ID: 1101061709

View in Genome Browser
Species Human (GRCh38)
Location 12:100979279-100979301
Sequence ATGGTTCTCAAACATGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101061709 Original CRISPR ATGGTTCTCAAACATGTGTC AGG Intronic
905133234 1:35777473-35777495 ATCTTTCTCAAGCATGTATCTGG - Intergenic
910574687 1:88747528-88747550 ATCTTTCTCAAACGAGTGTCAGG - Intronic
916459148 1:165004672-165004694 CTGGTTCTCAAGCATCTTTCAGG - Intergenic
916557947 1:165909369-165909391 AAGGTTCTCCAAAATGTTTCTGG - Intronic
916619169 1:166477104-166477126 ATGGTTCTCAAACTTTAGTATGG + Intergenic
917064926 1:171081913-171081935 ATTGCTCTCAAGCATGTTTCAGG + Intergenic
920814154 1:209315262-209315284 ATGGTTTGCAAAAATGTGTTGGG - Intergenic
921620707 1:217323398-217323420 CTGTTTCTCAAATATGTATCTGG - Intergenic
1064459327 10:15518562-15518584 ATAGTTATCAAAGATGTGACTGG + Intronic
1069303371 10:66937001-66937023 ATTTTTCTCAAACATGAGTTTGG + Intronic
1070817338 10:79333012-79333034 ATGAATCTCACTCATGTGTCTGG - Intergenic
1071202990 10:83241581-83241603 ATGGGTCCCAAACTTTTGTCTGG + Intergenic
1071888771 10:89979802-89979824 ATGGTACTCAAACATTATTCTGG + Intergenic
1072234161 10:93438765-93438787 GTGGTTCTCAAACGTGAGCCTGG - Intronic
1073333973 10:102691009-102691031 ATGGTTCTCTAAACTGTGTCTGG - Intronic
1073552223 10:104414270-104414292 ATGGTTGGCAAACTTGTTTCTGG - Intronic
1074494884 10:113971254-113971276 TTGGTTCTTTAACATGGGTCAGG - Intergenic
1075863280 10:125696182-125696204 ATGGGTCAGAAACATGGGTCAGG - Intergenic
1079519148 11:21304157-21304179 ATGGTTATAATACAAGTGTCGGG + Intronic
1080114134 11:28602962-28602984 TTGGTTCCCTAACATGTGTCAGG + Intergenic
1081751205 11:45512475-45512497 ATGGTACTCACACAGGTGCCTGG + Intergenic
1084130811 11:67132891-67132913 ATGGTTCTCAAACTTTTGCGTGG - Intronic
1091046888 11:132332991-132333013 ATGGGTTTCAAAGATGTGTGTGG + Intronic
1092084453 12:5744194-5744216 AGGGTTGTCAAACAGGTGGCTGG + Exonic
1098676058 12:73290851-73290873 ATGATTCTCAAACAGCTGTATGG + Intergenic
1101061709 12:100979279-100979301 ATGGTTCTCAAACATGTGTCAGG + Intronic
1102666132 12:114574738-114574760 ATGGTTCTCAAACAATTCTTTGG - Intergenic
1103971376 12:124674824-124674846 ATGGTTCATGAAAATGTGTCTGG - Intergenic
1107368112 13:39708251-39708273 AGAGTTTTCAAACATGTGTTTGG + Intronic
1107785735 13:43955781-43955803 ATGGTTCCCAAAAATGTTTGAGG + Intergenic
1107888740 13:44895841-44895863 ATGATTCGCACACATGTGTTTGG - Intergenic
1108507385 13:51124748-51124770 GTGGTTCTCTAACATTTGCCAGG - Intergenic
1110646175 13:77887104-77887126 ATGATTCCATAACATGTGTCTGG - Intergenic
1110748973 13:79090632-79090654 TTGGTTCTCAAATATCTTTCTGG + Intergenic
1111344949 13:86939495-86939517 AAGGTTTTCAAAAATGTTTCTGG + Intergenic
1112701115 13:102009839-102009861 ATATTTCTAAAACATGTGTTGGG - Intronic
1114937148 14:27553814-27553836 ATGGTTTTTAAAAATGTGTTAGG + Intergenic
1115796230 14:36939066-36939088 AGTCTTCTCAAACATGTCTCTGG + Intronic
1116624719 14:47249620-47249642 ATTGTGGTCAAACATGAGTCTGG - Intronic
1118451691 14:65908168-65908190 ATGGTTTTCAAACATTTCTGAGG + Intergenic
1119653628 14:76400993-76401015 CTTCTTCTCACACATGTGTCTGG - Intronic
1120031937 14:79651646-79651668 CTGGTTATCAAAGATGTCTCTGG + Intronic
1128593931 15:68928163-68928185 TTGGTTCCTCAACATGTGTCCGG + Intronic
1129113719 15:73353286-73353308 GGGGTCCTCTAACATGTGTCAGG + Intronic
1129533278 15:76287854-76287876 ATAGTTCTCACAAATGTGTCAGG + Exonic
1130153331 15:81328952-81328974 ATGGTGCTCCCACAGGTGTCTGG + Intergenic
1132295565 15:100731751-100731773 ATGAATTTAAAACATGTGTCAGG + Intergenic
1134611216 16:15609890-15609912 GTGGTTCTCAAACATGTTCCAGG + Intronic
1137806813 16:51314404-51314426 ATGGTTCTTAAAGATGTTTCTGG - Intergenic
1139060663 16:63246906-63246928 ATGTCTCTCAAAGATTTGTCTGG + Intergenic
1141258362 16:82425616-82425638 ATGGTTGCCAAACATGTGTTGGG + Intergenic
1143778449 17:9215770-9215792 ATGTTTTGCAAAGATGTGTCTGG + Intronic
1144708500 17:17385295-17385317 ATGGTTTTCAGCCATGTGTGAGG - Intergenic
1145775546 17:27525482-27525504 ATGGTTCTTAGCCATGTGTCAGG - Intronic
1149697883 17:58630822-58630844 ATGGTTCTCAATCATGGGAAAGG + Intronic
1150939442 17:69674571-69674593 ATGGTTCCCAAACAGGTGGCAGG + Intergenic
1156522838 18:37736194-37736216 CTGGTCCTCAGACATGTGTGAGG + Intergenic
1165015753 19:32878876-32878898 AAGGATCTCAAACATGTTTGAGG + Intergenic
1166089403 19:40498280-40498302 AAGGTTCCCAGACATGTGTCTGG - Intronic
1168527131 19:57098191-57098213 ATGGCTCAAAAACGTGTGTCTGG + Intergenic
927236922 2:20883071-20883093 ATTGTCCTCACACCTGTGTCTGG + Intergenic
928952162 2:36822853-36822875 ATGGTTCTGTAATATGTGACTGG - Intergenic
930469366 2:51793375-51793397 CTGGTTTTCAAATATGTGTGAGG - Intergenic
931761332 2:65419802-65419824 GTGGTTCCCAAACTAGTGTCTGG - Intronic
932443468 2:71754846-71754868 ATAGCTCTGAAAAATGTGTCAGG - Intergenic
932862837 2:75312323-75312345 ATGTTGCTCAGACATGTGTTGGG - Intergenic
941204896 2:162559740-162559762 GTGGTCCACAAAAATGTGTCTGG + Intronic
944091387 2:195915994-195916016 ATGTTTCTTAAATATGTGTTAGG - Intronic
947153120 2:227134488-227134510 ATTGTTCTGAACCATGTATCAGG + Intronic
1169696801 20:8398186-8398208 ATGGTCCTTAAACATGTGAAAGG - Intronic
1171432095 20:25089408-25089430 GTGGTTCTCAAACTTGAGTGGGG - Intergenic
1174860128 20:54083554-54083576 ATGGTTCAAAAACTTGTGTCAGG - Intergenic
1176984251 21:15418218-15418240 AAATTTCTCAAACTTGTGTCTGG + Intergenic
1177466162 21:21483130-21483152 AATGTTATCAAACATGTGGCAGG - Intronic
1177484173 21:21734536-21734558 TTGGTTCTCAAACAGATGTGAGG + Intergenic
1177836828 21:26193859-26193881 GTGGTTCTTAAACACGTATCTGG - Intergenic
1181164665 22:20976859-20976881 GTTGTTCTCAAACATCTGTCAGG - Exonic
1184027702 22:41870203-41870225 TTGCTTCTCAGCCATGTGTCTGG + Intronic
950686193 3:14620139-14620161 GTGGGGCTCACACATGTGTCTGG - Intergenic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
951313583 3:21160766-21160788 ATGGTGCACAAACATATGTTTGG - Intergenic
951866908 3:27318778-27318800 GTGGTTGTCTAACATGTCTCTGG + Intronic
952706377 3:36381418-36381440 AAGATTTTCAAACATGTGCCTGG - Intronic
953311344 3:41882916-41882938 TTGGTTCTCAGAGATGTGTCAGG - Intronic
953943522 3:47124875-47124897 ATGTCTTTCAAACATATGTCAGG - Intronic
955885050 3:63589157-63589179 ATGGTTCTCAAAGCAGTCTCAGG - Intronic
956331901 3:68119913-68119935 ATAGTTCTCAAACTTGAGTATGG - Intronic
957549339 3:81683735-81683757 TTGGTTACCAAACATGTGTCTGG - Intronic
958720633 3:97838518-97838540 ATGTTTCTCAAACAGATTTCTGG - Intronic
959950914 3:112179138-112179160 TTTGTTCTCAATCATGTGTAGGG + Intronic
960840993 3:121958406-121958428 ATGGAGCTCCAATATGTGTCTGG + Intergenic
961705675 3:128783311-128783333 ATGCTTTTCAAAAAGGTGTCTGG + Intronic
962358345 3:134714152-134714174 GTGGTTCTCAAACTTGTGCATGG + Intronic
965018925 3:163200338-163200360 ATGTTTATCAAACATGTTTATGG - Intergenic
965951487 3:174313465-174313487 ATGGTTCTCAAACATTAGTTTGG - Intergenic
966179513 3:177175320-177175342 ATCATTCTCAAAAATGTGTTTGG + Intronic
967280780 3:187821628-187821650 AGGGTACTCACACATGTTTCTGG - Intergenic
974269016 4:59626094-59626116 ATTGTTGTCATACATGTGTGAGG + Intergenic
981862523 4:149374502-149374524 ATGGTTTTCAAAGATGTTTTTGG - Intergenic
983372762 4:166883575-166883597 ATCTGTCTCAAACTTGTGTCTGG + Intronic
983432623 4:167670814-167670836 ATGGTTTTAAAATATGTGTATGG - Intergenic
984058127 4:174954334-174954356 ATTGGATTCAAACATGTGTCTGG - Intronic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
986999705 5:13647759-13647781 AGAGTTCTCAAACCAGTGTCTGG + Intergenic
987801602 5:22704025-22704047 TTGGTTCTCAAACATTTTTTGGG + Intronic
990894975 5:60689131-60689153 TTAGTTCTCAACCATGTGCCAGG - Intronic
993235139 5:85295769-85295791 GTAGTTCTCAAATATTTGTCAGG - Intergenic
993343022 5:86748362-86748384 CTGGTTCACAAACAGGTGTCAGG + Intergenic
998422638 5:142001582-142001604 ATGGTTCTCAACCAAGGGGCAGG + Exonic
1000102250 5:158027178-158027200 ATGGGTCTCTGACCTGTGTCAGG - Intergenic
1000274453 5:159721006-159721028 ATATTTCTCAATCATGTGTCTGG + Intergenic
1000304003 5:159979566-159979588 ATGGGTCTAAAAGATGTGGCTGG + Intergenic
1003459245 6:6314772-6314794 CTGGTTTTCACATATGTGTCAGG - Intronic
1003651009 6:7960109-7960131 ATGGTTCTTAAACATGAGAATGG + Intronic
1005899582 6:30205986-30206008 CTGCTTCTCAAGCATATGTCTGG + Intronic
1008269396 6:49473024-49473046 ATGTTTCTCAAATAAGTTTCAGG + Intronic
1011860934 6:91755338-91755360 ATTGTTTTCAAATATCTGTCTGG - Intergenic
1013036005 6:106383910-106383932 GTGGTTCTCAACCCTGTGTGTGG + Intergenic
1013158201 6:107514509-107514531 AGGGTTCTTAAAAATGTGTAAGG + Intronic
1013509432 6:110830996-110831018 ATGTTTCACAAGCATGTGTCTGG + Intronic
1015778688 6:136841190-136841212 CTGTTTCTCAAACATCTCTCTGG + Intronic
1018442491 6:163825962-163825984 ATGGATCTCATCCTTGTGTCAGG + Intergenic
1021617336 7:22516393-22516415 ATGGTTCTCAGAGATGTGTGGGG - Intronic
1022926927 7:35065801-35065823 ATGGTTCTCAGAGATGTGTTGGG - Intergenic
1022970210 7:35510272-35510294 ATGGTTCTCAAACTTGAGCATGG + Intergenic
1024252097 7:47513881-47513903 AGGATTCTTAAACATGAGTCTGG - Intronic
1026282899 7:68937486-68937508 ATAGTTCTCAAACTTGAGTGTGG - Intergenic
1027002209 7:74661301-74661323 ATGGTTCTCAAAGGGCTGTCCGG - Intronic
1027464334 7:78496215-78496237 ATGGTTTACAAATATTTGTCAGG - Intronic
1027906615 7:84192842-84192864 TTAGTTCTCAAAGATGTGACTGG - Intronic
1028375339 7:90139720-90139742 ATGGTTCTCAGAGATATGTGGGG + Intergenic
1030552053 7:110974028-110974050 ATGGTTCTTATACCTGTGTCTGG - Intronic
1031202604 7:118708359-118708381 ATGCTTCTGAATCATGTGTCTGG - Intergenic
1031473330 7:122192759-122192781 ATGCTTCTCATTCATGTGGCTGG - Intergenic
1032278619 7:130482908-130482930 TTTGTTCTTAGACATGTGTCAGG + Intergenic
1033180146 7:139169203-139169225 ATGGTTCTAACATATTTGTCAGG - Intronic
1034041920 7:147886704-147886726 ATGATTCGGAAACATGTGTAAGG - Intronic
1034994824 7:155570984-155571006 AAGGTTCTCACACTTGTCTCAGG + Intergenic
1037047319 8:14323901-14323923 ATGGTTCTCTAAGATTTGTCGGG + Intronic
1037353152 8:17985969-17985991 ATGGCTCTCAGAAATATGTCTGG - Exonic
1040008540 8:42641564-42641586 ATCCTTCTCAGACAAGTGTCAGG - Intergenic
1041104837 8:54431467-54431489 TTGGTTCTTGAACATCTGTCCGG + Intergenic
1041298650 8:56388512-56388534 ATGGTTTTCACAAATGTTTCTGG + Intergenic
1041699487 8:60772588-60772610 AGTGTTCTCAAAGAGGTGTCTGG - Intronic
1041995665 8:64054303-64054325 ATGGTTCTCAAACGTATTTAGGG - Intergenic
1042662954 8:71175928-71175950 ATCTTTCTTAAACATATGTCAGG - Intergenic
1044206122 8:89493907-89493929 ATGGTTCTGAAAGAGTTGTCAGG - Intergenic
1048055601 8:130860310-130860332 ATATTTGTAAAACATGTGTCTGG - Intronic
1051549482 9:18313220-18313242 ATAGTTCTCAAAGAGTTGTCTGG - Intergenic
1055941734 9:81656677-81656699 TTGTTAATCAAACATGTGTCAGG + Intronic
1056678028 9:88692998-88693020 GTGGTTCTCAAACCTGAGACAGG + Intergenic
1060514283 9:124256218-124256240 AAGGTGCTCATAGATGTGTCGGG + Intergenic
1186419720 X:9415186-9415208 ATGAATCTTAAACATATGTCTGG - Intergenic
1190153513 X:47967940-47967962 ATGGTGCTCACACCTGTTTCTGG - Intronic
1197051918 X:122069765-122069787 ATATTTCTAATACATGTGTCTGG - Intergenic
1200420025 Y:2955218-2955240 CCGGTTCTCAAATATGTCTCTGG + Intronic