ID: 1101062376

View in Genome Browser
Species Human (GRCh38)
Location 12:100985653-100985675
Sequence GAGGGTTCTCTTGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101062363_1101062376 19 Left 1101062363 12:100985611-100985633 CCCATCATCTCACTATATTTTAA 0: 1
1: 0
2: 2
3: 34
4: 390
Right 1101062376 12:100985653-100985675 GAGGGTTCTCTTGGGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1101062364_1101062376 18 Left 1101062364 12:100985612-100985634 CCATCATCTCACTATATTTTAAG 0: 1
1: 0
2: 1
3: 32
4: 301
Right 1101062376 12:100985653-100985675 GAGGGTTCTCTTGGGGAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101062376 Original CRISPR GAGGGTTCTCTTGGGGAGGA GGG Intronic
900347577 1:2216941-2216963 GAGGGCTCTCCTGGGCAGAATGG + Intergenic
901654938 1:10763831-10763853 GAGCGTTCTGTTGGAGAAGAGGG - Intronic
902068735 1:13713303-13713325 GTGGGTGCTCATGGGGAGGCAGG + Intronic
902701541 1:18175675-18175697 GAGAGTCCTCGTGGGAAGGAAGG - Intronic
903115417 1:21175879-21175901 GAGGGTACCTTAGGGGAGGAGGG + Intronic
904423625 1:30409718-30409740 GAGGGCTCTAGTGGGAAGGAGGG + Intergenic
904821349 1:33246604-33246626 GAGGCTTCCCTTGGAGGGGAAGG - Intergenic
905256897 1:36690672-36690694 AGGGGTGCCCTTGGGGAGGAGGG - Intergenic
905270687 1:36785634-36785656 GGGGATCCTCTTGGGAAGGATGG - Intergenic
905517108 1:38569955-38569977 GAGGGTACTGTTGGGGTGAAAGG - Intergenic
905998879 1:42406329-42406351 GAGGCTTCTTTTGGGGGTGATGG - Intronic
906638230 1:47424721-47424743 GAGGGTTTTCTAGAGGAGGTGGG - Intergenic
907080513 1:51617342-51617364 GAGGGTTCCCTTGTTGGGGAGGG + Intronic
907998827 1:59660008-59660030 GTATTTTCTCTTGGGGAGGAAGG + Intronic
910301143 1:85708592-85708614 GAGGCTTCTCTAAGGGAAGAGGG - Intergenic
913715118 1:121526035-121526057 GAGGGTGTTCTTGGGAGGGAAGG + Intergenic
914829763 1:151162035-151162057 GAGGGTTTTCTTCAGGAAGATGG + Exonic
915935752 1:160089438-160089460 GAGGGGGCTCCTGGGGAGGTCGG + Exonic
918580284 1:186118881-186118903 CAGGGTTCTTTTGGGGGTGATGG + Intronic
919417336 1:197327761-197327783 GAGGTGTCTCTAGGGGAGGCAGG + Intronic
922272098 1:224043692-224043714 GAGAGTGCTTATGGGGAGGAGGG - Intergenic
922427705 1:225514802-225514824 GAGGGGGCCCTGGGGGAGGAGGG + Exonic
922595361 1:226808984-226809006 GAGGGTCCTCTGGGGGGAGAGGG + Intergenic
922806796 1:228394486-228394508 GAGGGGTCTCCCAGGGAGGACGG + Exonic
923019434 1:230151520-230151542 CAGGGCTATCTTGGGGAGGCCGG - Intronic
923248637 1:232158931-232158953 GAGGGTGGAGTTGGGGAGGAGGG + Intergenic
923373344 1:233334591-233334613 AAGGGTTTTTTTGGGGGGGAAGG + Intronic
924794688 1:247284867-247284889 GGGCGATGTCTTGGGGAGGAAGG - Intergenic
1063433997 10:6015962-6015984 GGGGCTTCTCTTGGGAATGATGG + Intronic
1064244802 10:13659857-13659879 GAGGTTTTTTTTGGGGGGGAAGG - Intronic
1065108784 10:22419282-22419304 AAGGGTTTTCTTTGAGAGGAAGG - Intronic
1065292409 10:24244281-24244303 GAGAGTTCTCCTGGGTGGGAGGG + Intronic
1066295346 10:34049203-34049225 CAGGGTTCTCCTGGCAAGGAGGG - Intergenic
1067925246 10:50502142-50502164 GAGAGGCCTCTGGGGGAGGAGGG - Intronic
1068566855 10:58585620-58585642 AAGGTTTTTCTGGGGGAGGAGGG - Intronic
1068602283 10:58968552-58968574 GAGGGTGCTCTTGGGGACCTAGG + Intergenic
1070168191 10:73913502-73913524 GAGGGATGTCTTAGGGAGGCAGG - Intronic
1072903745 10:99431482-99431504 GAGAGGGCTCCTGGGGAGGAAGG - Intergenic
1073201459 10:101739153-101739175 GAGGCTGCCCTTGGGGATGAGGG - Intergenic
1073486183 10:103820510-103820532 GAGGGGGCACTGGGGGAGGAGGG - Intronic
1074149029 10:110741818-110741840 CAGGGCTCTCCTGGGGAGGGAGG - Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1074867660 10:117554205-117554227 GAGGTTTGACTTGGTGAGGAAGG - Intergenic
1075059305 10:119243723-119243745 AAGGACTCTCTTGGGAAGGATGG + Intronic
1075102898 10:119518611-119518633 GAAGGTTCGATTGGGGAGGGCGG - Intronic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1079023595 11:16927994-16928016 GGGGGGTCTGTTGGGGAGGGAGG + Intronic
1080325288 11:31064532-31064554 GAAGGTTCTCTTGAGGAGACGGG - Intronic
1080418814 11:32092505-32092527 GAGGGTTCTCTTGGTGGTGGAGG + Intronic
1080870395 11:36231735-36231757 CAGGGTTTTTTTGGGGGGGAGGG + Exonic
1080937729 11:36881586-36881608 GAGGGCTGTAGTGGGGAGGAGGG + Intergenic
1083729279 11:64644196-64644218 GAGGGTGAGCTTGGGGAGCAGGG - Intronic
1083792898 11:64997198-64997220 GAGGGTGTTCTAGGGGAGGGAGG + Intergenic
1083823148 11:65183595-65183617 GAGGGCTCCCCTGGGGAGGAGGG + Intronic
1085085745 11:73665546-73665568 GAGAGTTCTCTGGGTGAGGCTGG + Intergenic
1085173003 11:74464597-74464619 GGTGATTCCCTTGGGGAGGAGGG - Intronic
1085212523 11:74794133-74794155 CAGGGTTCTCTTAGTAAGGAAGG + Intronic
1085297738 11:75440363-75440385 GATGGTTCTATGGGAGAGGAGGG - Intronic
1086397999 11:86435882-86435904 TAGGCTTCCCTTGGGGATGATGG + Intergenic
1086400380 11:86456622-86456644 GGGGTTTCTCTGGGGAAGGACGG + Intronic
1087494942 11:98879625-98879647 GAGGGGTCCCTTGTTGAGGATGG - Intergenic
1089502283 11:118939787-118939809 GAGGGGCCTTTGGGGGAGGAGGG - Intronic
1089590049 11:119534176-119534198 AAGTGGTCTCTTGGGTAGGAAGG + Intergenic
1090587331 11:128228051-128228073 GAGGTTTCTCATGGGGAGATGGG + Intergenic
1090784124 11:130033314-130033336 GAGTCTTCTCTGGGGGAGGCGGG - Intergenic
1091016050 11:132051665-132051687 AGGGGTCCTCCTGGGGAGGAGGG - Intronic
1091209007 11:133841103-133841125 GAGGGTTGTCTTGGGGGTGATGG - Intronic
1092016572 12:5164043-5164065 GAGGTTTCTTTTGGGGGTGATGG - Intergenic
1092095048 12:5834789-5834811 GAGGTTCCTTTTGGAGAGGAGGG - Intronic
1093964350 12:25309536-25309558 GAGGTTTCCTTGGGGGAGGATGG - Intergenic
1100166189 12:91920774-91920796 GAGGGTGAAATTGGGGAGGAGGG - Intergenic
1100187115 12:92150525-92150547 GAGGGTTCGGTGGGGGAGGTGGG + Intergenic
1101062376 12:100985653-100985675 GAGGGTTCTCTTGGGGAGGAGGG + Intronic
1102181138 12:110913219-110913241 GTGGGGTCTGTGGGGGAGGAAGG - Intronic
1103418334 12:120759785-120759807 GATGGTGGTCTTGGGGAGGGTGG + Intergenic
1105723144 13:23135622-23135644 GATGCTCTTCTTGGGGAGGAGGG + Intergenic
1106169387 13:27275798-27275820 GTGGGGTCTCTTGGGGATCATGG + Intergenic
1106677712 13:31978671-31978693 CGGGGTTCTCTTTTGGAGGATGG + Intergenic
1107384805 13:39896400-39896422 GAAGGTTAGCTTGGGGAGGAAGG + Intergenic
1108511051 13:51156117-51156139 AGGGGTTCTCTTGGGGAAGAAGG + Intergenic
1113790959 13:113027886-113027908 GAGGGGTGTCCTGGGGAGGGCGG + Intronic
1113844748 13:113380464-113380486 CAGAGTTCACTTCGGGAGGATGG - Intergenic
1113874566 13:113585656-113585678 GAGGGTGCCTTTGGGAAGGAAGG + Intronic
1114332635 14:21652565-21652587 GTGGCTTCTATTGGGAAGGAAGG + Intergenic
1114499944 14:23161271-23161293 GAGGGTTTGCTGGGGGAGGGAGG - Intronic
1115147445 14:30241595-30241617 GAGAGTCCTCTTGGGGCGCATGG + Intergenic
1116791892 14:49348124-49348146 GAGGGTGACCTTGGAGAGGAAGG - Intergenic
1117292511 14:54347319-54347341 GAGGTTTCTTTTGGGGACAATGG + Intergenic
1118381674 14:65222623-65222645 CAGGGGCCTCTGGGGGAGGATGG + Intergenic
1118427135 14:65678271-65678293 GCTGGCTCTCTTTGGGAGGATGG - Intronic
1118548390 14:66920283-66920305 AAGTTTTCTCTTGGGGAGGAGGG + Intronic
1118933281 14:70263029-70263051 GAGGGATCTCAGGGTGAGGATGG + Intergenic
1120846943 14:89134432-89134454 TAGGGTTTTCTTGTGGAGGCTGG + Intronic
1121027648 14:90628343-90628365 GAAGGTCCTCTAGGAGAGGAAGG - Intronic
1122243142 14:100382336-100382358 GAAGGTTCGCTTGGGGATGGGGG + Intronic
1122430901 14:101642561-101642583 CAGGGTTCTTTTGGAGAGAAGGG + Intergenic
1122507535 14:102241259-102241281 GAGGATTAGCCTGGGGAGGAAGG - Intronic
1124259738 15:28178113-28178135 GGGGGTTCTGTTGGTAAGGAAGG - Intronic
1124929475 15:34105225-34105247 CAAGGTTGTATTGGGGAGGAGGG + Exonic
1125174340 15:36803708-36803730 GAGAGTGCTCTTATGGAGGAAGG - Intronic
1125500708 15:40239022-40239044 GGGGGTTGCCATGGGGAGGAAGG - Intronic
1125507876 15:40277570-40277592 GAGAGCTCACGTGGGGAGGAGGG - Intergenic
1125793815 15:42389671-42389693 GTGGTTTCCATTGGGGAGGATGG + Intronic
1127350581 15:58148096-58148118 GAGCTCTCTCATGGGGAGGAAGG - Intronic
1128134888 15:65255517-65255539 GAGGGTTCGAGTGGGCAGGAGGG - Intronic
1129178697 15:73858004-73858026 GAGGGTTCCCTTGAGAAGGCAGG + Intergenic
1129373748 15:75114589-75114611 GTGGGTGCTTTTGGTGAGGAAGG + Intronic
1129410716 15:75348868-75348890 CAGAGTCCTGTTGGGGAGGAAGG - Exonic
1130289979 15:82590408-82590430 CAGGTTTCTTTTGGGGATGATGG - Intronic
1130452290 15:84067924-84067946 GAGGGTGGAGTTGGGGAGGAAGG - Intergenic
1130533050 15:84762303-84762325 GAGGGGTTTGGTGGGGAGGAAGG + Intronic
1132745310 16:1433882-1433904 GAGGGCTTTCTTGGAGAGGCAGG + Intergenic
1133240414 16:4411021-4411043 GCGGGATCTTTTGGGGATGATGG + Intronic
1134631694 16:15760753-15760775 GCGGGTTCTCTTGGGGAAATGGG + Intronic
1137398782 16:48136223-48136245 GAGGGTGCTCTTGGGGACTAGGG - Intronic
1138105478 16:54285368-54285390 GAGGGTCATCTTGGTGATGATGG + Exonic
1138179600 16:54932697-54932719 GAGGGTCATCTTGGTGATGATGG - Exonic
1138229654 16:55327720-55327742 GAGGGTCATCTTGGTGATGATGG - Exonic
1138529376 16:57626864-57626886 GTGAGTTATCTAGGGGAGGATGG - Intronic
1139379918 16:66524174-66524196 GAGGGTTGTCTTTGGGACCATGG - Intronic
1139406354 16:66721538-66721560 CAGGGTTCTTTTTGGGAGGTGGG - Exonic
1139501654 16:67371300-67371322 GAGGGTTCTGTTGGGAATGGAGG + Intronic
1141474410 16:84262937-84262959 GAGGTTTCTCTTGGGGAGCCAGG + Intergenic
1142781220 17:2182673-2182695 GAGGGCACTTTTGGGGAGTAGGG - Intronic
1144145344 17:12392526-12392548 GAAGCTTGACTTGGGGAGGAAGG + Intergenic
1145866504 17:28245430-28245452 GGGGGTACTGTTGGGGAAGAGGG - Intergenic
1146300220 17:31682755-31682777 GTGGGGTGTGTTGGGGAGGAGGG + Intergenic
1147028296 17:37608990-37609012 GAGGGTCCTCTTGGGGTGGGGGG - Intronic
1147739914 17:42665611-42665633 GAGGGTCATCTGGGGAAGGAAGG + Intronic
1149560883 17:57607241-57607263 GAGGGTTACTCTGGGGAGGAAGG - Intronic
1150597022 17:66615305-66615327 GAGGGTTCTCTTATGAAGGAGGG + Intronic
1151009816 17:70481788-70481810 CAGGGTTGGGTTGGGGAGGAGGG - Intergenic
1151065982 17:71150403-71150425 GAGGGATCTCATGGGGATGATGG + Intergenic
1151798989 17:76366391-76366413 GAGGGCTGTCCTGTGGAGGAAGG + Intronic
1152406007 17:80098297-80098319 GACTTTTCTCTTGGGGAGGTGGG + Intronic
1152794764 17:82301525-82301547 GAGGGCTCTCCCTGGGAGGAGGG + Intergenic
1153217895 18:2837030-2837052 GAGGTCTCTCTGGGGAAGGATGG + Intergenic
1154963125 18:21329730-21329752 GAGGGTTGTTTTGGGGAAGGGGG - Intronic
1156350022 18:36295902-36295924 GAGGGCTCTCTCAGTGAGGAGGG + Intergenic
1157272055 18:46283641-46283663 GAGGGTTGTGTTGTGGAGGAGGG - Intergenic
1157991613 18:52503731-52503753 GAGGGTTCTCTTGGTTATAATGG - Intronic
1159009204 18:63042132-63042154 GAGGGTTCTCTTGGTGTGTTTGG - Intergenic
1159751828 18:72312167-72312189 GATGGTTCAATTGGGGAAGAAGG + Intergenic
1159805628 18:72955146-72955168 GAGGAATCTTTTGGGGATGATGG + Intergenic
1160168252 18:76531920-76531942 GTGGGTTCTTCTGGGCAGGAGGG + Intergenic
1160407068 18:78653139-78653161 GAGGGGTCTCTTGGGACTGAGGG - Intergenic
1160407115 18:78653278-78653300 GAGGGGTCTCTTGGGACTGAGGG - Intergenic
1160929145 19:1561484-1561506 GAGGGGTCTGGTGGGGAGGAGGG + Intronic
1161484073 19:4525341-4525363 GAGGATTCTGATGAGGAGGAAGG + Intronic
1161726963 19:5935006-5935028 GAGGTTTCTTTTTGGGATGATGG + Intronic
1162020759 19:7867378-7867400 TAGGGTTCATTGGGGGAGGAAGG + Intergenic
1162030698 19:7916152-7916174 GAGGCTTCTCTAGGGGCGCATGG + Exonic
1162335239 19:10056052-10056074 GAGGGGACTCTTGGTGGGGATGG - Intergenic
1163102031 19:15103637-15103659 CAGGGATCTCATAGGGAGGAGGG + Intergenic
1163105215 19:15119345-15119367 TCGGGTGCTCTTGGGGAGGCGGG - Intronic
1165266680 19:34667275-34667297 GAGGGGTCTTCTGGGAAGGAGGG - Intronic
1165565149 19:36719674-36719696 GAGGGCTGTCTTGAGGCGGAAGG - Exonic
1166217486 19:41345025-41345047 ATGGGTACTGTTGGGGAGGATGG - Intronic
1166251797 19:41576391-41576413 CTGGGGTCTCCTGGGGAGGATGG + Intronic
1166259290 19:41626826-41626848 CTGGGGTCTCTTGGGTAGGAGGG - Intronic
1166281438 19:41796793-41796815 CTGGGGTCTCCTGGGGAGGATGG + Intronic
1166411987 19:42561618-42561640 CTGGGATCTCCTGGGGAGGATGG - Intergenic
1166415866 19:42594690-42594712 CTGGGGTCTCCTGGGGAGGACGG - Intronic
1166668414 19:44695462-44695484 GAGGTTGTTCTTGGGGAGAAAGG - Intergenic
1166815104 19:45539922-45539944 GAGGGATCTTTTGGAGATGATGG + Intronic
925192155 2:1893409-1893431 CGGGGATCTCTTGGGGAAGAAGG - Intronic
925788073 2:7452465-7452487 GAGTGTTGTTTTGGGGAGCATGG - Intergenic
925835401 2:7940531-7940553 TAGGGTCCTGTAGGGGAGGAGGG - Intergenic
926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG + Intergenic
926164420 2:10510864-10510886 GAGGGATCTTTTTGGGATGATGG + Intergenic
926737307 2:16083297-16083319 GAGGGGCTTCCTGGGGAGGAAGG - Intergenic
926807994 2:16729946-16729968 GAAGAGTCTCTTGGGTAGGAAGG - Intergenic
927764929 2:25798170-25798192 GAGGGTGGTGTGGGGGAGGAGGG + Intronic
927809105 2:26172359-26172381 TAGGGTGCTCTTGGGCAGTAGGG + Intergenic
928071757 2:28223938-28223960 GAGATTTCTCTTGGGGAGAGAGG - Intronic
928142863 2:28745652-28745674 TAGGGTGCTCTTGTGCAGGAAGG + Intergenic
928256177 2:29724974-29724996 ATGGGTCCTCTTGGGGAGGCAGG - Intronic
929804919 2:45136568-45136590 GAGGGACCTCTTAGGGAGGTGGG + Intergenic
929925346 2:46202710-46202732 GAGGGAGCTTTAGGGGAGGAAGG - Intergenic
931198354 2:60074049-60074071 GAGGTTTCTCTGGAGGGGGAGGG + Intergenic
931340514 2:61396822-61396844 GAGGGATCTTTGGGGGATGATGG + Intronic
931908147 2:66865118-66865140 GAGTGTTCATTTGGGGAAGATGG + Intergenic
932441152 2:71736481-71736503 GAGGTTTCTGCTGGGGAAGATGG - Intergenic
934695909 2:96400019-96400041 CAGGGTTCTGTTGCTGAGGAGGG - Intergenic
934854887 2:97723626-97723648 GAGTGTTGCCTTCGGGAGGACGG + Intronic
935065261 2:99641763-99641785 GACGACTCTCTTGGTGAGGAAGG - Intronic
935093834 2:99924598-99924620 GAGGGCTGTCATGAGGAGGAGGG + Intronic
936255832 2:110910101-110910123 GAGGGAACTTTTGGGGATGATGG - Intronic
937914646 2:127092900-127092922 GAGAGAGCCCTTGGGGAGGAGGG - Intronic
939427587 2:142059177-142059199 AAGGTTTCTTTTGGGGATGATGG + Intronic
940113890 2:150186483-150186505 TAAGGTTCTCTTGGTAAGGAGGG - Intergenic
940142919 2:150514220-150514242 CAGAGTTCTCTTGGGAGGGAAGG - Intronic
940250072 2:151665295-151665317 GAGGGTTCCCTGGGCGAGGCTGG + Intronic
940717127 2:157238597-157238619 GTGGGCTCCCTTGGGGAGAAGGG + Intergenic
941702939 2:168624610-168624632 GTAGGTTCTCTTGGGGTGGGGGG - Intronic
942749194 2:179268722-179268744 GAGGGTGTTCATGGGCAGGAAGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946299264 2:218812669-218812691 GCGAGTCCACTTGGGGAGGAAGG - Exonic
948272447 2:236685018-236685040 GCGGATTCTCACGGGGAGGAAGG - Intergenic
948560722 2:238849328-238849350 CAGGGTTTGCCTGGGGAGGACGG + Intronic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
948806403 2:240455237-240455259 GAGGATTTTTTTGGGGGGGAAGG - Intronic
948935521 2:241161787-241161809 GAGGGTTCCCGTGGGCAGGAAGG + Intronic
1168830983 20:845206-845228 GAGGGGTGGCTGGGGGAGGACGG - Exonic
1171372065 20:24668592-24668614 GCGGGTATTCCTGGGGAGGAGGG - Intergenic
1172018449 20:31895169-31895191 TAGGGTTCTCTTGGGGAAAGAGG + Intronic
1172073059 20:32272770-32272792 GAGTTTGCTCTTGGGGAGGTAGG + Intergenic
1172105569 20:32515352-32515374 GAGAGTTCTGTGGGGGAGGGAGG + Intronic
1172522829 20:35579302-35579324 GAGGATCCTCCTGAGGAGGAAGG - Intergenic
1172801798 20:37581201-37581223 GAGGGTGCTTCTGGGGAGGAGGG + Intergenic
1172994121 20:39057490-39057512 GAGGGTTGTCATGTGGAAGAGGG + Intergenic
1173543182 20:43869742-43869764 TAGGGCTTTCTTGGGGAGCAGGG - Intergenic
1173601255 20:44296965-44296987 CAGGGTTCACTAGGGGATGAGGG - Intergenic
1173898098 20:46566204-46566226 GAGGGTCCTTCTGGGGAAGAGGG - Intronic
1174505805 20:51016798-51016820 GAAGATTCTCTTGGGAAGCAGGG - Intronic
1175252308 20:57616900-57616922 GAGGGCACTCCCGGGGAGGATGG - Intronic
1175985423 20:62762011-62762033 GGGGGCTCTGTGGGGGAGGAAGG - Exonic
1179527004 21:41985662-41985684 AAGGGCTCTCCTGTGGAGGACGG + Intergenic
1179566920 21:42254747-42254769 GAGCTTTCTCTTGGGGAGGGAGG + Intronic
1180027457 21:45175928-45175950 CAGGGCGTTCTTGGGGAGGACGG - Exonic
1180115175 21:45698481-45698503 CAGGGCTCTCTTGGGGAGAAGGG + Intronic
1180242213 21:46517435-46517457 GAGGTTTCTCTTAAGGAAGATGG - Intronic
1180728639 22:17964612-17964634 GAGGGTTCTAGTGTGGAGGTGGG - Intronic
1181419338 22:22786913-22786935 GATAGTCCTCTTGGGGAGGAGGG - Intronic
1181576929 22:23801149-23801171 GAGTGTTTTTCTGGGGAGGAAGG - Intronic
1181693119 22:24577054-24577076 GAGAGCTCTGTTGGGGAAGAGGG + Intronic
1181871608 22:25903561-25903583 GAGGTATCCCTGGGGGAGGAGGG + Intronic
1181985840 22:26799351-26799373 GGGGGTCCTCTTGAGGAGGCTGG - Intergenic
1182300575 22:29334693-29334715 GAGGGATCACTTGGGAAGTAGGG + Intronic
1182300587 22:29334742-29334764 GAGGGATCACTTGGGAAGTAGGG + Intronic
1182424905 22:30266733-30266755 GCGGGTTCTGGCGGGGAGGAAGG + Intronic
1183479626 22:38056490-38056512 GTGGGTTCCCTGGGGGAGGTTGG - Intronic
1184168315 22:42743569-42743591 GAAGGCTCTGGTGGGGAGGAGGG + Intergenic
950608436 3:14106828-14106850 CAGGGTTCTTTTTGGGAGGTGGG + Intergenic
951753435 3:26062202-26062224 GAAGGGTCTCTTGAGCAGGAGGG - Intergenic
952388562 3:32860608-32860630 GGAGTTTCTCTTGGGGAGGTGGG + Intronic
953129497 3:40124608-40124630 GAGGCTTCTCCTGGAGAGAAAGG + Intronic
954362305 3:50128512-50128534 GAAGGTTCTCTTGGAGAGCTTGG - Intergenic
955529521 3:59858577-59858599 GAGGGGTGTCTTGTGGAGGTGGG + Intronic
956931988 3:74053817-74053839 AAGGCTGCTCTTGGGGAGTATGG + Intergenic
957634247 3:82760713-82760735 GAGGTTTCCCTGGGGAAGGATGG - Intergenic
959214703 3:103437017-103437039 TGGGGTACTCTTGGGAAGGAAGG - Intergenic
960141512 3:114155818-114155840 GAGGGTTCGCTTTGTGAAGAGGG - Intronic
961236758 3:125374647-125374669 GAGTGTGCTCTTTGGGAGAAGGG - Intronic
964359249 3:155877494-155877516 GAGGTTTTTTTTTGGGAGGAGGG - Intronic
964492489 3:157251440-157251462 AAAGGTTGTCTTGGGGAAGAGGG + Intergenic
965599748 3:170442931-170442953 GAGGGATTTTTTGGGGGGGAGGG + Intronic
967194846 3:187017256-187017278 GAGGGTTTCCTTGGGCAGAATGG - Intronic
968496171 4:917646-917668 AAGGGTTACCGTGGGGAGGAGGG + Intronic
971849026 4:31959663-31959685 GGGTGTTCACTTGGGGAAGATGG + Intergenic
972281319 4:37604324-37604346 AAGGGGTCACTTGGGGACGACGG - Intronic
972602617 4:40586452-40586474 GAGGGTGCTCCTGGGTAAGAAGG + Intronic
972805691 4:42527926-42527948 GAGGTCTCTCTGGGGAAGGATGG - Intronic
974598093 4:64038954-64038976 GAGGGTCCGGTGGGGGAGGAGGG + Intergenic
975732811 4:77354196-77354218 TAGGGCTGGCTTGGGGAGGAGGG - Intronic
975734402 4:77367292-77367314 TAGGGCTGGCTTGGGGAGGAGGG - Intronic
976597458 4:86907340-86907362 AAATGTTCTCTTGGAGAGGAGGG + Intronic
977936129 4:102806835-102806857 GTGGGTTTTTTTGGGGAGGGGGG - Intronic
979997252 4:127445602-127445624 TATGTCTCTCTTGGGGAGGAGGG - Intergenic
981650833 4:147056504-147056526 AGGGGTTGTCTTGGGAAGGAAGG + Intergenic
982067659 4:151668775-151668797 GAGGGTTCTGGTGGGAAGGCAGG - Intergenic
985515679 5:343630-343652 GCGGCTTCTCTGGGGGAGGCCGG + Intronic
985782750 5:1879682-1879704 GAGGGTCATCTTGGTGATGATGG + Exonic
985895822 5:2749563-2749585 GAGGGTCATCTTGGTGATGATGG + Exonic
985996361 5:3599439-3599461 GAGGGTCATCTTGGTGATGATGG - Exonic
986358642 5:6953072-6953094 GGGGTTTCTGTTGGGGAGGGAGG - Intergenic
987975220 5:25006915-25006937 GAGGGTGCAATTGGAGAGGAAGG - Intergenic
990208051 5:53451299-53451321 GAGGCTGCTCTTGGGGTGGGGGG - Intergenic
990996489 5:61737085-61737107 CAGGGTGCAGTTGGGGAGGAAGG + Intronic
991054708 5:62307413-62307435 TAGGTTTCTCTTGGGGAAAATGG + Intronic
992120974 5:73591839-73591861 GAGAGGCCTCCTGGGGAGGATGG - Intergenic
992202882 5:74401490-74401512 AAGGAAGCTCTTGGGGAGGATGG - Intergenic
993045196 5:82858521-82858543 GAGGGTATTGATGGGGAGGAAGG + Intergenic
994057250 5:95431848-95431870 GATTGTGTTCTTGGGGAGGAAGG - Intronic
995174763 5:109162961-109162983 GAGGGAACTTTTGGGGATGATGG - Intronic
995772103 5:115682054-115682076 GAGGTTTCTTTTGGGGATGATGG - Intergenic
996562757 5:124848722-124848744 GAGGGTTATATTAGGGAGGAAGG - Intergenic
997443875 5:133927311-133927333 GCTGGTCCTCTTGGGAAGGATGG - Intergenic
997449496 5:133970378-133970400 AAGGGTTCTCTTGAGTATGAGGG - Intergenic
998166528 5:139847490-139847512 GCGGGTTCTGTTGGGGGCGAGGG - Intronic
998572368 5:143274161-143274183 GAGGGTACTTTTGGGGGTGATGG - Intergenic
999451107 5:151678927-151678949 GAGGTATCTCGTGGGGAGGCAGG - Intronic
999508160 5:152219926-152219948 GAGGCCTGTCATGGGGAGGAGGG - Intergenic
1004409017 6:15362973-15362995 GAGGGTTGTGGTGGGGAGGGAGG + Intronic
1005009642 6:21323452-21323474 GTGGGTTTTCTCGGGGAGTAGGG + Intergenic
1006058956 6:31405043-31405065 GAGGGTGCTCTGGGGGAGGGTGG - Intronic
1006071441 6:31499928-31499950 GAGGGTGCTCTGGGGGAGGGTGG - Intronic
1006516540 6:34548770-34548792 GAGGGCTCGCTGGGGCAGGAGGG - Intronic
1007533621 6:42564624-42564646 GTGGGTTCTCCTGGGCAGAAAGG - Intronic
1007698033 6:43746316-43746338 CAGTGGTCTCTGGGGGAGGAGGG + Intergenic
1007755778 6:44098494-44098516 GGGAGTTCCTTTGGGGAGGAGGG - Intergenic
1011600639 6:89056970-89056992 AAAGGTTGTCTGGGGGAGGAGGG - Intergenic
1011745941 6:90407768-90407790 GATGGCTCTCTTGGTGGGGAAGG - Intergenic
1011868551 6:91862463-91862485 GGAGGTTCTTCTGGGGAGGATGG - Intergenic
1011896642 6:92235990-92236012 GAGGGTGGAGTTGGGGAGGAGGG - Intergenic
1012397870 6:98820740-98820762 GAGTCTCCTCTTGGGGAGGGAGG + Intergenic
1015506145 6:133990979-133991001 GAGGTTCCTTCTGGGGAGGAGGG + Exonic
1016820914 6:148345214-148345236 GAGGGTTCTTTTGGGGAAGAGGG + Intronic
1017497359 6:154994313-154994335 GAGGGTTTTCTTGGGGGAAATGG - Intronic
1017636106 6:156444581-156444603 GAGGGTTCTCATGGGGAGTGAGG - Intergenic
1018383848 6:163285159-163285181 GAGGGGTGTCTGGGGGAGGCTGG - Intronic
1018727322 6:166623696-166623718 CAGAGCTCTCTTGGGGATGAGGG + Intronic
1019119853 6:169793894-169793916 GAGGGTTGTCTTGGGAATGAAGG - Intergenic
1019740433 7:2670337-2670359 GAGGGTACGCTTGGGTGGGAGGG + Intergenic
1019774629 7:2905354-2905376 CAGGATTCTCTTAGGAAGGAAGG + Intergenic
1020076000 7:5259366-5259388 GAGGGTGGAGTTGGGGAGGAGGG + Intergenic
1020509852 7:9040456-9040478 GAGGGTTTTTTTGGTGAGGCTGG + Intergenic
1021675915 7:23080807-23080829 GAGGGTACTCTTGAGGGGAATGG + Intergenic
1022505550 7:30907025-30907047 GAGAGTTCTCTTGTGAAGGAGGG + Intergenic
1022840824 7:34162219-34162241 GAGGCTTCTCTTCAGGAGGCGGG - Intergenic
1023028610 7:36074193-36074215 GAAGGTCTACTTGGGGAGGAGGG - Intergenic
1026930803 7:74221939-74221961 GAGGGCTGGCTTGGGGAGGTGGG + Intronic
1026951465 7:74350037-74350059 GGGGCTTCTCTTTGGGATGATGG + Intronic
1026977044 7:74505387-74505409 GTGGGTGCACTTGGGGAGCATGG - Intronic
1031618513 7:123908134-123908156 GAGGGTTATGTGGGGTAGGAAGG + Intergenic
1032203774 7:129843635-129843657 GAGGGATTCTTTGGGGAGGAGGG - Intronic
1033776907 7:144621241-144621263 GAGGGTGCTCATGAGGAGGGTGG - Intronic
1034347942 7:150398379-150398401 GAGGGGTCTGTTGGGGACGCTGG + Exonic
1035176605 7:157056356-157056378 TAGGGGCCTCTTGGGGAGGAGGG + Intergenic
1035367701 7:158360009-158360031 GTGGGTTGTCTGGGTGAGGAAGG - Intronic
1035596322 8:860909-860931 GGGCATTCTCTTGGGTAGGAAGG + Intergenic
1036644941 8:10607184-10607206 GAGGATGCTCTGGAGGAGGAAGG + Exonic
1037990862 8:23320335-23320357 GGGGCTGCTCTTTGGGAGGATGG + Intronic
1038047110 8:23774828-23774850 GATGGTCCTCTTGGTGAAGATGG + Intergenic
1038125344 8:24667218-24667240 TAGGGTTCTGTTGGCCAGGAAGG - Intergenic
1039120496 8:34141128-34141150 AAGAGTTCTCTTGGGAAGCAAGG - Intergenic
1040717568 8:50275906-50275928 CTGGTTTCTCTTGAGGAGGATGG + Intronic
1041240928 8:55848384-55848406 GAAGCTTCTCCTGGGGAGAAGGG + Intergenic
1041503300 8:58563439-58563461 GAGTTTTCTTTTGGGGAGGATGG + Intronic
1041764041 8:61398695-61398717 GAGGGTTAGTTAGGGGAGGAGGG - Intronic
1042463193 8:69094729-69094751 AAGGGTTCTCTTGGGGGGTGTGG - Intergenic
1044507946 8:93042121-93042143 CATGTTTCTCTTGGGGATGAGGG + Intergenic
1048494105 8:134920922-134920944 AAGGTTTACCTTGGGGAGGAAGG + Intergenic
1048877954 8:138851631-138851653 GAGCTTTCTCTAGGAGAGGATGG + Intronic
1049049697 8:140184896-140184918 GAGGGTGCTCTGGGGAGGGATGG - Intronic
1049350034 8:142159515-142159537 GGGGCCTCTCTTGGGAAGGATGG + Intergenic
1049819816 8:144626792-144626814 GAGGGGTCTCTAGCCGAGGAGGG - Intergenic
1050283206 9:4074192-4074214 CAGGGGTCTCTAGGGGAGCAGGG + Intronic
1050714514 9:8507131-8507153 GGGGTTTTTCTTGGGGGGGAGGG + Intronic
1051015109 9:12464640-12464662 CAGGGCTCTCTTGTGGATGATGG + Intergenic
1051555771 9:18380894-18380916 AAGGGTTCTCTTTGGTGGGAAGG - Intergenic
1051705851 9:19878874-19878896 GGGGGTTTTCTGGGGGAGAAGGG - Intergenic
1052896322 9:33750905-33750927 GAGGCTCCTCTAGGGGAGGACGG + Intronic
1053056178 9:34994235-34994257 GTGGATTCTGTTGGGGAGGAAGG - Intronic
1055978295 9:81975625-81975647 GAAGTTTTTCTTGGAGAGGAAGG - Intergenic
1056832374 9:89927575-89927597 GGGGGTTGGCTTGGGGAGAAAGG + Intergenic
1057207994 9:93184731-93184753 GAGGCTTGGGTTGGGGAGGAGGG - Intergenic
1058603731 9:106698309-106698331 GAGGGTTGGACTGGGGAGGAGGG + Intergenic
1059554607 9:115266836-115266858 GAGGGTTCTCAAGAGGAGGTAGG - Intronic
1060201242 9:121652639-121652661 GAGGGTGCCCGTGGGGTGGAAGG + Intronic
1060236040 9:121863245-121863267 CTGGGTTCTGTGGGGGAGGATGG + Intronic
1060561554 9:124549136-124549158 GAGGGTTATCTGGTGGGGGATGG + Intronic
1061006180 9:127929570-127929592 GAGGGATATCAAGGGGAGGAAGG - Intronic
1061203430 9:129150011-129150033 GAAGGTTTTGTTGGGGAGAAGGG + Intergenic
1062479642 9:136745388-136745410 GAGGGGTCTCCTGGGGAGGGGGG - Intronic
1062564290 9:137157065-137157087 GGGGCTGCTCTTGGGGAGGTGGG + Intronic
1185612847 X:1402630-1402652 GAGGCTGCATTTGGGGAGGAGGG - Intergenic
1185612876 X:1402738-1402760 GAGGCTGCATTTGGGGAGGAGGG - Intergenic
1185612962 X:1403000-1403022 GAGGCTGCATTTGGGGAGGAGGG - Intergenic
1185780012 X:2835941-2835963 AAGGGTCGTCTTGGGGAGCAGGG + Intronic
1187278595 X:17838507-17838529 GAGGGTTCTCTTGGTGAAGTTGG + Intronic
1187724877 X:22192070-22192092 GTGGCTTGTCTTGGGGAGGGTGG + Intronic
1188771670 X:34161248-34161270 GTGGGTCTTCCTGGGGAGGAGGG - Intergenic
1190287520 X:48971130-48971152 GAGAGTTATCTGGGGGAGGTGGG + Exonic
1190322383 X:49186620-49186642 GAAGGTTCTGTAGTGGAGGATGG + Intergenic
1191793277 X:64993728-64993750 GGGGGTGCTCTTGGGGAGTAGGG - Intronic
1194847211 X:98825335-98825357 GAGGGTTCTTTGGGAGAGGAAGG - Intergenic
1195479348 X:105325162-105325184 GAGGGATCTTTTTGGGATGAAGG - Intronic
1197992548 X:132333716-132333738 GAAGATTCTCTTGGGGATGGGGG - Intergenic
1198143078 X:133825505-133825527 AAGCATTTTCTTGGGGAGGAGGG + Intronic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1199636180 X:149813939-149813961 GGGGTTTCTCTTGGAGAGGAGGG - Intergenic
1200157569 X:153985452-153985474 GGGGGTTCGCCTGGGCAGGAAGG - Intergenic
1201290037 Y:12414048-12414070 AAGGGTCGTCTTGGGGAGCAGGG - Intergenic