ID: 1101071220

View in Genome Browser
Species Human (GRCh38)
Location 12:101077885-101077907
Sequence CCGGATAAGCAAAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101071220 Original CRISPR CCGGATAAGCAAAAGAAGGA GGG (reversed) Intronic
901775332 1:11556726-11556748 CCGCAGAATCAAAAGGAGGATGG + Intergenic
903531751 1:24036007-24036029 CTCGATAGGAAAAAGAAGGAAGG - Intergenic
904052348 1:27647202-27647224 CCAGAGGAGCAAAAGAAGGAAGG + Intergenic
906669691 1:47645469-47645491 CTGGAGAGGCAAGAGAAGGATGG + Intergenic
909567816 1:77075205-77075227 CCAGAAAAGCAAGGGAAGGATGG - Intergenic
909754241 1:79203536-79203558 CAGGATTAACAAAATAAGGAGGG + Intergenic
910507022 1:87961010-87961032 CTAGATAAGCAATAGAAGTAGGG + Intergenic
910817328 1:91305111-91305133 CTTGAAAAGAAAAAGAAGGAAGG - Intronic
912513657 1:110204818-110204840 CCAGAGAAGCCAAGGAAGGAAGG + Intergenic
912862484 1:113226349-113226371 CAGGAAAAGAAAACGAAGGAGGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916907143 1:169298561-169298583 CCGCAGAAGCAAAAGAATCAGGG + Exonic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1066284010 10:33946310-33946332 CTGAATATGTAAAAGAAGGAAGG + Intergenic
1066803636 10:39219083-39219105 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1070610311 10:77927604-77927626 CCGGATGAGGAAAAGAAAGGTGG + Intergenic
1074575281 10:114663119-114663141 CAGGAAAAGCAAAAGAAGCAGGG - Intronic
1075591503 10:123694687-123694709 AAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1080093908 11:28382051-28382073 CCAAATAAACAAAAGAAAGAAGG - Intergenic
1081857967 11:46315975-46315997 TCGGTTAAGCAAAAGAAGGCTGG + Intronic
1082582431 11:54888995-54889017 CAGGATAAAAAATAGAAGGAAGG + Intergenic
1082768723 11:57188931-57188953 CTGGATAAGCCCTAGAAGGAAGG + Exonic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1086150074 11:83599369-83599391 CTGGATAAGCAAAAGCAAGGAGG - Intronic
1087806523 11:102561381-102561403 ACAGAGAAGGAAAAGAAGGAAGG - Intergenic
1088939448 11:114438895-114438917 TCCCATAAGAAAAAGAAGGAAGG + Intronic
1090585980 11:128213991-128214013 CCGGTTAGGAAAAAGAAGGATGG - Intergenic
1092551119 12:9501291-9501313 CCGAAAAAGAAAAAGAAGGAAGG - Intergenic
1093321121 12:17716805-17716827 CCAGATAAAAAAAAAAAGGAGGG - Intergenic
1094520685 12:31185065-31185087 CCGAAAAAGAAAAAGAAGGAAGG + Intergenic
1094761058 12:33533458-33533480 TCAGATTAGAAAAAGAAGGAAGG - Intergenic
1094863129 12:34493860-34493882 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1094868557 12:34571128-34571150 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1095113077 12:38319305-38319327 CAGCATAAGCAAAGGAAGAAAGG + Intronic
1095703557 12:45215606-45215628 GAGAATAAGCAAAAGAAGAAGGG - Intergenic
1096851675 12:54442898-54442920 CCGGAGAAGCAAGAGAATGAAGG + Intergenic
1100784635 12:98065910-98065932 CCTTATAAGTAAAAGTAGGAAGG + Intergenic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1104350425 12:128040482-128040504 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1106525750 13:30539856-30539878 GAGGAAAAGAAAAAGAAGGACGG - Intronic
1109548674 13:63862438-63862460 CCAGATAAGCAAAAGTTGAAGGG + Intergenic
1111276928 13:85962150-85962172 CCAGATAAACAAAAGTAGAAGGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1113166520 13:107449353-107449375 CCTGAAAATCAAAAGTAGGAAGG + Intronic
1114173511 14:20298099-20298121 CAAGAGAAGCAAAAGAAGAAAGG + Intronic
1115546018 14:34465374-34465396 GAGGATAAGCAAAATAAGGAAGG + Intergenic
1115909049 14:38235215-38235237 CCATGTAAGCAAAGGAAGGAGGG - Intergenic
1116394495 14:44431130-44431152 CCTGATAAGAACAAGAAGGCAGG + Intergenic
1117925303 14:60772846-60772868 CTGAATAAGCAAATGAAGTAAGG + Intronic
1120105725 14:80491946-80491968 CTGGATAAGGGAATGAAGGATGG - Intronic
1120433126 14:84444342-84444364 CCAGAAAAGCAAAAAAGGGAGGG - Intergenic
1121106838 14:91285852-91285874 TCGGATAACCCAAAGGAGGAAGG + Intronic
1122589122 14:102833451-102833473 AGGGAAAAGCAAAGGAAGGAAGG - Intronic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122780919 14:104143147-104143169 CTGGATAAGCAAGAGATGCACGG - Intronic
1125196441 15:37052698-37052720 TCGAATAAGTGAAAGAAGGAAGG - Intronic
1126417393 15:48432058-48432080 CCAGAAAAGGAAATGAAGGAGGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126645042 15:50867449-50867471 CTGGATCTGCAAAGGAAGGAAGG + Intergenic
1127484504 15:59406824-59406846 CTGGCTTAGCACAAGAAGGAAGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1132758191 16:1496129-1496151 CGGGAAAGGCAAGAGAAGGAAGG - Intronic
1135226119 16:20659686-20659708 CTGGATATGGAAAGGAAGGAAGG - Intronic
1137219770 16:46437160-46437182 AAGGAAAAGGAAAAGAAGGAAGG - Intergenic
1141856222 16:86683103-86683125 GGGGAGAAGGAAAAGAAGGAAGG + Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1146991524 17:37277736-37277758 CCAAATAAGGAAAAGAAAGATGG - Intronic
1147233132 17:39034098-39034120 CAGGATAAGTAAAAGAATCATGG - Intergenic
1147873709 17:43605907-43605929 CTGGCTGAGCAAAAGAAAGAAGG - Intergenic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150783947 17:68147573-68147595 CAGGATAAGTAAAAGAATCATGG + Intergenic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1153953178 18:10074144-10074166 CCAGATCAGCAAAAGAAAAAAGG + Intergenic
1154011563 18:10579185-10579207 TGGGATAAGCAACAGCAGGAAGG - Intergenic
1160537247 18:79601261-79601283 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167181100 19:47904000-47904022 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167181768 19:47909359-47909381 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167182418 19:47914749-47914771 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183085 19:47920101-47920123 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183753 19:47925451-47925473 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167184383 19:47930501-47930523 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185055 19:47935852-47935874 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185707 19:47941241-47941263 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167186374 19:47946599-47946621 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187025 19:47951987-47952009 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187675 19:47957370-47957392 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167542166 19:50096262-50096284 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167542601 19:50099327-50099349 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543038 19:50102392-50102414 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543474 19:50105455-50105477 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544147 19:50110799-50110821 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544822 19:50116152-50116174 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167545497 19:50121504-50121526 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546174 19:50126832-50126854 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546851 19:50132167-50132189 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167547509 19:50137540-50137562 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167845913 19:52164018-52164040 AAGGAAAAGAAAAAGAAGGAAGG + Intronic
1168013599 19:53554208-53554230 CGGGAGAGGCCAAAGAAGGAAGG + Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
929362119 2:41104280-41104302 CAGGAGAAGGAAAAGAAAGAAGG - Intergenic
929564509 2:42976125-42976147 CAGGAAAAGAAAAAAAAGGAAGG + Intergenic
931541389 2:63333406-63333428 CTGGATCTGCAAAGGAAGGAAGG - Intronic
932280851 2:70490820-70490842 CCAGATAAACAAAAAAAGCATGG - Intronic
933311582 2:80667805-80667827 CCGGAGGAGCAAAATAAGAAGGG + Intergenic
935518547 2:104076520-104076542 CTGGAAAAGCAAAAGAATGGAGG - Intergenic
937486157 2:122316856-122316878 CAGGAGAGGCAAAAGAAGAAAGG - Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
941459426 2:165750941-165750963 CAGGCAAAGCCAAAGAAGGAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943857901 2:192822281-192822303 ACAGATAATCAAAAGAAGGTTGG + Intergenic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
1170394707 20:15913909-15913931 ACGAATAAGCAAATGAACGATGG + Intronic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1171364501 20:24614592-24614614 TAGGAAAATCAAAAGAAGGAAGG + Intronic
1174138112 20:48394419-48394441 CCTGCTCAGCAAATGAAGGATGG - Intergenic
1174755127 20:53150716-53150738 GAGGAAAAGAAAAAGAAGGAGGG + Intronic
1176991572 21:15503559-15503581 CCCCATAATCAAGAGAAGGAAGG + Intergenic
1177449417 21:21245859-21245881 GAGGATAAGGAAGAGAAGGAAGG + Intronic
1177907268 21:26987108-26987130 CCAGATAAGTAAGAGAAAGAAGG - Intergenic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178519544 21:33277109-33277131 CGTGATAGGCAAAAGAATGAAGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179435823 21:41361413-41361435 GCGGAAAACCCAAAGAAGGAGGG - Intergenic
1182466783 22:30521859-30521881 AAGGAAAAGAAAAAGAAGGAAGG - Intergenic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183266754 22:36832012-36832034 ACGGATAATGAACAGAAGGATGG + Intergenic
1184271250 22:43385579-43385601 GCGAATAATCAAAAGAAGCACGG - Intergenic
1184875683 22:47274016-47274038 CCAGAAAAGCAAAGGAAGGATGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
951591451 3:24269908-24269930 CAGAAAAAGCCAAAGAAGGAAGG - Intronic
952614168 3:35249457-35249479 CAGTCTAAGCAAGAGAAGGAGGG - Intergenic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
954741059 3:52751008-52751030 CAGGTTAAGTAAAAGAAGGCAGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
964804279 3:160589489-160589511 CCAGACAAACAAAAGAATGAGGG + Intergenic
966021686 3:175220585-175220607 CATGAAAAGAAAAAGAAGGAGGG - Intronic
968271069 3:197404200-197404222 CCGGGTAAGGAGATGAAGGAAGG + Intergenic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
976497405 4:85746309-85746331 TCAGATACTCAAAAGAAGGAGGG - Intronic
977148013 4:93471204-93471226 GCACAGAAGCAAAAGAAGGAAGG - Intronic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
980135886 4:128858151-128858173 CTGGATATGCAAAAGCAGGCAGG - Intronic
981679363 4:147377610-147377632 CCAGATAATAAAAAGAAGGATGG - Intergenic
982662243 4:158221234-158221256 CCAGTTGAGCAAAAGAAGGAAGG + Intronic
982936500 4:161484232-161484254 GAGAATAAGAAAAAGAAGGAAGG - Intronic
987785817 5:22497420-22497442 ACGGGTGAGCAAAGGAAGGAAGG - Intronic
989400280 5:41000919-41000941 CCGCTTCAGCAAAAGAAGGCTGG + Intronic
990186261 5:53213048-53213070 CTGGATATGGAAAGGAAGGAAGG + Intergenic
990421813 5:55642981-55643003 ACTGAAATGCAAAAGAAGGAAGG - Intronic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
993215305 5:85015037-85015059 CAGGTAAAGCAAAAGAAAGAAGG + Intergenic
993344980 5:86771500-86771522 CCAGAAAAAGAAAAGAAGGAAGG + Intergenic
993567606 5:89493967-89493989 CCTGATCAGCAAGATAAGGAGGG + Intergenic
995947423 5:117665455-117665477 CCTGAGAAGCAAAACAAGCATGG - Intergenic
996657916 5:125963909-125963931 ACAGATAAGCCAAAGAAGGGGGG + Intergenic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
999663114 5:153886119-153886141 CCGGACAAAAAAAAGAAAGAGGG + Intergenic
1000734562 5:164882821-164882843 CAGAAGAAGCAAAGGAAGGAAGG - Intergenic
1001241947 5:170077894-170077916 CCGGAGAAGAGAGAGAAGGAGGG - Intronic
1003014304 6:2455714-2455736 CAGGTCTAGCAAAAGAAGGAGGG - Intergenic
1003487812 6:6595074-6595096 GTGGACCAGCAAAAGAAGGATGG + Intronic
1004577029 6:16906831-16906853 GAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1007470025 6:42083793-42083815 CAAGACAAGCAAAGGAAGGAAGG + Intronic
1007714258 6:43845254-43845276 CCTGGAAAGGAAAAGAAGGAGGG - Intergenic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1009061874 6:58406409-58406431 CAGGATAAGAACTAGAAGGAAGG - Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1009260868 6:61485623-61485645 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1009320953 6:62287167-62287189 CCGCATTGGTAAAAGAAGGATGG - Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1014847919 6:126302345-126302367 CCAGATGAGTAAAACAAGGAAGG + Intergenic
1016124035 6:140376654-140376676 CTTTATAAGCCAAAGAAGGAAGG - Intergenic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1018423709 6:163662078-163662100 CCAGGTAAACAAGAGAAGGAAGG + Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021902750 7:25303677-25303699 CAGGATGAGCAAAAAAATGAAGG - Intergenic
1022764045 7:33390093-33390115 AAGGAAAAGGAAAAGAAGGAAGG - Intronic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1025530414 7:61874267-61874289 CAGGATAAAAAACAGAAGGAAGG - Intergenic
1025599644 7:62979633-62979655 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1031848793 7:126838352-126838374 GCAGAGAAACAAAAGAAGGAAGG - Intronic
1033261696 7:139849605-139849627 CCAAATAAGCAATAGAGGGAAGG + Intronic
1033622472 7:143074594-143074616 CCGGAGAAACAAAAGAGTGATGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1036926557 8:12912326-12912348 CCAGAGGAGAAAAAGAAGGAAGG + Intergenic
1038799229 8:30734117-30734139 CCCGGTAGGCAAAGGAAGGAAGG + Intronic
1039708028 8:40027034-40027056 CACAATAAGCACAAGAAGGACGG + Intergenic
1039763332 8:40601367-40601389 GCTGATAGCCAAAAGAAGGAAGG + Intronic
1039915004 8:41853364-41853386 TCGCAAAGGCAAAAGAAGGAGGG + Intronic
1041706423 8:60850974-60850996 ACTGATAAGCAAAAGAAGGAAGG - Intronic
1041768134 8:61441994-61442016 CTTGATATACAAAAGAAGGATGG - Intronic
1042572346 8:70179411-70179433 CCGGAGGAGGAAAAGAAGGGAGG + Intronic
1043107509 8:76133604-76133626 CCAGAAAATCAAAAGATGGAGGG + Intergenic
1043264079 8:78240496-78240518 CCAGATATGGAAAAGAAGGCTGG + Intergenic
1044041070 8:87368923-87368945 CATGAGAAGGAAAAGAAGGAGGG - Intronic
1044905570 8:96998020-96998042 CAGGATAAGCAGAAGAATAAAGG - Intronic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1046751033 8:117926686-117926708 CAGGATAAGGAAAAGCAAGAAGG + Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047548579 8:125844203-125844225 CAGGGTGAGCAAAAAAAGGATGG - Intergenic
1047691327 8:127357747-127357769 CAGGAAAAGAAAGAGAAGGAAGG - Intergenic
1051354754 9:16231424-16231446 TGGGAAAAGGAAAAGAAGGAAGG - Intronic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1054363720 9:64207679-64207701 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1056081217 9:83095894-83095916 AGGGATAAGCAAAAGAGGGTAGG - Intergenic
1058184266 9:101835808-101835830 CCGGATATGCACATGAAGGCAGG - Intergenic
1059883103 9:118714404-118714426 AAAGAAAAGCAAAAGAAGGAAGG - Intergenic
1060078867 9:120622123-120622145 CCGACTATGCAAAAGATGGAAGG - Intronic
1060145737 9:121250840-121250862 CATGATAAGCAAAAAAGGGAAGG - Intronic
1203613363 Un_KI270749v1:28641-28663 CCGCATCAGCAAATGCAGGAGGG - Intergenic
1189777104 X:44480263-44480285 CAGGAGAAGCAAAAGATGGGAGG - Intergenic
1191268452 X:58429515-58429537 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1191581518 X:62767279-62767301 CCAGATAAAGAAAAGAAAGAAGG - Intergenic
1192136051 X:68601591-68601613 CCAGATAAACAAAAGATGGAGGG + Intergenic
1192274121 X:69612647-69612669 CCAGACAAACAAAAGTAGGAAGG + Intergenic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1199296908 X:146169975-146169997 ACTGATAAGCAAAATAAGGCAGG - Intergenic
1199355637 X:146860252-146860274 GCGGAAAAGGAAAAGAAAGAAGG + Intergenic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic