAGGTGG - Intronic
1105676612 13:22679036-22679058 CTTGATACTGATTCTGGAGTGGG - Intergenic
1110421918 13:75320664-75320686 CAGGATAGTGGTCCTGGAAATGG + Intronic
1110560435 13:76905941-76905963 CAAGATTGTGATTCAGTAGGGGG + Intergenic
1112098260 13:96158858-96158880 CCTGAGAGTGATTCTGGAGTCGG + Intronic
1112564149 13:100537963-100537985 GAGGATAGTGTTTCTGAAGAAGG + Intronic
1113983935 13:114298900-114298922 GAGGAGATTGATACTGGAGGTGG + Exonic
1114530784 14:23394432-23394454 CAGTGTAGTGATGTTGGAGGTGG - Intronic
1115788002 14:36847889-36847911 CAGGAAAGTAACTCTGGAAGCGG + Intronic
1115895866 14:38086254-38086276 CATGATAGAAATTCTAGAGGTGG + Intergenic
1121108732 14:91297479-91297501 CAGGAAATTGACCCTGGAGGAGG + Exonic
1121403262 14:93701518-93701540 CAGGATATTGTTTCTGAAGAGGG + Intronic
1121715200 14:96068834-96068856 CATGACAGTGTTTCTGGATGAGG + Intronic
1121746527 14:96299268-96299290 CAGGAAAGGCTTTCTGGAGGTGG - Intronic
1121823912 14:96994946-96994968 CTGGGCAGTCATTCTGGAGGAGG + Intergenic
1122409018 14:101516763-101516785 CAGCATGGGGATGCTGGAGGAGG - Intergenic
1123771420 15:23533620-23533642 CAGGAGGGTGAAACTGGAGGTGG + Intergenic
1123973170 15:25528074-25528096 AAGGACAGTGATGCTGGAGGTGG + Intergenic
1123973178 15:25528109-25528131 AAGGACAGTGATGGTGGAGGTGG + Intergenic
1124181275 15:27477626-27477648 CAGGATATTGACAATGGAGGAGG + Intronic
1125801426 15:42451652-42451674 AACCATAGTAATTCTGGAGGTGG - Exonic
1127475461 15:59328303-59328325 CAGAAGAGAGATTCTGCAGGAGG + Intronic
1127497017 15:59523079-59523101 CAAGACAGAGATGCTGGAGGGGG - Exonic
1127686577 15:61351376-61351398 CAGGATAGTGTTTGAGCAGGGGG + Intergenic
1127846001 15:62871521-62871543 CAGGATTGTGTTTCTTCAGGAGG - Intergenic
1127949506 15:63790639-63790661 CAGGATAGTGATTGCCCAGGGGG + Intronic
1128621014 15:69150065-69150087 CGGGGTAGTAATACTGGAGGAGG - Intergenic
1129112652 15:73346764-73346786 CGGGAAACTGCTTCTGGAGGAGG + Intronic
1129699991 15:77762386-77762408 CAGGATAGGCTTCCTGGAGGAGG - Intronic
1130484518 15:84391155-84391177 TAGGCTCGTGTTTCTGGAGGAGG + Intergenic
1131467257 15:92665740-92665762 AAGGATAGCAATTCTGGAGCTGG + Intronic
1131565176 15:93479033-93479055 GAGGGTAGTGAGCCTGGAGGCGG + Intergenic
1133076398 16:3283857-3283879 CCTGATAGTGAAGCTGGAGGAGG + Exonic
1136412070 16:30083384-30083406 CAGGATAGCGAACCTGGGGGTGG - Exonic
1137463252 16:48685321-48685343 CAGGGTAGAGATTTTGGCGGGGG + Intergenic
1139255306 16:65535417-65535439 CAGGAAACTGATTATGGAGCAGG - Intergenic
1139504768 16:67393330-67393352 CAGGATACTGATTGGGGTGGCGG + Intronic
1140401735 16:74677458-74677480 CAGGAGAGTGAGGCAGGAGGAGG - Intronic
1140941249 16:79723376-79723398 GATGATATTGATTATGGAGGTGG + Intergenic
1141858673 16:86701807-86701829 CCGGATACTCACTCTGGAGGAGG - Intergenic
1142015256 16:87742573-87742595 CAGGATAGGGATCGTGGAGAGGG + Intronic
1142872286 17:2828680-2828702 CAGGTTTGTGATTCTGGCTGTGG + Intronic
1143760841 17:9102964-9102986 GAGGGTAGTGACTGTGGAGGAGG + Intronic
1143919447 17:10319198-10319220 CAGGAATGTTATTGTGGAGGAGG + Intronic
1144613441 17:16746133-16746155 GAGGAGATTGATACTGGAGGTGG - Intronic
1145133109 17:20376209-20376231 GAGGAGATTGATACTGGAGGTGG - Intergenic
1147408693 17:40233128-40233150 CAAGATACTGATTCTAGAGTTGG + Intronic
1147622802 17:41879168-41879190 GAGGAAGGTGATTCTGGAGTTGG - Intronic
1148022571 17:44563034-44563056 AAGAAGAGTGATTCTAGAGGAGG - Intergenic
1150628623 17:66859899-66859921 CAAAATAGTGATTATGGAAGAGG - Intronic
1152713923 17:81889166-81889188 CTGGATGGTGAGTCTGGGGGTGG - Exonic
1153022469 18:642590-642612 CAGGCTAGTGATTCCTGATGAGG + Intronic
1155248723 18:23935862-23935884 CAGGAGGGTTCTTCTGGAGGAGG + Intronic
1159640900 18:70862037-70862059 CATGCTAGTGATGCTTGAGGTGG + Intergenic
1159656978 18:71041750-71041772 CAAGAAAGTGGTTCTTGAGGTGG + Intergenic
1166565087 19:43759702-43759724 AAGGATAGTGGTTCTGGAAGAGG + Intergenic
1166699663 19:44874854-44874876 CCGGATTGTGTTTCTGGGGGTGG - Intronic
1167695888 19:51015507-51015529 CAGGATAGTGATGCTGGAGCAGG + Exonic
1167769703 19:51507469-51507491 CAGGAGAGGCCTTCTGGAGGAGG - Intergenic
925134265 2:1515396-1515418 CAGGAAGGAGATCCTGGAGGCGG + Intronic
927899182 2:26806579-26806601 CAGGAAGGTGATTTGGGAGGTGG - Intergenic
928717392 2:34077143-34077165 CCAGGTGGTGATTCTGGAGGTGG + Intergenic
928925915 2:36579406-36579428 CAGAAATGTGATGCTGGAGGTGG + Intronic
929862951 2:45694791-45694813 CAGGAGAGTGTATCTGGGGGTGG + Intronic
929996737 2:46831365-46831387 CCTGATTGTGATTCTGGAAGAGG + Intronic
929997202 2:46836146-46836168 GAGGAAAGCGATGCTGGAGGAGG - Intronic
931276815 2:60751369-60751391 CAGGATGTTGATAATGGAGGAGG + Intergenic
932080151 2:68706892-68706914 CAGGGGAGAGATCCTGGAGGAGG - Intronic
932216604 2:69970164-69970186 CAGGAGAGAGACTCAGGAGGAGG - Intergenic
936639385 2:114295048-114295070 CAGGGCAGTGATTCTCCAGGCGG + Intergenic
937387951 2:121454156-121454178 CAGCATATTAATTTTGGAGGGGG - Intronic
940294056 2:152104248-152104270 CAGATCAGTGGTTCTGGAGGGGG + Intergenic
941697904 2:168573030-168573052 CAGGAAAGGGTTTCTGGAGGAGG + Intronic
942999737 2:182311241-182311263 CAGGAAAGTTTTTCTGGAGTAGG - Intronic
943114292 2:183647001-183647023 CATGCTATGGATTCTGGAGGTGG - Intergenic
1170373161 20:15671601-15671623 CAGGATACTAAAGCTGGAGGGGG - Intronic
1172046845 20:32086523-32086545 CAGGAAAGACTTTCTGGAGGAGG + Intronic
1173553522 20:43949560-43949582 CAGGACAGTGATTCTGCAGGAGG - Intronic
1175440314 20:58986093-58986115 CAGGAGGATGATTCTGGAGAAGG + Exonic
1178152132 21:29807410-29807432 GAGGACGGTCATTCTGGAGGAGG + Intronic
1178438591 21:32580902-32580924 CAGGTTAGTGATACAGGATGGGG + Intronic
1178992876 21:37368685-37368707 GAGGAGAGTGAGTCTGGAGAGGG + Intronic
1181330345 22:22086207-22086229 CAGGAGAGTGTGTCTGGATGTGG + Intergenic
1182824714 22:33254843-33254865 CAGAATTCTGATGCTGGAGGTGG + Intronic
1183246198 22:36695459-36695481 CAGGGTGGTGATGCTGGATGGGG - Intronic
1183309309 22:37100905-37100927 GAGGAAAGGGCTTCTGGAGGTGG + Intronic
1183950595 22:41350484-41350506 CAGGGTGGTGATGCTGGAGGTGG + Intronic
951093926 3:18606655-18606677 CAGTATTTTGAATCTGGAGGTGG - Intergenic
953932047 3:47010286-47010308 CAGGATCGCGAGTCTGGAGATGG - Intergenic
954638248 3:52083279-52083301 GAGCATAGTGCTTCTGGAGAGGG + Intronic
956325354 3:68046148-68046170 GAATATAGTGATTCTGGCGGCGG + Intronic
964433304 3:156627002-156627024 CAGAATAGTCATTCTAGAGCTGG + Intergenic
965842069 3:172917496-172917518 GAGCATAGTGATTCTGGTGTAGG - Intronic
967117595 3:186355647-186355669 TAGGACAGTGATGCTGGTGGTGG - Intronic
969290227 4:6234184-6234206 CAGGAAAGTCTTCCTGGAGGAGG - Intergenic
969538890 4:7773634-7773656 CAGGATAGTGAAGATGCAGGAGG - Intronic
970140721 4:12979342-12979364 AAGGATAGTGGTGCTGGATGTGG + Intergenic
971575960 4:28275004-28275026 CAGGAGAGTCATTCAGGAGCAGG + Intergenic
973565022 4:52176841-52176863 CAGCATAGTGGTGTTGGAGGTGG - Intergenic
973832024 4:54771336-54771358 CAGGCCAGTAAGTCTGGAGGAGG + Intergenic
976108119 4:81641229-81641251 AAGAATGGGGATTCTGGAGGTGG - Intronic
977822192 4:101486049-101486071 CAGGATGTTGATAATGGAGGAGG - Intronic
981023277 4:140050805-140050827 CAAGGTAGCGATTCTGAAGGAGG - Intronic
983392080 4:167145073-167145095 CAGGATGGTCATGCTGGAGTTGG + Intronic
985367589 4:189248615-189248637 AAGAATAGTGATTCAGGAGATGG + Intergenic
985830783 5:2227773-2227795 CAGGACAGAGACGCTGGAGGTGG + Intergenic
988045137 5:25941462-25941484 CAGAATAGTAACTTTGGAGGTGG - Intergenic
988982445 5:36584862-36584884 CATTATTGTGGTTCTGGAGGAGG - Intergenic
991173250 5:63653480-63653502 AAGGATAGTGATACTGAAAGTGG + Intergenic
993424673 5:87748405-87748427 CAGGATGGTAATAGTGGAGGTGG + Intergenic
998822460 5:146069000-146069022 CAGGATAGTGGTTGTGAGGGAGG - Intronic
1001907788 5:175487408-175487430 CTGGATAGTGAAGCGGGAGGAGG - Intronic
1003689416 6:8337831-8337853 AAGGCTAGTGATGATGGAGGAGG - Intergenic
1004797526 6:19104007-19104029 CTGGCTAGAGATTCTGGAGGAGG - Intergenic
1005523050 6:26617022-26617044 CAGGATGTTGATAGTGGAGGAGG + Intergenic
1008364718 6:50664407-50664429 CTGCATAGTGATTATGGATGAGG - Intergenic
1009496454 6:64354413-64354435 TATGCTAGTGATTCTGTAGGTGG + Intronic
1010208789 6:73346701-73346723 CAGGATGGTGATTTTGTGGGTGG - Intergenic
1010340094 6:74740239-74740261 CAGTATAGACATTCAGGAGGGGG + Intergenic
1011350502 6:86417896-86417918 GAGGATATTGATTATGGTGGGGG - Intergenic
1017629281 6:156380749-156380771 CAGGCCAGTGGTTCTGAAGGTGG + Intergenic
1026895844 7:74009680-74009702 GAGGAAACTGAGTCTGGAGGTGG + Intergenic
1027465086 7:78505049-78505071 CAGGATAGTAAATTTGGATGGGG + Intronic
1030383191 7:108836792-108836814 CAGGAAAATGGCTCTGGAGGTGG + Intergenic
1030528113 7:110677914-110677936 CAGGATGGTGATACCAGAGGGGG - Intronic
1031695002 7:124840092-124840114 GAGGATGTTGATACTGGAGGAGG - Intronic
1033443520 7:141400977-141400999 CCAGATAGTCATTCTGAAGGAGG - Intronic
1037378053 8:18253230-18253252 TAGGATAGTGAATCTGGAGGAGG + Intergenic
1037805353 8:22055561-22055583 CAGGAGAGTGATGTGGGAGGGGG - Intronic
1038160971 8:25037267-25037289 CAGGATAGTGGTTGTGGGGTGGG - Intergenic
1038871794 8:31503441-31503463 CAGCACAGTCATACTGGAGGTGG - Intergenic
1040604562 8:48918846-48918868 CAGGAGAGACATTCTGGAGAAGG + Exonic
1041389396 8:57335627-57335649 CAGGAGGGTGTCTCTGGAGGAGG + Intergenic
1041729938 8:61052938-61052960 CAGGTTGGTGATGGTGGAGGTGG + Intergenic
1042339468 8:67663952-67663974 CAAGATAGTGAAGCAGGAGGGGG + Intronic
1043917490 8:85939471-85939493 CAGGATAGTGCTACAGGAGTGGG - Intergenic
1044355085 8:91213128-91213150 GAGGATATTGATTATGCAGGGGG + Intronic
1044865067 8:96562877-96562899 CAGGTTAGTGACTCTGGTGGGGG + Intronic
1044897001 8:96903003-96903025 CAGGATAGTGATCCTTCAGTTGG + Intronic
1046888217 8:119392499-119392521 CAGGAAAGTCTTTCTGGAGGTGG + Intergenic
1048561629 8:135544782-135544804 CAGTATGGTGATTCTGCAAGTGG + Intronic
1050238086 9:3604310-3604332 GAGAATAGTGCTCCTGGAGGTGG - Intergenic
1050249647 9:3731288-3731310 CAGCATAGTCCTTCTGGATGAGG - Intergenic
1050505415 9:6342897-6342919 CAGGGTATTGATTCTTCAGGGGG - Intergenic
1050681504 9:8117109-8117131 CTGGTTAATGAATCTGGAGGGGG - Intergenic
1052978369 9:34428994-34429016 CATGATAGTGCTCCTGGAGATGG - Intronic
1054754864 9:68947346-68947368 CAGGGCAGTGTCTCTGGAGGTGG - Intronic
1055743458 9:79415699-79415721 CAGGATGTTGATACTGGAGGAGG + Intergenic
1056568292 9:87794039-87794061 CAGCAAAGTGCTTCTGGGGGTGG + Intergenic
1058123675 9:101167421-101167443 CAGGAAAGTATTTTTGGAGGTGG - Intronic
1058865685 9:109160318-109160340 CAGGATTGTGAGACTGTAGGTGG - Intronic
1059382875 9:113941950-113941972 GAGGAAAGTGAGTCTGGAGAGGG - Intronic
1060477227 9:123995900-123995922 GAGTAAAGTGATTCAGGAGGAGG - Intergenic
1061504351 9:131022934-131022956 CAGGATAGGGGTTCAGGATGGGG - Intronic
1062280753 9:135750648-135750670 CAGGATAGGGATTGGGGAGCAGG - Intronic
1186855706 X:13624158-13624180 CAGGAGAGTGAATATGGAAGAGG - Intronic
1187365386 X:18662034-18662056 CAAGCTAGTGATACTGGAGGGGG - Intronic
1188518016 X:31008394-31008416 CATGATAGTGATTTTGAGGGAGG + Intergenic
1191952252 X:66605207-66605229 CAGGATTGTGGTTATGGAGAGGG - Exonic
1193635389 X:83943895-83943917 CAGCAGAGTGATGCTGGGGGTGG + Intergenic
1193691438 X:84649611-84649633 CAGGAAAGAGATTATGGAGAAGG + Intergenic
1193972729 X:88076468-88076490 CAGGATTGTGTTTGGGGAGGGGG + Intergenic
1196376567 X:115039752-115039774 CATGACAGTGATACGGGAGGGGG + Intergenic
1197127833 X:122968814-122968836 CAGGAAAGGGCTTCTTGAGGAGG + Intergenic
1198456025 X:136818737-136818759 CATGAAAGAGATTGTGGAGGTGG - Intergenic
1198758993 X:140011691-140011713 CAGCAAAGTGATTTGGGAGGTGG + Intergenic
1198779751 X:140221881-140221903 CAGCAAAGTGATTTGGGAGGTGG - Intergenic
1198840892 X:140856737-140856759 CAGGAAAGTCTTTATGGAGGAGG - Intergenic
1199320617 X:146433905-146433927 CATGACAGTGATTTTGGAGGTGG + Intergenic
1199894773 X:152118719-152118741 CAGGATAGGGTTTCTGGTGGGGG + Intergenic
1200364404 X:155645910-155645932 CAGAAGAGTGAATCTGGAGAGGG - Intronic
1201063521 Y:10069010-10069032 CAGGATAGAGTCTCTGCAGGAGG - Intergenic
1202366829 Y:24171341-24171363 TAGGCTCGTGTTTCTGGAGGAGG + Intergenic
1202503953 Y:25498782-25498804 TAGGCTCGTGTTTCTGGAGGAGG - Intergenic