ID: 1101052110

View in Genome Browser
Species Human (GRCh38)
Location 12:100874246-100874268
Sequence ACAAGGCAGTGCCCCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 4, 2: 28, 3: 73, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101052110_1101052114 -5 Left 1101052110 12:100874246-100874268 CCTTCACTGGGGCACTGCCTTGT 0: 1
1: 4
2: 28
3: 73
4: 286
Right 1101052114 12:100874264-100874286 CTTGTGGAGCTGTGAGAAGAGGG 0: 18
1: 1782
2: 2088
3: 1403
4: 2996
1101052110_1101052117 21 Left 1101052110 12:100874246-100874268 CCTTCACTGGGGCACTGCCTTGT 0: 1
1: 4
2: 28
3: 73
4: 286
Right 1101052117 12:100874290-100874312 CTGTCCTCTGGAACCCAGAATGG 0: 1
1: 8
2: 79
3: 649
4: 1261
1101052110_1101052113 -6 Left 1101052110 12:100874246-100874268 CCTTCACTGGGGCACTGCCTTGT 0: 1
1: 4
2: 28
3: 73
4: 286
Right 1101052113 12:100874263-100874285 CCTTGTGGAGCTGTGAGAAGAGG 0: 18
1: 1691
2: 2088
3: 1458
4: 1028
1101052110_1101052115 9 Left 1101052110 12:100874246-100874268 CCTTCACTGGGGCACTGCCTTGT 0: 1
1: 4
2: 28
3: 73
4: 286
Right 1101052115 12:100874278-100874300 AGAAGAGGGCCACTGTCCTCTGG 0: 9
1: 22
2: 27
3: 55
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101052110 Original CRISPR ACAAGGCAGTGCCCCAGTGA AGG (reversed) Intronic