ID: 1101052110

View in Genome Browser
Species Human (GRCh38)
Location 12:100874246-100874268
Sequence ACAAGGCAGTGCCCCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 4, 2: 28, 3: 73, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101052110_1101052113 -6 Left 1101052110 12:100874246-100874268 CCTTCACTGGGGCACTGCCTTGT 0: 1
1: 4
2: 28
3: 73
4: 286
Right 1101052113 12:100874263-100874285 CCTTGTGGAGCTGTGAGAAGAGG 0: 18
1: 1691
2: 2088
3: 1458
4: 1028
1101052110_1101052115 9 Left 1101052110 12:100874246-100874268 CCTTCACTGGGGCACTGCCTTGT 0: 1
1: 4
2: 28
3: 73
4: 286
Right 1101052115 12:100874278-100874300 AGAAGAGGGCCACTGTCCTCTGG 0: 9
1: 22
2: 27
3: 55
4: 202
1101052110_1101052114 -5 Left 1101052110 12:100874246-100874268 CCTTCACTGGGGCACTGCCTTGT 0: 1
1: 4
2: 28
3: 73
4: 286
Right 1101052114 12:100874264-100874286 CTTGTGGAGCTGTGAGAAGAGGG 0: 18
1: 1782
2: 2088
3: 1403
4: 2996
1101052110_1101052117 21 Left 1101052110 12:100874246-100874268 CCTTCACTGGGGCACTGCCTTGT 0: 1
1: 4
2: 28
3: 73
4: 286
Right 1101052117 12:100874290-100874312 CTGTCCTCTGGAACCCAGAATGG 0: 1
1: 8
2: 79
3: 649
4: 1261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101052110 Original CRISPR ACAAGGCAGTGCCCCAGTGA AGG (reversed) Intronic
902540730 1:17152652-17152674 ACTAGGCTGTGCCCCAGTTAGGG - Intergenic
902672521 1:17984711-17984733 CCAAGGGAATGCTCCAGTGACGG + Intergenic
902919091 1:19656000-19656022 ACCAGGGTGTGCCCCAGTCAGGG - Intronic
904128997 1:28261659-28261681 ACCAGGCACTGACCCAGAGAGGG - Intronic
906533915 1:46540867-46540889 GCAAAGCTGAGCCCCAGTGACGG - Intergenic
909099377 1:71331982-71332004 ACTAGGCATTGCCCTAGTGGAGG + Intergenic
909405305 1:75281954-75281976 ACTAGGCAATGCCCCAGTGGAGG - Intronic
909747582 1:79117178-79117200 TCCAGAAAGTGCCCCAGTGATGG + Intergenic
912068687 1:105779801-105779823 ACCAGGCAGTGCCCCAGTGAGGG - Intergenic
912084054 1:105977084-105977106 ACCAAGCAGTGCCCCAGTGTGGG - Intergenic
915319323 1:155047641-155047663 ACAGGGCAGTTCTGCAGTGAGGG + Intronic
915786993 1:158624222-158624244 ACTAGGCAGTACCCCAGTGAGGG - Intronic
915903363 1:159861867-159861889 ACAGGGCAGTGCCCCACTCTAGG - Intronic
917152102 1:171956644-171956666 ACTAGGCAGTGCCCCAGTAAGGG + Intronic
917408745 1:174736560-174736582 ACTAGGCAGTGCCCTGGTGGAGG + Intronic
918207008 1:182318378-182318400 ACATGGCAGCCCTCCAGTGAAGG - Intergenic
919393503 1:197016623-197016645 ATAATGCAGTGCACCACTGATGG - Intergenic
919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG + Intergenic
921996554 1:221425839-221425861 ACTAGGCAGCACCCCAGTGGGGG + Intergenic
922575422 1:226658209-226658231 ACCAGGCTTTTCCCCAGTGAAGG - Intronic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923179143 1:231499236-231499258 ACTAGGTAGTGCCCCAGTGGGGG + Intergenic
924858553 1:247898235-247898257 ACAAACCAGAGCCCCAGAGAGGG + Intergenic
1062770465 10:96340-96362 ACTAGGCAGTGCCCCTGTGGGGG + Intergenic
1066684248 10:37965279-37965301 ATTAGGCAGTACCCCAGTGGGGG - Intronic
1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG + Intergenic
1067060151 10:43074140-43074162 TCAAGGCTCTGCCCCAGTGCAGG - Intergenic
1067138144 10:43629921-43629943 ACAAGGGCGTGACCCATTGAAGG - Intergenic
1067274964 10:44826250-44826272 ACATCACAGTGCCTCAGTGATGG + Intergenic
1067350940 10:45474938-45474960 AGAAGGCATTGCTCCAGGGAGGG + Intronic
1068005022 10:51382975-51382997 ACAAGGCATTTCCCTAGAGAGGG - Intronic
1068147772 10:53093166-53093188 ACTAGGCAGTGCTCCTGTGTAGG - Intergenic
1068399419 10:56509055-56509077 ACTAGACAGTGCCCCAGTGGTGG - Intergenic
1068604512 10:58990424-58990446 ACTAGACAGTGCCTCAGTGGGGG - Intergenic
1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG + Intergenic
1069629810 10:69890579-69890601 CCCTGGCAGTGCCCCAGTCATGG - Intronic
1069773489 10:70913791-70913813 AAATGCCAGTGCCCCAGTGGAGG + Intergenic
1069929818 10:71874813-71874835 ACAGGGCACTGCCCCATGGAAGG - Intergenic
1070581639 10:77724909-77724931 ACTAGGCAGTGGCCCAGTGGGGG - Intergenic
1070637659 10:78142170-78142192 ACTAGGCACTGCCCCGGTGGGGG - Intergenic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1074803945 10:117028897-117028919 ATCAGGCAGTGCCTCAGTGGGGG - Intronic
1076166237 10:128284912-128284934 ACAAGGCAGGGACCCTGAGATGG - Intergenic
1076813220 10:132899721-132899743 TCAAGACAGTGACCCAGGGAGGG - Intronic
1076875466 10:133213567-133213589 CCAAGGCAGGGTCCCAGGGAGGG - Intronic
1078508280 11:11967808-11967830 CCAGGGCACTGCCCCAGTGCAGG - Intronic
1078546986 11:12253775-12253797 GAAGGGCAGTGCCCCAGAGACGG - Intronic
1079002935 11:16772993-16773015 ACAAGGCAGAAACCCAGGGAAGG - Intergenic
1079106334 11:17574708-17574730 ACAGGACAGTGCTGCAGTGAGGG - Exonic
1079153932 11:17926599-17926621 ATAAGGCAGATACCCAGTGATGG - Intronic
1082179292 11:49099218-49099240 AAAATGCAGTGCTTCAGTGAAGG - Intergenic
1083276007 11:61597551-61597573 AAAGGGCTGGGCCCCAGTGAAGG - Intergenic
1083319022 11:61834055-61834077 ACAGGGCAATGACCCAGGGAAGG + Intronic
1085079304 11:73620947-73620969 ACAAGGAAGTGGCCCAGGCAGGG + Intergenic
1085169954 11:74441398-74441420 ACAAGCCAGAGTCCCAGAGAGGG - Intergenic
1085593928 11:77791006-77791028 ACTAGGCAGTGCCCCAGGTAGGG + Intronic
1085854860 11:80164642-80164664 AGAAGGCAGTGCAGCTGTGAAGG - Intergenic
1086056600 11:82654217-82654239 ACTAGGCAGTGCCCCAGTAAAGG - Intergenic
1086685995 11:89733704-89733726 AAAATGCAGTGCTTCAGTGAAGG + Intergenic
1086705459 11:89946788-89946810 AAAATGCAGTGCTTCAGTGAAGG + Intergenic
1086956822 11:92942245-92942267 AAAGGGCAGTGCATCAGTGAAGG - Intergenic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1087675656 11:101158410-101158432 ACCAGGCTGTGCTCCAGTGGGGG - Intergenic
1088573226 11:111243249-111243271 ACACAGTAGGGCCCCAGTGAGGG - Intergenic
1088586556 11:111364801-111364823 GCAAGGCAGCACCACAGTGAGGG + Intronic
1088587225 11:111369769-111369791 GCAAGGCAGTACCATAGTGAGGG + Intronic
1088708854 11:112488073-112488095 ACAAGACAGTGCCCCATTAGAGG + Intergenic
1088946943 11:114523813-114523835 ACAAGGCATTGGCTCAGTGATGG - Intronic
1089196711 11:116697770-116697792 ACAAGGAAGATCCCCAGAGAAGG + Intergenic
1089218651 11:116852278-116852300 ACAAGGCAGAGCCCAAAGGAGGG - Intronic
1089748795 11:120635538-120635560 AAAAGGAAGTCCCCCAGGGAGGG + Intronic
1090134009 11:124176865-124176887 ACTAGGCAGGGTCCCAGTGCAGG - Intergenic
1090392065 11:126395167-126395189 AGATGGCATTGCCCCAGTGCAGG - Intronic
1090729199 11:129555187-129555209 ACAGGGCATTGCCCAAGTGAGGG - Intergenic
1093563007 12:20564853-20564875 ACAAGGTAGTGCCCATGTCATGG - Intronic
1094815417 12:34178908-34178930 ACTAGGCCATGCCCCAGTGGGGG + Intergenic
1095216714 12:39557941-39557963 ACTAGGCAATGCCCCAGTGGGGG - Intronic
1096304669 12:50463798-50463820 ACTATGCAGTGCCCTAGTGGAGG + Intronic
1096478673 12:51923880-51923902 ACAAGGTAGGTCCCCAGGGAAGG - Intergenic
1096593968 12:52682350-52682372 AGACAGCAGTGCCACAGTGATGG - Intergenic
1096672605 12:53209225-53209247 GCAAGGCACTGTCCCAGGGAAGG + Intergenic
1097501520 12:60409819-60409841 CCTAGGCAATGCCCCAGTGGGGG + Intergenic
1097571238 12:61335000-61335022 ACTAGGCAATGCCCCAGTAAGGG + Intergenic
1097992329 12:65848944-65848966 TTAAGGCAGTTCCCCAGTGCAGG + Intronic
1098297189 12:69015856-69015878 ACAAGGCATTGCACCAGGCAGGG - Intergenic
1099658711 12:85527835-85527857 ACTAGACAATGCTCCAGTGAGGG - Intergenic
1099760320 12:86912548-86912570 ACTAGGCAGTGTCTCAGTGGGGG - Intergenic
1099984701 12:89649149-89649171 ACTAAGCAGTGCCCTAGTGGGGG - Intronic
1100473058 12:94910902-94910924 TAAAGACAGTGCCCCAGTGGAGG + Intronic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1102675227 12:114653432-114653454 ACAAGGCAGTGGGCCAGGCATGG - Intergenic
1103581336 12:121917910-121917932 ACACTGCCATGCCCCAGTGATGG - Exonic
1104742031 12:131184718-131184740 ACTAGGCAGTGCCCCAATGTGGG + Intergenic
1107912439 13:45118079-45118101 AGAAGTCAGTGCCCCAGAGAAGG - Intergenic
1110062663 13:71062337-71062359 ACTTAGCAGTGCCCCAGTGGGGG + Intergenic
1111239690 13:85457871-85457893 ACTAGCCAGTGTCCCAGTGGGGG - Intergenic
1112854170 13:103745930-103745952 ATCAGGCAAAGCCCCAGTGATGG - Intergenic
1113029359 13:105976561-105976583 AGTAGGCAGTGCCCCAATGCGGG + Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1113604733 13:111597251-111597273 ACAAGGGAGGTCCCCAGAGACGG - Intronic
1113962917 13:114135123-114135145 AGAAGGCAGAGCTCCAGAGAAGG + Intergenic
1115340769 14:32291185-32291207 ACTAGGCAGTGCCCCACAGTGGG - Intergenic
1116095327 14:40359848-40359870 ACTAGGCAATGCCCCAGTCTGGG - Intergenic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1116287177 14:42988122-42988144 ACTAGGCAGTGTCCCAGTAGGGG - Intergenic
1116485543 14:45444197-45444219 ATTAGGCAGTGCCCCAGTGTGGG - Intergenic
1117928627 14:60813112-60813134 ACATGGCAGTGCCCAGGTGAGGG - Intronic
1118715527 14:68556957-68556979 AAATGGCAGTGCCCCAATGCCGG - Intronic
1122072494 14:99213756-99213778 TCCAAGCAGTGCCCCAGAGAGGG - Intronic
1124464038 15:29920099-29920121 ACCTGGCAGTGCCCCAGTTTCGG - Intronic
1125723909 15:41858530-41858552 ACAGGACAGTGCCCCAGAGCTGG - Intronic
1126592028 15:50350074-50350096 AGAAGGCAGTACCCCACTGTAGG + Intronic
1126984053 15:54282506-54282528 ACATGGCACTGCCCAGGTGAGGG + Intronic
1127576225 15:60295098-60295120 ACTAGGCAGTGCCCCAGCAGGGG + Intergenic
1128878388 15:71221022-71221044 CCAAGGCTGTGTCCCCGTGATGG + Intronic
1130105826 15:80927845-80927867 ATAAGACAGTGCCCTAATGATGG + Intronic
1131425980 15:92345813-92345835 ACACAGGTGTGCCCCAGTGATGG + Intergenic
1131987566 15:98060503-98060525 ACTAGGCAGTGCCCCAGTAGAGG + Intergenic
1132558116 16:581404-581426 GCAGGGAAGAGCCCCAGTGAGGG - Intronic
1132576680 16:667492-667514 ACAACGCAGTGCACCTGTGCAGG + Exonic
1132751366 16:1459357-1459379 ACACGTCAGGGCCCCAGGGAAGG + Intronic
1133269328 16:4602778-4602800 AGAAGGCAGTGCCCAAGGGAGGG + Intergenic
1135876335 16:26203817-26203839 CCAAAGCAGAGCCCCATTGAAGG - Intergenic
1136628952 16:31478033-31478055 ACAGGGCAGTGACCTAGAGACGG - Intergenic
1139489280 16:67278096-67278118 AGAAGGCAGTGACTCAGTGGGGG + Exonic
1139893485 16:70269647-70269669 ATCAGCCAGTGCCACAGTGATGG + Exonic
1140219372 16:73032914-73032936 ACAAATCAGAGCCCCAGTGGAGG + Intronic
1140708245 16:77651497-77651519 ACAAGGCACTGCTCAAGAGAAGG - Intergenic
1142205036 16:88778858-88778880 ACAAGGCTGTGGCCCAGGGAAGG + Intronic
1144072612 17:11688349-11688371 AGAAGGGAGTGGCCCAGGGAAGG + Intronic
1144763815 17:17722384-17722406 ACAGGGCAGGGCCACGGTGAGGG - Intronic
1146126980 17:30237881-30237903 ACAGGGCAGTGCCATAGGGAGGG - Intergenic
1148099164 17:45077348-45077370 ACAAAGCAGTGTCCCATTGTTGG - Intronic
1148390502 17:47268800-47268822 ACTAGGCAGTGCCCGAGTGGGGG + Intronic
1148835352 17:50463087-50463109 TCAAGGCAGTGGCCCAGGGTGGG + Intronic
1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1149119269 17:53141836-53141858 AGAAGGCAGTGCTCCTGTTAGGG - Intergenic
1149135573 17:53359676-53359698 ACTAGGCAGTGCCCCTGTGGGGG - Intergenic
1151422837 17:74009752-74009774 ACCAGGCAGTCCCACAGTGGGGG - Intergenic
1152522932 17:80870648-80870670 AGAAGGCAGTGCCCTGGTGGGGG + Intronic
1156154680 18:34287693-34287715 GCTAGGCAGTACCCCAGTGGGGG + Intergenic
1156231754 18:35159907-35159929 CTAAGGCAGTGACCCACTGATGG + Intergenic
1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG + Intergenic
1159713890 18:71797675-71797697 ACTAGGTATTGCCCCAGTGGGGG - Intergenic
1160910466 19:1471545-1471567 ACGAGGCGTTGCCCCAGTCACGG - Exonic
1161075012 19:2281264-2281286 ACACAGCAGGGCCCCAGAGAGGG - Intronic
1161075034 19:2281350-2281372 ACACAGCAGGGCCCCAGAGAGGG - Intronic
1161075054 19:2281436-2281458 ACACAGCAGGGCCCCAGAGAGGG - Intronic
1161075073 19:2281522-2281544 ACACAGCAGGGCCCCAGAGAGGG - Intronic
1161075095 19:2281608-2281630 ACACAGCAGGGCCCCAGAGAGGG - Intronic
1161075107 19:2281651-2281673 ACACAGCAGGGCCCCAGAGAGGG - Intronic
1161075127 19:2281737-2281759 ACACAGCAGGGCCCCAGAGAGGG - Intronic
1162495312 19:11020071-11020093 AGAAGCCAGGGCCCCAGGGAGGG - Intronic
1163110925 19:15160761-15160783 GGCAGGCAGTGCCCCAGTGGTGG + Exonic
1164082346 19:21869673-21869695 TCAAGGAAGGCCCCCAGTGATGG - Intergenic
1165110110 19:33497449-33497471 AGAAGGCAGTTCCCCTGAGAAGG - Intronic
1166834566 19:45659337-45659359 ACCAGGCAGTGCCCCTGTCCAGG - Intergenic
1167246561 19:48376501-48376523 TCAAGGTGGTGCCCCAGTGATGG - Intergenic
925306730 2:2851915-2851937 AGAAGGCAGGGACCCAGAGAAGG + Intergenic
926613638 2:14972994-14973016 AAAAGGCAGTGTCACAGGGAAGG - Intergenic
930411758 2:51032883-51032905 CCAAGGCAGAGCCACAGTAAGGG - Intergenic
930626117 2:53699206-53699228 TCAAGATGGTGCCCCAGTGATGG - Intronic
930687560 2:54325696-54325718 ACTAGGCAATGCTCCAGTGGGGG - Intergenic
931487173 2:62705564-62705586 GCAAGGCGGAGCCCCTGTGATGG + Intronic
932068573 2:68592560-68592582 ACAAGGCAGTGGCCAGGAGAAGG + Intronic
932583756 2:73009353-73009375 ACGAGGCAGTGGCCCAGGGGTGG + Intronic
933563473 2:83919112-83919134 TAAAGGCAGTGCCAGAGTGATGG + Intergenic
933584988 2:84170157-84170179 ACCAGGCACTGCCCTAGTTATGG - Intergenic
934144192 2:89075469-89075491 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
934225051 2:90125079-90125101 ACTAAGCAGTGCCCCAGTAGGGG + Intergenic
934765812 2:96879440-96879462 GCCAGGCAGTGCCCCAGCAATGG + Intronic
936788756 2:116125418-116125440 ATTAGGCAGTGGCCCAGTGGTGG + Intergenic
936792346 2:116164747-116164769 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
937941699 2:127291205-127291227 ACCAGGCAGAGCCACAGTGTTGG + Intronic
938135843 2:128755821-128755843 ACAAGGCACAGCCCCGGAGATGG - Intergenic
940288948 2:152059195-152059217 ACTATGCAGTGCCCCAGTGGGGG - Intronic
940425930 2:153532069-153532091 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
941527001 2:166618487-166618509 ACTAGACAGTGCCCCAGTGGGGG - Intergenic
943092966 2:183395897-183395919 ACTAGGCAGTGCCCCAGTACAGG - Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
943936113 2:193919003-193919025 ACTAGGCAGGGTCCCATTGAGGG - Intergenic
944477750 2:200124810-200124832 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG + Intergenic
945360151 2:208886882-208886904 ACTAGGCAATGCCCCAGTAGGGG - Intergenic
946623842 2:221589970-221589992 TGACGGCAGTCCCCCAGTGAAGG + Intergenic
946806841 2:223479535-223479557 ACAAGGCAGTACCCAAGGCAGGG - Intergenic
947007766 2:225531753-225531775 ACAAAGCAGGGCCTGAGTGATGG - Intronic
949048224 2:241881979-241882001 ACTTGGCTGGGCCCCAGTGAAGG - Intergenic
1170732098 20:18984679-18984701 TCAAGCCAGTGGCGCAGTGAAGG + Intergenic
1172030543 20:31979263-31979285 AGAATGCAGTGCCACAGTCATGG + Intronic
1173338907 20:42136666-42136688 TCCAGGCACTGCCCCACTGAGGG + Intronic
1173698664 20:45046382-45046404 ACAGTGCAGTGCCACAGTCATGG - Intronic
1174910563 20:54603466-54603488 ACAAGGCAGTGTCCGAGTTTAGG - Intronic
1175736513 20:61391015-61391037 AGGAGGCAGTGCCGCAGTGGGGG + Intronic
1175994917 20:62807733-62807755 ACCAGGCTGTGCCCCAGGCAGGG - Intronic
1177211427 21:18076782-18076804 ACTAGGCATTGCCCTAATGAGGG - Intronic
1177522115 21:22239322-22239344 ACTAGGCAATGGCCCAGTGGGGG - Intergenic
1178903339 21:36615354-36615376 ACTAGGCATTGCCCTAGTGAAGG + Intergenic
1179341684 21:40516746-40516768 ACTCTGCAGTGCCCCAGTGTGGG + Intronic
1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG + Intronic
1182940268 22:34270090-34270112 ACTAGGCATTGCCCCAGTAGGGG + Intergenic
1183177501 22:36235111-36235133 ACTAGGCAGAGCCTCAGAGAGGG + Intronic
1184198461 22:42947922-42947944 AGAATGGAGTGCCCCAGTGTGGG - Intronic
1184677430 22:46051298-46051320 ACAAGCCACTGCCCCTTTGAGGG - Exonic
951180652 3:19654760-19654782 ACCAGGCAGTGCCCCAGCTGGGG + Intergenic
951446122 3:22782471-22782493 ACTAGGCAGTGTCCCAAGGAGGG + Intergenic
951449347 3:22819058-22819080 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
952589382 3:34932464-34932486 ACCAGGCAGTGCCCCAGTGGGGG - Intergenic
953377954 3:42444701-42444723 ACTGGGCAGTGCCCCAGTGAGGG - Intergenic
953804044 3:46052471-46052493 ACAATGCAGTGCCCCACCCAGGG - Intergenic
954463082 3:50638702-50638724 TCAGGGCAGTGTCCCAGAGAGGG - Intronic
954591603 3:51788083-51788105 ACCAGGCAGTGCCCCAGTAGGGG - Intergenic
956246248 3:67186520-67186542 ACTAGGCAGTACCTCAGTGTGGG + Intergenic
956572516 3:70712546-70712568 ACTAGTCAGTGCTCCAGTGGGGG + Intergenic
958555674 3:95673323-95673345 GCTGGGCATTGCCCCAGTGAGGG + Intergenic
959818508 3:110704131-110704153 ACTAGGTAGTGACCCAGTGAAGG + Intergenic
960121388 3:113951250-113951272 ACTGGGCAGTGCCCTAGTGGGGG + Intronic
960581483 3:119282854-119282876 ATGAGGCAGTGCCCCAGTGGGGG - Intergenic
961598862 3:128043210-128043232 ACACGGCAGTGCCCAGGTGAGGG + Intergenic
962461039 3:135612881-135612903 AATAGGCAGTGTCCCAGTGGGGG - Intergenic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
963853360 3:150228872-150228894 TCAAGGCAGTGACCAAGTGGAGG - Intergenic
964275908 3:155008792-155008814 TCAAGGGAGGGACCCAGTGAAGG - Intergenic
966668461 3:182499565-182499587 ACAAGGCCATTCTCCAGTGAGGG + Intergenic
966861071 3:184231004-184231026 ACAAGGCAGTGCCCGGAGGAAGG - Intronic
967129030 3:186453601-186453623 TCAGGGCAGGGCCCCCGTGATGG + Intergenic
967275125 3:187766897-187766919 ACAAGGCAGTGACCTAGACAAGG + Intergenic
967582773 3:191179363-191179385 AGTAGGCAGTGCCCCAGTTGAGG - Intergenic
967633918 3:191778611-191778633 ACCAGGTAGTGCCCCAGTGTGGG - Intergenic
968337620 3:197926812-197926834 GCAAGGCTGACCCCCAGTGAAGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
971510482 4:27417524-27417546 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
971710536 4:30105604-30105626 ACTAGGCAGTGCCTCTGTGTGGG + Intergenic
971962556 4:33507763-33507785 ACTAGGCAGTGCCCTAGTTGGGG - Intergenic
974485124 4:62494500-62494522 ATTAGGCAATGCCCCAGTGGGGG - Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
975230264 4:71924361-71924383 ACAAGACAGTGCCCTAATGGGGG - Intergenic
975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG + Intergenic
975992169 4:80268305-80268327 ACCAGGCAGAGCCCCAGCCAGGG + Intronic
976132237 4:81896902-81896924 ACAAGGCAGTGTTGGAGTGAAGG - Intronic
976715669 4:88120308-88120330 ACTAAGCAGTGCCTCAGTGGGGG - Intronic
976908037 4:90263921-90263943 ACAAGTCATGGCCCCTGTGAGGG - Intronic
978423707 4:108560767-108560789 AAAAGGCATTGTCCCAGGGAGGG - Intergenic
978931744 4:114322651-114322673 ACAATGCAGAGCCCAAGAGAAGG + Intergenic
979087235 4:116428498-116428520 AATAGGCAGTGCCCCAGTGGGGG - Intergenic
979443147 4:120776648-120776670 AGAAAGCTGTGCCCTAGTGAAGG - Intronic
981398850 4:144288107-144288129 ACCAGTCAATGCCCAAGTGAGGG + Intergenic
981522162 4:145674403-145674425 ACAAGTCAGTGCCCATGAGAAGG + Intergenic
981799318 4:148637300-148637322 ACTAGGCAGTGCCCCAGTTAGGG + Intergenic
981959786 4:150522886-150522908 ACTAGGCATTGCCCTAGTGGGGG - Intronic
982227708 4:153181400-153181422 ACAAGGCAGCGACCATGTGATGG + Intronic
982240004 4:153290417-153290439 CCAAGGGATTTCCCCAGTGAGGG - Intronic
982337636 4:154257991-154258013 ACGATGCAGGGCCCCAGTGTGGG + Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
983419214 4:167496290-167496312 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
983469288 4:168136784-168136806 ACTAGGCAGTGTCCCAGTGTGGG + Intronic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
986533424 5:8761979-8762001 ACTAGGCAGTGCCCTAGTGAGGG - Intergenic
986873687 5:12080898-12080920 TGAAGGCACTGCTCCAGTGAGGG + Intergenic
987881296 5:23749510-23749532 ACTAGGCAGTGACCCAGTGGGGG + Intergenic
987983876 5:25121578-25121600 ACTGGGCAGTGCCCCAGTGGGGG + Intergenic
988131218 5:27108699-27108721 GAAAGGCAGTCTCCCAGTGACGG - Intronic
990093384 5:52083078-52083100 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
991321950 5:65383761-65383783 ACTAGGCATTGCCCTAGTGGGGG + Intronic
991601823 5:68358665-68358687 ACAATGCAGTGCCCTATTGTTGG + Intergenic
993117545 5:83735638-83735660 ACTAGGCAGTGCACCAGTGGCGG - Intergenic
993421813 5:87712203-87712225 ACATGGCAGAGCCCCAGTGTTGG - Intergenic
993967149 5:94372293-94372315 GCTAGGCAGTGCCCCAGTGGGGG + Intronic
994898784 5:105744121-105744143 ACAGGGCAGGTCCCCAGTGACGG + Intergenic
995398672 5:111716848-111716870 AAAAGGCAGAGCCCCAGTCAGGG - Intronic
995784070 5:115809621-115809643 ACAAGGAAGAGCACAAGTGAAGG - Intronic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
996101563 5:119450310-119450332 AGAGGGCAGGTCCCCAGTGAGGG - Intergenic
996861716 5:128074356-128074378 GCAAGGCAGTTGCCCAGGGAGGG + Intergenic
996929180 5:128865939-128865961 ACAAGGCAGTGTATGAGTGAAGG + Intronic
997897696 5:137734673-137734695 CCATGGCAGTGCACCACTGAGGG - Intronic
999366862 5:151028927-151028949 TCAAGCCAGTGGACCAGTGAGGG - Exonic
999635295 5:153615685-153615707 ACAAAGCAACTCCCCAGTGATGG - Intronic
1000674618 5:164105600-164105622 ACTATGCAGTGTCCCAGTGGGGG - Intergenic
1000751074 5:165097449-165097471 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1001181632 5:169526058-169526080 ACTAGACAGTGCCCCAGTAGGGG + Intergenic
1001978371 5:176019813-176019835 ACAAGGCTGTGCCCCAGCTCAGG + Intronic
1002157707 5:177295826-177295848 ACCAGACAGAGCCCCATTGAGGG + Exonic
1002239046 5:177823949-177823971 ACAAGGCTGTGCCCCAGCTCAGG - Intergenic
1002478987 5:179486854-179486876 ACAAGGTATTGCCCCACTAATGG + Intergenic
1002535492 5:179873438-179873460 ACAGGGCAGTGCCCCCGACAAGG + Intronic
1002757155 6:172799-172821 ACTAGGCAGTGCCCCAGGTGGGG - Intergenic
1003233032 6:4271892-4271914 ACATGGCAGTGTCCCTGAGATGG - Intergenic
1004036386 6:11928180-11928202 ACAAAGAACTGCCCCAGTGAAGG - Intergenic
1005802968 6:29445661-29445683 ACAAATCAGTGCCCTAGGGAGGG + Intronic
1006093660 6:31642868-31642890 ACCAGGCATCGCCACAGTGATGG + Exonic
1006402323 6:33825070-33825092 ACAAGGCACTGTGGCAGTGAGGG - Intergenic
1009392027 6:63155901-63155923 ACAAGCATGTGCCCCAGTGGAGG - Intergenic
1010055149 6:71556377-71556399 ACTAGGCAGTGCTTCAGTGTGGG - Intergenic
1010898241 6:81392604-81392626 ATTAGGCAGTGTCCCAGTGGAGG - Intergenic
1011209730 6:84942253-84942275 ATAAAGCAGTGAACCAGTGATGG + Intergenic
1011345832 6:86368889-86368911 ACCAGGCAGTGCCCTAGTAGAGG - Intergenic
1012649579 6:101736296-101736318 ACTAGGCAGTGCCCCAGTAGGGG + Intronic
1013225023 6:108114546-108114568 ACAAAGCGGAGCCCCAGTGCTGG - Intronic
1013613398 6:111817884-111817906 ACCAGACAGTGCCCCAGTGGAGG - Intronic
1013728371 6:113130088-113130110 ATAAGTCTGTGCCCCATTGAAGG + Intergenic
1014068112 6:117150571-117150593 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
1014563053 6:122914089-122914111 ACTAGGCAGTGCCCCAGTTGGGG - Intergenic
1016549007 6:145255857-145255879 AGAGGGCAGGTCCCCAGTGAGGG - Intergenic
1017125277 6:151059018-151059040 TTGAGGCAGTGCCTCAGTGAGGG + Intronic
1017313485 6:153002137-153002159 ATAAGGCACTGTCCCTGTGATGG - Intronic
1018196717 6:161361822-161361844 TCACGGCAGAGGCCCAGTGAGGG + Intronic
1018469490 6:164083172-164083194 CTAAGGCAGTGCCCCAGAGAGGG + Intergenic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1018573767 6:165236853-165236875 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1024338792 7:48236612-48236634 AAATGTCAGTGCCCAAGTGATGG - Intronic
1025724442 7:64044219-64044241 AAAAGGCAGTGTCCCTGTGATGG - Intronic
1026373714 7:69728235-69728257 ACAAGGCAGCGCCTCAGCAATGG - Intronic
1027446039 7:78274595-78274617 AAAAGGCAGCACCCCAGTCAGGG - Intronic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1028718817 7:94005055-94005077 ACAAGGCAGTGTGCCAATTAGGG + Intergenic
1029817009 7:103106735-103106757 AAAAGGCAGCACCCCAGTCAGGG + Intronic
1032248424 7:130232419-130232441 AAAGGGCAGGTCCCCAGTGAGGG - Intergenic
1033885064 7:145934277-145934299 ACTAGTCAGTGCCCCAGTGCGGG - Intergenic
1033910732 7:146260319-146260341 ACTAGGCAGTGCCCCAGGTGGGG - Intronic
1034448286 7:151124429-151124451 ACACGGCATTGCCCCACGGAGGG + Intronic
1034729305 7:153370224-153370246 ACAAGGCAGGGCCCTGCTGAAGG + Intergenic
1035085050 7:156251108-156251130 ACAAGGCAGGGGCCCGGGGAGGG + Intergenic
1035597133 8:866950-866972 ACAAGGCAGTGAGCCTGTAAGGG - Intergenic
1036045628 8:5137031-5137053 ACAAGGCAGAGCCTCAGGCATGG + Intergenic
1038585039 8:28780737-28780759 ACAAGGTAGAGACCCAGGGAAGG - Intronic
1041182390 8:55262487-55262509 GGAAGGTAGAGCCCCAGTGATGG + Intronic
1043993157 8:86780825-86780847 ACTAGGCAGTGCCCCAGTTTGGG - Intergenic
1043999834 8:86865737-86865759 AGAGGGCAGTTCCCCAGTAAAGG - Intergenic
1044496790 8:92896428-92896450 ACTAGGCATTGCCCTAGTCAGGG - Intronic
1044718600 8:95124036-95124058 ACTAGGCAGAGCCCCAGTGGGGG - Intergenic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1046146848 8:110171977-110171999 ACTAGGCAGTGCACCAGTGGGGG - Intergenic
1047869977 8:129071684-129071706 ACTAGGCAGTGACCCTGTGTGGG - Intergenic
1047998856 8:130359974-130359996 ACAAGGGAGTGCCCCAAAGCAGG + Intronic
1048404609 8:134107032-134107054 ACTAGGCAGTGCCCCAGGAAAGG - Intergenic
1049341374 8:142114392-142114414 CCAAGGCAGTGCCCCAGGGAGGG + Intergenic
1050412039 9:5376295-5376317 ACAAGGGAGAGGCGCAGTGAAGG + Intronic
1051808710 9:21026308-21026330 CCCAGGCAGTGACACAGTGAGGG + Intronic
1052251838 9:26407837-26407859 ACAAGGTAGGGTCCTAGTGAAGG + Intergenic
1052383901 9:27802681-27802703 CAAAGGCAGTGCACCACTGAAGG - Intergenic
1052577752 9:30311996-30312018 ATTAGGCAGTGCCCCAGTGTGGG + Intergenic
1053357014 9:37455001-37455023 AGAAGGCAGTACCCCAGCTAAGG + Intronic
1055175549 9:73313800-73313822 ACTAGGCAGTGTCCCAGTAGGGG + Intergenic
1055368803 9:75574616-75574638 ACAAGACAGTGCTACAATGAAGG - Intergenic
1057242913 9:93428096-93428118 AGAAAGCAGTGGCCCAGTGTGGG - Intergenic
1057331669 9:94120878-94120900 ACTAGGCACTGCCCTAGTGGGGG - Intergenic
1057759466 9:97860801-97860823 TCAGGGCAGAGCCCCAGTCATGG + Intergenic
1058230369 9:102417427-102417449 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1058499024 9:105591708-105591730 AGTAGGCAGTGCCCCAGTGGGGG + Intronic
1059600500 9:115772270-115772292 ACAAGACAGTGACCCTGTCATGG + Intergenic
1060273134 9:122161619-122161641 ACAAGGCTCTGCTACAGTGAAGG + Intronic
1060277111 9:122190842-122190864 CCATGGCAGTGCCACAGTGAGGG - Intronic
1060747648 9:126148251-126148273 AGAAGACAGTGCACCAGTCATGG + Intergenic
1061541351 9:131279169-131279191 CCAAGGCAGGGCCACAGAGATGG + Intergenic
1062399923 9:136367842-136367864 ACAAGGCCGACCCTCAGTGAGGG + Intronic
1062639444 9:137510792-137510814 ACCAGGCAGTGCCCCCGTGTGGG + Intronic
1062730566 9:138105951-138105973 AAAAGCCAGTGCCCCAGGGTGGG - Intronic
1185982949 X:4799314-4799336 AGAAGGCAGTTCCCCAGCAAAGG - Intergenic
1187133569 X:16525877-16525899 ACTAAGCAGTGCCCCAGTTGGGG + Intergenic
1187448636 X:19378270-19378292 TCAAGGCAGTGCCCCATGGAAGG + Intronic
1188134918 X:26483648-26483670 ACTAGGCAGTGTCCCAGTGGGGG - Intergenic
1188166474 X:26870347-26870369 ACTACGCAGTGCTTCAGTGAGGG + Intergenic
1188407048 X:29824682-29824704 AAAAGGAAGTGTCTCAGTGAAGG + Intronic
1188496807 X:30790600-30790622 ACAAGGCAAGGCCCTAGTCAAGG - Intergenic
1188497177 X:30793039-30793061 ACAAGGCAAGGCCCTAGTCATGG - Intergenic
1188497194 X:30793151-30793173 ACAAGGCAAGGCCCTAGTCATGG - Intergenic
1189170067 X:38900690-38900712 ACTAGGCATTGCCCTAGTGGGGG - Intergenic
1189254094 X:39623975-39623997 ACTAAGCATTGCCCTAGTGAGGG + Intergenic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1189912458 X:45824750-45824772 ACAAGGCGGCACCCCAGGGAAGG + Intergenic
1190772554 X:53527294-53527316 ACCAGGCAGTGTCCCAGTGGGGG - Intergenic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192704865 X:73518867-73518889 ACAAGGCATTGCCCTAATGGAGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1193370754 X:80694395-80694417 ACTAGGCAGTACCCCAGTGGGGG - Intronic
1193865040 X:86720734-86720756 TCTAGGCAGTGCCCCAGTGGGGG + Intronic
1194178838 X:90688387-90688409 ACTATTCAGTGCCCCAGTGGTGG + Intergenic
1194850258 X:98860188-98860210 ACTAGGCAGTGCCCCACTGGGGG - Intergenic
1195292441 X:103442135-103442157 ACTGGGCATTGCCCTAGTGAGGG - Intergenic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1196723388 X:118875475-118875497 ACTAGGCATTGCCCTAGTGGGGG - Intergenic
1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG + Intergenic
1197439954 X:126475890-126475912 ACTAGGCAGTGCCCTAGTGGGGG + Intergenic
1198209947 X:134507361-134507383 ACAAGGCAGGGCAACACTGAAGG - Intronic
1198941696 X:141963835-141963857 ACTAGGCAGTGCCCTAGTGAGGG + Intergenic
1199381601 X:147178663-147178685 ACAAGGGTGGGCCCCGGTGATGG + Intergenic
1200506141 Y:4013704-4013726 GGAATGCAGTGCCCCTGTGATGG - Intergenic
1200525502 Y:4270557-4270579 ACTATTCAGTGCCCCAGTGGTGG + Intergenic
1201751090 Y:17432811-17432833 ACAAGGCAATGTCCCACTGTAGG - Intergenic
1202143161 Y:21750450-21750472 TCAAGTCAGTCTCCCAGTGAGGG + Intergenic