ID: 1101053540

View in Genome Browser
Species Human (GRCh38)
Location 12:100888623-100888645
Sequence GGCCAACTGGAGGCCTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101053528_1101053540 18 Left 1101053528 12:100888582-100888604 CCTCCCAACCTTTAGCTCCTTCT 0: 1
1: 0
2: 2
3: 21
4: 309
Right 1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 225
1101053527_1101053540 27 Left 1101053527 12:100888573-100888595 CCTGTTTTTCCTCCCAACCTTTA 0: 1
1: 0
2: 3
3: 32
4: 491
Right 1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 225
1101053530_1101053540 14 Left 1101053530 12:100888586-100888608 CCAACCTTTAGCTCCTTCTTGTG 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 225
1101053535_1101053540 -9 Left 1101053535 12:100888609-100888631 CCTCCATTGGCTGAGGCCAACTG 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 225
1101053531_1101053540 10 Left 1101053531 12:100888590-100888612 CCTTTAGCTCCTTCTTGTGCCTC 0: 1
1: 0
2: 4
3: 21
4: 624
Right 1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 225
1101053529_1101053540 15 Left 1101053529 12:100888585-100888607 CCCAACCTTTAGCTCCTTCTTGT 0: 1
1: 1
2: 4
3: 42
4: 440
Right 1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 225
1101053533_1101053540 1 Left 1101053533 12:100888599-100888621 CCTTCTTGTGCCTCCATTGGCTG 0: 1
1: 0
2: 0
3: 31
4: 265
Right 1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101053540 Original CRISPR GGCCAACTGGAGGCCTGTGA GGG Intronic
900506828 1:3033503-3033525 TGCCAACAGGAGGACAGTGATGG + Intergenic
900947494 1:5839312-5839334 AACCAACTGGAGGCCTCTAAAGG + Intergenic
901059914 1:6467243-6467265 ATCCCACTGGAGGCCAGTGAGGG + Exonic
901259918 1:7863901-7863923 GGCCATCTGGAGGCTGGTGCTGG + Intergenic
901392791 1:8958077-8958099 TGCCAACCTGAGTCCTGTGAGGG - Intronic
901631548 1:10650658-10650680 GGGGAACGGGAGGCGTGTGATGG + Intronic
901645545 1:10715114-10715136 GGCCAACCGGAGGCCAGGGTGGG - Intronic
903259717 1:22124859-22124881 GGCCAGCTGGAGTCCTGGGGAGG + Intronic
903391350 1:22965500-22965522 GGCTAACTTGAGGCCTAGGAGGG - Intergenic
903859536 1:26356509-26356531 GGCCATCCAGAGGCCTGGGAAGG + Intergenic
904004287 1:27355598-27355620 GGCCAACTGCAGGCCTGCCTAGG - Intronic
904036560 1:27562131-27562153 GGCCGAGGGGAGGCCTGTGTGGG + Intronic
907118603 1:51990253-51990275 GGGCAACTGGAGGGCAGTGAGGG - Intronic
908677419 1:66620866-66620888 GCCCCATTGGAAGCCTGTGAAGG - Intronic
909857986 1:80564375-80564397 GGCCAAATGGGGGCCTATAATGG - Intergenic
912526540 1:110287639-110287661 GGCCAACAGCAGGCCTGAGCTGG + Intergenic
914764994 1:150629767-150629789 GACCAATTGGAAGCCTGTGGGGG + Intergenic
915721959 1:157992578-157992600 AGCCAACTGGATGGCTTTGAAGG - Intergenic
916887710 1:169086258-169086280 GGAAAACAGAAGGCCTGTGAGGG + Intergenic
917969279 1:180196843-180196865 GGCCAGCTGGAGGCCCGAGCTGG + Exonic
918587307 1:186202791-186202813 GGCCAACGTGAGGGCTGAGATGG - Intergenic
919845171 1:201637783-201637805 TGGCAACTGCAGGCCGGTGAGGG - Intronic
919940834 1:202284926-202284948 GCCCAACTGGAGCCCTGTGCTGG + Intronic
920750572 1:208670872-208670894 GTCCAACTGGAGCCCTTTGGAGG + Intergenic
922706358 1:227792811-227792833 GGGGAAATGGAGGCCTGTGGAGG - Intergenic
1062829667 10:597267-597289 TGCAACCTGGAGGCCTGGGAGGG - Intronic
1067067642 10:43112739-43112761 GAGCAACTGGAGGCCTGAGTAGG - Intronic
1067568490 10:47354747-47354769 GTCCAACTGATGGCCTGGGATGG - Intronic
1069636146 10:69926065-69926087 GGCCACCTGGATGCCAGTAATGG - Intronic
1069746740 10:70719903-70719925 GGCAGTGTGGAGGCCTGTGAAGG - Intronic
1070143943 10:73760155-73760177 GTGAAGCTGGAGGCCTGTGATGG - Exonic
1070704945 10:78630828-78630850 GGGCAACTAGAAGCCTGGGAAGG - Intergenic
1071493767 10:86154019-86154041 GGCCTTCCGGCGGCCTGTGATGG - Intronic
1072156137 10:92725607-92725629 GCACATCTGGAGGACTGTGAAGG - Intergenic
1073785552 10:106885557-106885579 GGCTATCTGGAGGACAGTGAAGG + Intronic
1075308794 10:121393226-121393248 GAAAAACTGGAGGCCTGGGATGG + Intergenic
1075718385 10:124570218-124570240 GGCCCAGAGGAGGGCTGTGACGG - Intronic
1076146246 10:128124997-128125019 GTCCCACTAGAGGCCTGAGAAGG - Intronic
1076596427 10:131625464-131625486 GGCAAATTGGCGGCCGGTGAAGG + Intergenic
1080666020 11:34337137-34337159 GGCTAAGAGGAGGCCTGTGCTGG + Intronic
1082002275 11:47399929-47399951 GACCAAGTGCAGGCTTGTGAAGG - Intergenic
1082698787 11:56402237-56402259 GGCCAACTGGAGTTCTGGGTGGG - Intergenic
1083460386 11:62807189-62807211 GGCCAGCTGGGGGCCAGTGGGGG - Exonic
1083876493 11:65526720-65526742 GGCAGGCTGGAGGCCTGTGCAGG + Intronic
1084006963 11:66328277-66328299 GGCCTACTGGTGGCCTGAAAGGG - Intergenic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1087337568 11:96863757-96863779 TGCCAACTGGAGGTCTGCCAGGG + Intergenic
1088278725 11:108116024-108116046 GGCCAATTGGAGTCCTCTAAAGG + Intergenic
1088299763 11:108344590-108344612 TGCAAACTGGAGGCATGAGATGG + Intronic
1088598606 11:111457205-111457227 GGGCACCTTGATGCCTGTGACGG - Intronic
1089599017 11:119602030-119602052 GACCAAGTGGAGGCCACTGAGGG + Intergenic
1089868562 11:121652602-121652624 GCCCTTCTGGAGGACTGTGAGGG - Intergenic
1091362019 11:134985469-134985491 AGCCAATTGGAGGCCTCTAAAGG - Intergenic
1092730795 12:11532476-11532498 AGCCCACTGGAGGGATGTGAGGG - Intergenic
1094313006 12:29106591-29106613 GGCCAGTTGCAGGCCTGTAAAGG + Intergenic
1094607573 12:31962025-31962047 GGCCAACTTGAGGCCAGGGCTGG - Intronic
1095802234 12:46281314-46281336 GGCCCACTGCAGGCATGTGCAGG - Intergenic
1095959732 12:47826728-47826750 GGGCAACTGGAGGGTTGTGTTGG - Intronic
1101022929 12:100572297-100572319 GGCCAAATGGAAGTCTGTGGAGG - Intergenic
1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG + Intronic
1102844813 12:116168972-116168994 GGCCTACTGCAGGGGTGTGAAGG + Intronic
1103475818 12:121217989-121218011 GGCCATCTGGAGGGCTATGTCGG - Intronic
1103960291 12:124605284-124605306 GGCCAAATGGAAGAGTGTGAGGG + Intergenic
1105600058 13:21878724-21878746 GGCCATCTGCAGCCCTGTGCCGG + Intergenic
1106482308 13:30146056-30146078 GGACAACTGGAGGCCTGAGTCGG - Intergenic
1109715196 13:66212519-66212541 TGCCAAGTAGAGGCCTGTGAGGG - Intergenic
1112134372 13:96560061-96560083 TGCCAACTATAGGCCTGTGGAGG - Intronic
1113513972 13:110876754-110876776 AGCCAATTGGAGGCCTCTAAAGG - Intergenic
1114084225 14:19227697-19227719 GGCCAACTGGAGGGCAGGGAAGG - Intergenic
1117435480 14:55711965-55711987 GGGCTACTGGTGGCTTGTGATGG + Intergenic
1117978203 14:61319048-61319070 GGGCCACTGGACGCCTCTGAAGG - Intronic
1119328216 14:73774855-73774877 GGCCACCTGAGGGGCTGTGAGGG - Intronic
1119777818 14:77259275-77259297 GGGCCACTGGAGGCCTGAGGAGG - Exonic
1120759105 14:88270302-88270324 GGACAACTGGAGGCCGGTGTGGG - Intronic
1121798504 14:96754855-96754877 GGCCAGATGGAGGCCTGGGCAGG + Intergenic
1122263534 14:100536345-100536367 GGCCCGCTGCAGGCCTGGGATGG + Intergenic
1202895838 14_GL000194v1_random:9554-9576 GGCCAACTGGAGGGCAGGGAAGG - Intergenic
1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG + Intergenic
1124579583 15:30941678-30941700 GGCCCCCTGGAGGCCTGCTATGG - Exonic
1125463168 15:39925303-39925325 GGCCACATGGGGGCATGTGAGGG - Intergenic
1125505125 15:40263466-40263488 GGGGAACTGGGGGCCTGGGAAGG - Intronic
1125956218 15:43792735-43792757 GGCCAGCTGGAGGCGTGTTTTGG - Intronic
1126114104 15:45193356-45193378 GGACAACTGGAGGCCAGGGAGGG + Intronic
1127229954 15:56980242-56980264 AGCTAACTGGAAGCCTGAGACGG - Intronic
1127593213 15:60448889-60448911 GGCCAACTAGAGGAGTCTGAAGG + Exonic
1127789807 15:62390150-62390172 GGCTAACTGGAGGGCCGTGGTGG - Intergenic
1128836770 15:70815134-70815156 GGACAACTGGAAGCCAGGGAGGG + Intergenic
1130550691 15:84888481-84888503 GGCCGAGGGGAGGCCTGTAAGGG - Intronic
1132499513 16:279166-279188 AGCCAATTGGAGGCCTCTAAAGG + Intronic
1132896249 16:2230654-2230676 GGCCAACCCGGGGCCTGGGAAGG + Intronic
1132936152 16:2482395-2482417 GGTCCCATGGAGGCCTGTGAAGG + Intronic
1133269306 16:4602710-4602732 GGCCACCTGGGGGCTTGGGAAGG + Intergenic
1134510293 16:14841017-14841039 GTGCAACTGTAGGCATGTGAGGG + Intronic
1134697934 16:16239506-16239528 GTGCAACTGTAGGCATGTGAGGG + Intronic
1134780535 16:16891220-16891242 AACCAACTGGAGGCCTCTAAAGG + Intergenic
1134790323 16:16983759-16983781 AGCCAACTGGAGGCCTCTAAAGG + Intergenic
1134973900 16:18555175-18555197 GTGCAACTGTAGGCATGTGAGGG - Intronic
1140326253 16:74005904-74005926 GGCCCACTGAAGGCATGTGCAGG + Intergenic
1140486381 16:75296829-75296851 TGCTAACAGGATGCCTGTGACGG + Intronic
1141630833 16:85287148-85287170 GGCCAGCTGGAGGCGAGTGCCGG + Intergenic
1141926827 16:87175286-87175308 GACCTACTGGGGGCCTCTGAGGG + Intronic
1141939260 16:87263761-87263783 GGCCCACTGCAGAACTGTGAAGG + Intronic
1142003851 16:87679854-87679876 GACCAGCTGGGGGCCTCTGAAGG - Intronic
1144453752 17:15402566-15402588 GGCCCACTGGAGGGTTGTGGTGG + Intergenic
1144706645 17:17372873-17372895 GGACAACTCGAGGCCGGGGAGGG - Intergenic
1146481743 17:33210555-33210577 GGCCAGCTGCAGACCTTTGAGGG + Intronic
1147039160 17:37704191-37704213 GGCCATCTTGAGGCATGAGAAGG - Intronic
1148047511 17:44753206-44753228 GGCCACTTGGACGCCTGAGAGGG + Intergenic
1148255607 17:46128931-46128953 GGCCAACTGGGAGGCTGCGAAGG + Intronic
1148624745 17:49060714-49060736 GGGTAACAGGAGGCCTGAGATGG + Intergenic
1150429675 17:65105218-65105240 GGGCAACGCTAGGCCTGTGATGG + Intergenic
1151297613 17:73197016-73197038 GGCCAGCAGGAAGTCTGTGAGGG - Exonic
1151872626 17:76846676-76846698 GGGGAACTGGATGGCTGTGAGGG + Intergenic
1152388450 17:79989097-79989119 GGCCATGTGGAGCCCTGAGAAGG - Intronic
1154088834 18:11337055-11337077 GGGCATGTGAAGGCCTGTGAAGG + Intergenic
1154493295 18:14937572-14937594 AGCCAATTGGAGGCCTCTAAAGG + Intergenic
1157168819 18:45383641-45383663 GAACACCTGGAGGCCTGTGAGGG - Intronic
1157403909 18:47407955-47407977 GGCCAAGGGGGGGCCAGTGAAGG - Intergenic
1160293944 18:77620896-77620918 GGCCAGCTGGAGGTTTGTGCTGG + Intergenic
1160451855 18:78971789-78971811 GGCCATGTGGAACCCTGTGATGG - Intergenic
1160710307 19:548405-548427 GGCCAAGCCAAGGCCTGTGAGGG + Intronic
1161219254 19:3110512-3110534 GGCCAACTGGAGAGTTGTGATGG + Intronic
1161518354 19:4709811-4709833 GGCCAACAGGAGGGGTGGGAGGG + Intronic
1162145207 19:8609085-8609107 GGCCAACAGGATGTCAGTGAGGG + Intronic
1163758744 19:19121575-19121597 GGCCAGCCGCAGGCCTGGGAAGG + Exonic
1165161673 19:33820309-33820331 GGCTCCCCGGAGGCCTGTGATGG - Intergenic
1165843061 19:38800800-38800822 GGACAAATGGATGACTGTGATGG + Intergenic
1166119188 19:40674732-40674754 GGCAAACTGGAGCCCAGAGAGGG - Intronic
1166779197 19:45331631-45331653 AACCAATTGGAGGCCTCTGAAGG + Intergenic
1166853209 19:45770127-45770149 GGCAAACTGCAGGCCTGGGAAGG - Exonic
1166887575 19:45971527-45971549 GACCCCCTGGATGCCTGTGAGGG - Intronic
1167222137 19:48206591-48206613 AACCAACTGGAGGCCTCTAAAGG + Intronic
925333885 2:3078848-3078870 GGCCATCTAGCGGCCTGTGAAGG - Intergenic
925447715 2:3942340-3942362 TGCCAATAGGAGGCCTATGATGG - Intergenic
925474950 2:4203089-4203111 GGCCAACTGCAAGCCAGTAAGGG - Intergenic
925507397 2:4583780-4583802 GGCTTCCTGGAGGCCTGTGTGGG + Intergenic
926128439 2:10285900-10285922 CGCCCACTCGAGGGCTGTGAGGG + Intergenic
927263378 2:21117223-21117245 GACCACCTGGAGGGCTGTGCTGG + Intergenic
927425328 2:22975168-22975190 GGCCAAAAGGTGGACTGTGATGG + Intergenic
928101275 2:28438872-28438894 GGCCACCTGCTGCCCTGTGAAGG - Intergenic
929290217 2:40182008-40182030 GGCCAACTGGAGGACATTCAAGG - Intronic
932218504 2:69982731-69982753 GACCAGCTGCAGGCCTGAGAAGG - Intergenic
933983770 2:87574282-87574304 GTCCAACTGAAAGCCTGTCAGGG + Intergenic
934308803 2:91845355-91845377 GGCCAAGTGGCTGCATGTGAGGG + Intergenic
935637170 2:105258246-105258268 GGCCCACTGGATGAATGTGATGG + Intergenic
937337172 2:121069167-121069189 GGGCACCTGGAGGCCAGTGGTGG - Intergenic
937879225 2:126852455-126852477 AGCCAAGTGGAGGCTTGAGAAGG - Intergenic
938492361 2:131768391-131768413 GGCCAACTGGAGGGCAGGGAAGG + Intergenic
938495208 2:131793959-131793981 GGCCAACTGGAGGGCAGGGAAGG - Intergenic
941749252 2:169118185-169118207 GACCAACTGGAGGCCTCTAAAGG - Intergenic
945123575 2:206484653-206484675 GGACAAATGGAGGTCTCTGAAGG + Intronic
946186461 2:217983437-217983459 GGCCCAGTGGTGGCCTGAGAGGG + Intronic
946489298 2:220132270-220132292 GGCCAAAAGTAGGTCTGTGAGGG - Intergenic
1168796500 20:613240-613262 GGCAGCCTAGAGGCCTGTGAGGG + Intergenic
1169423856 20:5481253-5481275 GGTCAATTGGAGGCCTCTGAAGG - Intergenic
1171503979 20:25618420-25618442 GCCCAAATGGAGGCATGTGAGGG + Intronic
1172516728 20:35539986-35540008 AGCCAACTGGAGGCTTCTAAAGG + Intergenic
1172825392 20:37778755-37778777 GGGCAAGTGGAGGGCTTTGAGGG + Intronic
1173392603 20:42648383-42648405 GGCCAACTGTGTTCCTGTGATGG - Intronic
1173476642 20:43364395-43364417 AACCAACTGGAGGCCTGTGAAGG + Intergenic
1175251213 20:57611129-57611151 GGCCAACTGGAGCAGGGTGATGG - Intronic
1175419694 20:58823457-58823479 GGCCATCTGTATGCCTGTGACGG + Intergenic
1176201319 20:63861967-63861989 GCCAAGCTGGTGGCCTGTGACGG + Exonic
1176615527 21:9025614-9025636 GGCCAACTGGAGGGCAGGGAAGG - Intergenic
1176709653 21:10138192-10138214 GGCCAACTGGAGGGCAGGGAAGG + Intergenic
1179369698 21:40793240-40793262 GGCTGGCTGGAGGCCTGTGATGG + Intronic
1180293747 22:10865506-10865528 GGCCAACTGGAGGGCAGGGAAGG + Intergenic
1180496552 22:15894921-15894943 GGCCAACTGGAGGGCAGGGAAGG + Intergenic
1180967876 22:19799960-19799982 GGCCAGGAGGAGGCCTGGGAGGG - Intronic
1181000962 22:19987483-19987505 GGCCAAACCGAGGCCTGGGAAGG - Intronic
1183353270 22:37345085-37345107 GGCCAAGTGGACATCTGTGATGG - Intergenic
1183864354 22:40692493-40692515 AACCAACTGGAGGCCTCTAAAGG - Intergenic
1184455503 22:44607570-44607592 GGCCAAGAGGAGGCCTGGGAGGG + Intergenic
1184792088 22:46706351-46706373 GGCACACAGGAGGCCTGAGAAGG + Intronic
1185187448 22:49410369-49410391 GGCCAACTCCAGGGCTGTGGTGG - Intergenic
950467938 3:13166505-13166527 GGCCACCTGGAAGCCAGTAAGGG - Intergenic
950475157 3:13210315-13210337 GCCGAACTGGAGCCCTGGGAGGG - Intergenic
950646679 3:14381594-14381616 GGCCAACAACAGGCCTGTGGTGG - Intergenic
954628030 3:52033357-52033379 GGCCAGGTGGAGGCCTCTTAGGG - Intergenic
959003504 3:100992514-100992536 AGCCAACTCTAGGTCTGTGAAGG - Intronic
960619788 3:119626814-119626836 GGGCACCTGCAGGCCTGTGCTGG - Intronic
961101360 3:124201949-124201971 GGCCAGCTGGAGCCCTGTGATGG + Intronic
961133540 3:124490395-124490417 GGCCAACTGTGGGTGTGTGAAGG + Intronic
961788306 3:129360542-129360564 GCCGAACTGGAGCCCTGGGAGGG + Intergenic
966726837 3:183116061-183116083 GGCCAATTGGAGGCTTCTGAGGG - Intronic
967738745 3:192982344-192982366 GGCCAACGGGAGGCTGATGAGGG - Intergenic
968054970 3:195684287-195684309 GGCCAACTGGAAGCATCTGCAGG + Intergenic
968100943 3:195964989-195965011 GGCCAACTGGAAGCATCTGCAGG - Intergenic
968312145 3:197692808-197692830 CTCCATCTGGAGGCCTGTGCAGG + Intronic
968522620 4:1040867-1040889 AGCCAGCGGGAGGCCTGTGCCGG - Intergenic
970422181 4:15915676-15915698 AGCCAACTGGAGGCCTCTAAAGG - Intergenic
971389632 4:26173847-26173869 GGGCAGCCGGAGCCCTGTGAAGG + Intronic
972511326 4:39770750-39770772 AGCCCCCTGGAGGCCTGGGAGGG - Intronic
975693657 4:76990479-76990501 GGCCAGCAGGAGGCGAGTGATGG + Intronic
977963960 4:103121109-103121131 GGTCAACTGGGGGTCTGAGATGG - Intronic
978466931 4:109018174-109018196 GGCCAATAGGAGTCCTGTCATGG + Intronic
981245478 4:142532215-142532237 GGCCAACTGCAGGCATATGCAGG - Intronic
985291052 4:188388337-188388359 GGCCAACTAGAGGCATCTGAAGG + Intergenic
985502144 5:254926-254948 GGCCAACTGGAAGCGTCTGCAGG + Intronic
985734876 5:1573741-1573763 GGCCAACTGGAAGCATCTGCAGG - Intergenic
985923429 5:2997090-2997112 GGTCAACAGAATGCCTGTGAGGG - Intergenic
987148615 5:15016975-15016997 GGACACCTGGGTGCCTGTGAAGG - Intergenic
990525162 5:56618297-56618319 AACCAATTGGAGGCCTGTAAAGG - Intergenic
995492566 5:112708026-112708048 GGCCAACTGGAGGCCTGAATGGG - Intronic
996525630 5:124476383-124476405 ATGTAACTGGAGGCCTGTGACGG - Intergenic
997532531 5:134591053-134591075 AACCAACTGGAGGCCTTTAAAGG - Intergenic
999498507 5:152123934-152123956 GGCCAATTGGAGGACTGAGTGGG + Intergenic
1003395878 6:5751630-5751652 GGCCTAGTGGAAGCCTGTGCTGG + Intronic
1004536677 6:16509868-16509890 GGCCACCCGTATGCCTGTGATGG - Intronic
1006047505 6:31309405-31309427 GGCCGACTGGATCACTGTGATGG - Intronic
1006898038 6:37483144-37483166 GGCCAAGTGGAAGCCTGTGCTGG + Exonic
1009500968 6:64413284-64413306 TACCAACTGCAGGCCTGAGAAGG - Intronic
1009602792 6:65823843-65823865 GGCAAACTGGAGGCCAGAGAAGG - Intergenic
1012120212 6:95356275-95356297 TGACAACTAGAGGCCTGTGAGGG + Intergenic
1013059508 6:106619397-106619419 GGTCAGCTGGATTCCTGTGAAGG - Intronic
1013651483 6:112199449-112199471 GGCTCACTGGAGGTCTGTGGCGG - Intronic
1016048653 6:139506504-139506526 TTTCAACTGGAGACCTGTGAAGG + Intergenic
1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG + Intergenic
1023823716 7:43994883-43994905 AGCCAACTGGTGGCCTGAGCGGG - Intergenic
1023843908 7:44110666-44110688 GGCCACCTGAGGGCCTGGGAGGG + Intronic
1023988011 7:45109156-45109178 GGCCAACTGGAGCCATGGCAGGG + Exonic
1024472768 7:49780482-49780504 GGTCTCCTGGAGGACTGTGATGG + Intronic
1026176029 7:67997869-67997891 GGCCCACAGGAGGCCTATCAGGG - Intergenic
1029365259 7:100112420-100112442 GGCCACATGGAGGCCTGGCATGG + Intronic
1029751984 7:102548296-102548318 AGCCAACTGGTGGCCTGAGCAGG - Intronic
1029769936 7:102647390-102647412 AGCCAACTGGTGGCCTGAGCAGG - Intronic
1029958022 7:104659971-104659993 GGCAAACTGGAGGGCTAGGAAGG - Intronic
1030444087 7:109626796-109626818 GGCCAATTGGAAGCCAGTCAAGG - Intergenic
1031510475 7:122642455-122642477 GGAGAACTGGAAGCCTGTGCTGG + Intronic
1033664919 7:143431310-143431332 GGCCACCAGGAGGACTGTAAAGG - Intergenic
1036204004 8:6792192-6792214 AGCCAATTGGAGGCCTCTAAAGG - Intergenic
1037983074 8:23269017-23269039 AGCCAACGAGAGGCCTGAGAAGG - Intergenic
1038032494 8:23654883-23654905 AGCCAACTGCTGGCCTTTGAGGG - Intergenic
1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG + Intergenic
1046536738 8:115523858-115523880 GGCCAACTGGAAGGCTGACAAGG + Intronic
1046814734 8:118571515-118571537 AGCCTACTCCAGGCCTGTGATGG - Intronic
1049076137 8:140397851-140397873 GGGTATCTGGAGCCCTGTGATGG - Intronic
1049619020 8:143589470-143589492 GGCCACCTGCTGGCCTGTGTTGG + Exonic
1050315277 9:4395429-4395451 TGCCTACTGGAGGCCTAAGAAGG - Intergenic
1053297257 9:36923765-36923787 GGCCAACTGGAGCTGGGTGAGGG - Intronic
1053646622 9:40123725-40123747 GGCCAACTGGAGGGCAGGGAAGG + Intergenic
1053759096 9:41339842-41339864 GGCCAACTGGAGGGCAGGGAAGG - Intergenic
1054327630 9:63721611-63721633 GGCCAACTGGAGGACAGGGAAGG + Intergenic
1054537949 9:66252248-66252270 GGCCAACTGGAGGGCAGGGAAGG - Intergenic
1055734742 9:79314733-79314755 TGCCAACAGGAGGCCCTTGAGGG - Intergenic
1057664950 9:97038185-97038207 GGCCAAGTGGAGGTATTTGATGG + Intronic
1057826782 9:98377817-98377839 GGCCAACTGGAGTCCTGGATGGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060526623 9:124324623-124324645 GGCCACCTCCAGGCCTGTGGCGG - Intronic
1060545778 9:124458246-124458268 CGCCACCTGGAGGGCTGTGAGGG + Intronic
1061668055 9:132171888-132171910 TGCCGACTGGAGGGTTGTGACGG - Intronic
1062217216 9:135395737-135395759 GGACAAGTGGAGGCCTCAGAGGG - Intergenic
1062395930 9:136352807-136352829 GGCACACTGGAGGGCTGTGTGGG - Intronic
1062650714 9:137575512-137575534 GGCCAACCGAGGGCCTGTGTAGG - Intronic
1062679970 9:137774143-137774165 TGCCCACTGCTGGCCTGTGATGG + Intronic
1202794412 9_KI270719v1_random:107159-107181 GGCCAACTGGAGGGCAGGGAAGG + Intergenic
1185891865 X:3829041-3829063 GGCAAACTGGAGGCCGACGAAGG + Intronic
1185896972 X:3867455-3867477 GGCGAACTGGAGGCCAACGAAGG + Intergenic
1185902090 X:3905881-3905903 GGCGAACTGGAGGCCAACGAAGG + Intergenic
1188308216 X:28585366-28585388 GGTCAACTAGAGGACTGTGATGG + Intergenic
1191575118 X:62694480-62694502 GACCACTTTGAGGCCTGTGATGG - Intergenic
1191894021 X:65974140-65974162 GGGCAACTGGAGTCCAGAGAGGG + Intergenic
1195020405 X:100820918-100820940 GGCCACCTGGTGTCCTGAGATGG + Intronic
1195292092 X:103439195-103439217 GGACAACTGGAAGCCAGGGAGGG + Intergenic
1195451704 X:105021279-105021301 GGCCATCTGAAGGGCTGTGTGGG + Intronic
1199719734 X:150534184-150534206 GAGCAACTGGAAGCCTCTGAAGG + Intergenic
1200039717 X:153356153-153356175 GGCCACCCAGAGGCCTGGGAGGG - Intronic
1200204424 X:154305573-154305595 GGCCACTTGGAGCCCTGTGATGG + Intronic
1201148919 Y:11084266-11084288 GGCCAACTGGAGGGCAGGGAAGG - Intergenic