ID: 1101071727

View in Genome Browser
Species Human (GRCh38)
Location 12:101082397-101082419
Sequence GAAAATGGACAGATACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 439}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101071721_1101071727 29 Left 1101071721 12:101082345-101082367 CCTCTTTTTCTTTATAACTTACC 0: 9
1: 1505
2: 1571
3: 1084
4: 1166
Right 1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG 0: 1
1: 0
2: 1
3: 60
4: 439
1101071725_1101071727 7 Left 1101071725 12:101082367-101082389 CCATTCTTGGGTATTTCTTCATA 0: 8
1: 457
2: 976
3: 2102
4: 7506
Right 1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG 0: 1
1: 0
2: 1
3: 60
4: 439
1101071720_1101071727 30 Left 1101071720 12:101082344-101082366 CCCTCTTTTTCTTTATAACTTAC 0: 1
1: 16
2: 36
3: 139
4: 1126
Right 1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG 0: 1
1: 0
2: 1
3: 60
4: 439
1101071724_1101071727 8 Left 1101071724 12:101082366-101082388 CCCATTCTTGGGTATTTCTTCAT 0: 6
1: 438
2: 1094
3: 4567
4: 8766
Right 1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG 0: 1
1: 0
2: 1
3: 60
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101071727 Original CRISPR GAAAATGGACAGATACATCC AGG Intronic
901190132 1:7404817-7404839 GAAAATTGACAAATACTTTCAGG + Intronic
902196636 1:14803296-14803318 GAAACAGGTCAGCTACATCCGGG - Intronic
902268628 1:15287302-15287324 GAGAATGGACTAATACATCTGGG - Intronic
902939745 1:19792171-19792193 GAAAATGGACTAATACACCAAGG + Intronic
903887860 1:26551416-26551438 CAAGATGGAGAGAGACATCCTGG + Exonic
904132210 1:28283282-28283304 GAAAATGAACAGATACCTCAAGG - Intergenic
906882985 1:49613012-49613034 GAAAATGTACATATACATCATGG + Intronic
907615613 1:55922130-55922152 CAAAATGGACAGATACAAACAGG - Intergenic
907726057 1:57021684-57021706 GAGAATGGACTAATACACCCAGG + Intronic
908358574 1:63345875-63345897 GAAAATGCACAAATAGATACTGG - Intergenic
909053833 1:70799671-70799693 GAAAATGAACATATACACCATGG + Intergenic
909263125 1:73520745-73520767 GAAAATGAACAGAAAGATACAGG + Intergenic
909520124 1:76558372-76558394 GAAAATGTACATATACACCATGG + Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
910148230 1:84108106-84108128 GAAAATGTACATATACACCATGG + Intronic
911148828 1:94577647-94577669 GAAAATTGACAAAGATATCCAGG - Intergenic
912071201 1:105811806-105811828 GAAAATGGACTAATACACCCTGG + Intergenic
913490506 1:119375607-119375629 GAAAATGGACTAATACAATCAGG - Intronic
914697942 1:150102653-150102675 GAAAATGTACATATACACCATGG + Intronic
915005153 1:152628845-152628867 GAAATTGCTCAGTTACATCCAGG - Intergenic
915494343 1:156270710-156270732 GAAATGGGAAAGATACAGCCGGG + Intronic
916362347 1:163984817-163984839 AAAAAGGGTCAGATACATCAGGG + Intergenic
916574632 1:166056530-166056552 GTAAATGGTCAGATTCATCCAGG - Intergenic
916897402 1:169179588-169179610 GAAAATGTACATATACACCATGG + Intronic
917103903 1:171473021-171473043 GAAAACGGACTAATACATGCAGG - Intergenic
918356567 1:183710499-183710521 GAAAATGGACTAATACACCTGGG - Intronic
918429554 1:184444586-184444608 GAAAATGGACTAATACAACTGGG + Intronic
918469659 1:184859016-184859038 AAATATGGAAAGATACATACAGG + Intronic
918977583 1:191510689-191510711 GAAAATGTTAAGATACATCAAGG - Intergenic
919194159 1:194262697-194262719 GAAAATGTACATATACAACATGG + Intergenic
919899039 1:202030188-202030210 GAAAATGGACAGAAAAATACAGG + Intergenic
920191370 1:204196270-204196292 TAAGACGGACAGATGCATCCAGG - Intronic
921634906 1:217480766-217480788 GAAAATGTACATATACATAATGG + Intronic
1063303294 10:4873375-4873397 GAAAATGGACTAATACAGTCAGG + Intergenic
1063450977 10:6149941-6149963 GAAAATGTACATATACAACATGG - Intronic
1063718972 10:8559225-8559247 GAAAATGGAAAGACAAATCTTGG + Intergenic
1064506925 10:16041601-16041623 GAAGATGGAGAGGTACATTCCGG - Intergenic
1064798291 10:19039119-19039141 GAAAATGTACATATACACCATGG + Intergenic
1065751232 10:28889869-28889891 GAAAATGGACTAATACACACAGG - Intergenic
1066173647 10:32879912-32879934 GAAAATGTACATATACACCATGG - Intronic
1066328447 10:34391228-34391250 GAAAGTAGACAGATACATGTTGG + Intronic
1067118811 10:43456503-43456525 GAAAATGGAGAGACATTTCCTGG - Intronic
1067660939 10:48235787-48235809 GAACATGGACAGATATGTTCTGG + Intronic
1067929813 10:50549324-50549346 GAAAATGTACATATACACCATGG + Intronic
1068264423 10:54627638-54627660 GAAAATGGACTAATACAGCCAGG + Intronic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1070579296 10:77707618-77707640 GAAAATGTACAGATACACAATGG + Intergenic
1073009413 10:100347872-100347894 GAAACTGTACAGATACATTAGGG - Intronic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1073591610 10:104762891-104762913 GAAAATAGACAAATACACCTGGG + Intronic
1073946288 10:108754398-108754420 GTAAATGGATACATATATCCAGG - Intergenic
1074084086 10:110194377-110194399 GAAAAAGAACAGGTGCATCCAGG + Intergenic
1074124419 10:110516768-110516790 AAAAATGCACAGATACTTCAAGG - Intergenic
1074258843 10:111831825-111831847 GAGAATGGACTAATACATCTGGG - Intergenic
1074287354 10:112110634-112110656 GGAAATGGACTAATACACCCAGG + Intergenic
1074439327 10:113461208-113461230 AAAAATGGACAAATACAATCTGG + Intergenic
1074951370 10:118340516-118340538 GAGAATGGAGTGATACATCCAGG - Intronic
1075152257 10:119944434-119944456 GAAAATGGACTAATACAGTCAGG + Exonic
1075294227 10:121259520-121259542 GAAAAAGGACAGTAACTTCCAGG + Intergenic
1075500503 10:122969439-122969461 GAAAATGTACATATACACCATGG + Intronic
1075547885 10:123369136-123369158 GAAAAGGGACAGACTCATTCAGG - Intergenic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1076275406 10:129194524-129194546 GAAAATGGACTAATACATAGAGG - Intergenic
1076514356 10:131034950-131034972 GAAAATGGAGAGATAAATCGTGG - Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078113271 11:8418448-8418470 GAAAATGTACATATACACCATGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078556833 11:12334813-12334835 GAAAATGTACATATACACCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1078645625 11:13139280-13139302 GAAAATGTACATATACATCATGG - Intergenic
1079570950 11:21942641-21942663 GAGAATGGACTAATACATCCAGG + Intergenic
1079992322 11:27259356-27259378 GAGAATGGACTAATACAACCAGG - Intergenic
1080487923 11:32730618-32730640 GAAAATACCCAGATACATCATGG - Intronic
1082702619 11:56451724-56451746 GAAAATGTACAGATACGCCATGG - Intergenic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1085881402 11:80471282-80471304 CAAAATGAGCACATACATCCCGG - Intergenic
1086361216 11:86061874-86061896 GTAAATGGACAAATAAACCCGGG + Intronic
1086534557 11:87829318-87829340 GAAAATGAACTGATACAACAGGG - Intergenic
1087512797 11:99119498-99119520 GAAAATCTACATATACATCATGG - Intronic
1087841424 11:102924594-102924616 GAGAATGAAAAGATCCATCCAGG + Intergenic
1088497999 11:110451716-110451738 GAAAATGTACATATACACCATGG + Intronic
1088706186 11:112466576-112466598 GAAAATGGACTAATACAATCAGG - Intergenic
1091025915 11:132141092-132141114 GAAAAAAGAGAGAAACATCCAGG - Intronic
1092150381 12:6244163-6244185 GAAACTTGACAGGGACATCCTGG + Intergenic
1093097765 12:14991542-14991564 GAAAATGTACATATACACCATGG + Intergenic
1093750156 12:22789091-22789113 GTAAATAGACAGATAAATCGTGG - Intergenic
1095258978 12:40076515-40076537 GAAAATGTACATATACACCATGG - Intronic
1095391048 12:41707061-41707083 GAAAATGTACATATACACCATGG - Intergenic
1096285673 12:50297736-50297758 TAAAAGGGAGAGAAACATCCAGG + Intergenic
1097367847 12:58739845-58739867 GAAAATGTACATATACACCATGG - Intronic
1097375335 12:58836407-58836429 GAAAATGTACATATACACCATGG - Intergenic
1097483066 12:60156315-60156337 GAAAATGGTTAAATAAATCCTGG - Intergenic
1097955656 12:65483140-65483162 GAAAATGGACTAATACAGCCTGG + Intronic
1097989642 12:65822031-65822053 GAATATGGACAGAAACTACCTGG + Intergenic
1098160352 12:67643551-67643573 GAAAAGAGAAAGCTACATCCTGG - Intergenic
1098275943 12:68811202-68811224 GAAAATGGACAGATAAGACTAGG - Intronic
1098938915 12:76512332-76512354 GAAAATGTACATATACACCATGG - Intronic
1099023270 12:77433090-77433112 GAAAATAGTCTGATAAATCCAGG - Intergenic
1099493854 12:83320199-83320221 GGAAATGGAAAGATAAATCTTGG - Intergenic
1099929825 12:89060421-89060443 GAAACTGGACAGCTGCTTCCTGG - Intergenic
1100898951 12:99216305-99216327 GAAAATGGAGTCATACACCCTGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1101147779 12:101857527-101857549 CAAAATGGAGAGATACATTTGGG - Intergenic
1101231172 12:102742995-102743017 GAAAATGGACTAATACAAGCTGG + Intergenic
1101286407 12:103317935-103317957 GAGAATGGACAAATACATTGTGG - Intronic
1101506820 12:105354766-105354788 GCAGATGGACGGATTCATCCAGG + Intronic
1101548911 12:105743271-105743293 GCAAATGGACATAGACATCAAGG - Intergenic
1101742270 12:107509963-107509985 GATAATAGACAGAGACAACCTGG - Intronic
1103866877 12:124059661-124059683 GAAAATGTACATATACACCATGG - Intronic
1104262353 12:127196101-127196123 GAAAATGTACATATACATCATGG + Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104498312 12:129261565-129261587 GAAAATGGACTAATACAGACTGG + Intronic
1104505775 12:129330817-129330839 GAAAATAGACAAATACACCAAGG + Intronic
1104604686 12:130179517-130179539 GAACATGGACAGAGGCATCCAGG - Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1106048465 13:26167828-26167850 GAAAATGTACATATACACCATGG + Intronic
1107120335 13:36789005-36789027 GAAAATGGACTAAGACACCCAGG - Intergenic
1108650018 13:52468738-52468760 GAAAATGTACATATACACCATGG - Intronic
1109167582 13:59055297-59055319 GAAAATGTACATATACACCATGG + Intergenic
1109337322 13:61009115-61009137 GAAAATGGACTAATACATATGGG + Intergenic
1109588702 13:64446444-64446466 GAAAATGGACTAATACAACAGGG - Intergenic
1110007391 13:70290110-70290132 GAAAATGTACATAAACATCATGG + Intergenic
1110361556 13:74631059-74631081 AAAAATGGACTAATACACCCTGG + Intergenic
1110378007 13:74815505-74815527 GAAAATGGACTAATACACCTAGG + Intergenic
1110442698 13:75542964-75542986 GAAAATGTACATATACACCATGG + Intronic
1111655763 13:91150229-91150251 GAAAATTGACTAATACATCAAGG + Intergenic
1112556660 13:100474774-100474796 CAAAATGGACATATACGGCCAGG - Intronic
1113152594 13:107281641-107281663 GAAAATGGACTAATACAGTCAGG - Intronic
1115104476 14:29744307-29744329 GAAAATTCAAAGATAAATCCAGG - Intronic
1115210086 14:30958598-30958620 GAAAATTGAGAGATACATAATGG - Intronic
1115295335 14:31819838-31819860 GAAAATGGACAGAGAATTCTTGG + Intronic
1117483931 14:56174816-56174838 GAGAATGGACTAATACAACCAGG + Intronic
1119108473 14:71947225-71947247 TAAAGTGGATAGATACATCTTGG + Intronic
1120258013 14:82143431-82143453 GAAAATGGACTAATACATATAGG + Intergenic
1120511695 14:85423458-85423480 ATAAATGGATATATACATCCTGG - Intergenic
1121267706 14:92615165-92615187 GAAAATGGACTAATACAAACAGG + Intronic
1126383660 15:48072806-48072828 GAAAATGGACTAATACAGGCTGG - Intergenic
1126959661 15:53977524-53977546 GAAAATGGAAGGATATTTCCAGG - Intergenic
1127154876 15:56113282-56113304 GAAAATGTACATATACACCATGG + Intronic
1127529013 15:59824078-59824100 GAAAATGGAGACATAAATACAGG + Intergenic
1127642117 15:60925771-60925793 AAAAATGGACAGAAACGTACAGG - Intronic
1128764200 15:70241188-70241210 CAAAATGGACAGTTCCAGCCAGG + Intergenic
1128910841 15:71512933-71512955 GAAAATGAAAACATACATCTTGG + Intronic
1129585645 15:76861756-76861778 GAAAATGGACTAATACATTTAGG - Intronic
1130768490 15:86899168-86899190 GAAAATGTACATATACACCATGG + Intronic
1130993731 15:88892526-88892548 GAAAATGGCCAGCTTCCTCCTGG - Intronic
1131556672 15:93405383-93405405 GAAAATGGACTAATACACCTGGG + Intergenic
1131874379 15:96789257-96789279 GAGAATGGACTGATACATTTGGG - Intergenic
1134606180 16:15573076-15573098 GAAAATGGACTAATACAACTAGG + Intronic
1134768459 16:16783043-16783065 GAAAATGGACTAATACACCTGGG + Intergenic
1135676446 16:24418837-24418859 GGAAATGAGCAGACACATCCAGG + Intergenic
1135817427 16:25648062-25648084 GAAAATGGACTAATACAAACAGG + Intergenic
1135837947 16:25844831-25844853 GAAAATGTACATATACACCAGGG + Intronic
1137019013 16:35404678-35404700 GAAAATATACAGATATATCTTGG - Intergenic
1138778160 16:59750543-59750565 GAAAATGGACAAATACACTCTGG - Intronic
1138908999 16:61373916-61373938 GAAAATGGACTAATACACCAAGG + Intergenic
1138965488 16:62079161-62079183 GAAAATAAACAAATACATCCTGG - Intergenic
1139134024 16:64179426-64179448 GAAAATGGACTAATACACCCTGG + Intergenic
1139732138 16:68955377-68955399 GCATCTGGACAGATATATCCCGG - Intronic
1140122834 16:72098442-72098464 AAAAAAGGAAAAATACATCCTGG + Intronic
1140655796 16:77138001-77138023 GAAAATGTACATATACACCATGG - Intergenic
1140831942 16:78760018-78760040 GAACACAGACAAATACATCCTGG - Intronic
1141411277 16:83834801-83834823 GAAAATGGACTAATACATAAGGG + Intergenic
1142017838 16:87760735-87760757 GAAAATGTACATTTACAGCCAGG + Intronic
1143601688 17:7950740-7950762 GAAAATGTACATATACACCATGG + Intergenic
1144680760 17:17192559-17192581 AAAAATGATCAGCTACATCCAGG - Exonic
1146449044 17:32957454-32957476 GAAAATGGAGAAATACATTGTGG - Intergenic
1146622249 17:34408063-34408085 GAGAATGGGCAGATACTTCCTGG - Intergenic
1148529203 17:48373058-48373080 GAAAATGGACTAATACAACCTGG - Intronic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1149677104 17:58475692-58475714 GAAAGTAGACAGATACATGTTGG + Intronic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1150002524 17:61451020-61451042 GAACAGGGACAGACCCATCCAGG + Intergenic
1150040974 17:61860744-61860766 GAAAATGGACAGATAAATTCTGG + Intronic
1150537847 17:66062201-66062223 GAAAATGGACTAATACATAGTGG + Intronic
1151093129 17:71465315-71465337 GAAAGTGGATAGATAGATGCTGG + Intergenic
1153116993 18:1670368-1670390 TAAAATGGACAGATTCATCTTGG + Intergenic
1153740085 18:8115789-8115811 GAAAATGCACATGTACATCATGG - Intronic
1153873559 18:9344205-9344227 AAAAATTAAGAGATACATCCAGG - Intronic
1153892177 18:9527618-9527640 GTAAATGGAGAGATAAATCATGG + Intronic
1153898182 18:9588428-9588450 GGAAGTGGACAGAGCCATCCTGG + Intronic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1155242991 18:23881064-23881086 CTAAATGCACAGAAACATCCAGG - Intronic
1155662375 18:28264773-28264795 GAAAATGTACATATACACCATGG - Intergenic
1156649555 18:39208966-39208988 GGAAATGGACAAATACAAGCAGG + Intergenic
1156769295 18:40699434-40699456 GAAAATGGACCAATACAACTGGG + Intergenic
1157046010 18:44102788-44102810 GAAAATGGGCAGTAACTTCCAGG + Intergenic
1157580235 18:48769846-48769868 GCAAATGAACAGAGACATACAGG - Intronic
1158238868 18:55353899-55353921 CAAAATGGGCAAATTCATCCTGG + Intronic
1158842564 18:61403864-61403886 GAAAATGTACATATACACCATGG + Intronic
1158855570 18:61540341-61540363 GAAAATGGACTAATACATGAAGG - Intronic
1158879966 18:61768635-61768657 AAAAATGGACTGATACACCAAGG + Intergenic
1158882739 18:61796618-61796640 GCATATGGACAAATGCATCCAGG + Intergenic
1159429437 18:68332369-68332391 GAAAAGGCACAGATATACCCAGG + Intergenic
1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG + Intronic
1160027857 18:75233378-75233400 GAAAATCAGCAGAAACATCCTGG - Intronic
1164668457 19:30059042-30059064 CAAGATGGAAAGATTCATCCGGG + Intergenic
1166606125 19:44144386-44144408 AAAAATGGATAGACAAATCCTGG - Intronic
925440877 2:3884039-3884061 GAAAATGGACTAATATAACCTGG - Intergenic
925528078 2:4826709-4826731 CAAAATGGAAAGATTCAACCAGG - Intergenic
927098764 2:19770525-19770547 GAAAATGGACTAATACAACATGG - Intergenic
927398079 2:22678503-22678525 GAATATGCACTGATACAGCCAGG + Intergenic
927567929 2:24130171-24130193 GAAAATGTACATATACACCATGG - Intronic
928521543 2:32094016-32094038 GAAAATGGAGAGAATGATCCTGG - Intronic
929273982 2:40005753-40005775 GAAAATGGACTAATACACCAGGG - Intergenic
929759067 2:44791104-44791126 GAAAATGGACTAATACAATCAGG - Intergenic
929773253 2:44910928-44910950 GAGAATGGACTAATACATTCTGG - Intergenic
930457351 2:51622299-51622321 GAAAATGGACTAATACATATAGG - Intergenic
932103132 2:68919175-68919197 GAAAAGGCACAGAAACATCCAGG + Intergenic
937201010 2:120204519-120204541 GACCATGGACACATACATGCTGG - Intergenic
937446747 2:121964870-121964892 AAAAATGTACATATACATCATGG + Intergenic
937448453 2:121978651-121978673 GAAAATGGACTAATACACCTGGG - Intergenic
938244649 2:129767232-129767254 GAAAATGGAAGGATGGATCCAGG + Intergenic
939346929 2:140977416-140977438 GAAAATGGACTAATACATATGGG + Intronic
939363474 2:141203629-141203651 GAAAATTAACAAATACATTCAGG + Intronic
939564871 2:143775297-143775319 GAAATTTGACAGACACATCATGG - Intergenic
940675152 2:156718255-156718277 GAAAATGTACATATACACCATGG + Intergenic
940726176 2:157339226-157339248 GATAGTGGACAGATACATACTGG + Intergenic
942436141 2:175979118-175979140 GAAAATGGAGAGATACATTTGGG + Intronic
942968929 2:181933400-181933422 GAATATGGACTTATAGATCCAGG + Intergenic
943200874 2:184822192-184822214 GAAAATGTACATATACACCATGG + Intronic
944386289 2:199168568-199168590 GAAAATGGACTAATACATTTGGG + Intergenic
945621052 2:212137535-212137557 GAAAATGTACATATACACCATGG - Intronic
945792339 2:214320466-214320488 GAAAATGGACTAATACAACCAGG - Intronic
946023152 2:216655601-216655623 GAAAATGGACTAATACAGTCAGG + Intronic
946092158 2:217237233-217237255 GAAAATTAACAAATACATTCAGG - Intergenic
946169913 2:217888844-217888866 GAAAATGGACTAATACACCAGGG + Intronic
946735799 2:222753484-222753506 GAAAGTGGAGAGACAAATCCAGG + Intergenic
946832031 2:223736941-223736963 GAAAATGGACTAATACATAAAGG + Intergenic
948038690 2:234881121-234881143 GCAAAGGGACAGAGACATGCAGG + Intergenic
948143529 2:235691845-235691867 GACAATGGCCAGTGACATCCAGG + Intronic
948310704 2:236983814-236983836 GAAAATGGACTAATACAACCAGG + Intergenic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
1169498165 20:6134294-6134316 GAAAATGAACTAATACACCCTGG + Intergenic
1170519730 20:17171812-17171834 AAAAATGGACAGGAAAATCCAGG - Intergenic
1172402486 20:34661577-34661599 GAAAATGTACATATACACCATGG - Intronic
1172832789 20:37850384-37850406 GAAAATGGACACACACACACAGG - Intronic
1172909968 20:38401346-38401368 GAAAATGGACAAATACACTATGG - Intergenic
1173264042 20:41461678-41461700 GAAAATGAACCAATACATCCTGG + Intronic
1173851649 20:46222350-46222372 GCAAATGGATAGCTACACCCAGG - Intronic
1174876165 20:54228555-54228577 GAGAATGGACACATACATTGTGG + Intergenic
1175587651 20:60157617-60157639 GAAAATGTACATATACACCATGG + Intergenic
1175770526 20:61620807-61620829 GAAAATGGACACATTCTCCCTGG + Intronic
1178221071 21:30660885-30660907 GAAAATGGACTAATACATGCAGG - Intergenic
1178300976 21:31452673-31452695 GAAAATGGAAAAATATATTCTGG - Intronic
1178623151 21:34193916-34193938 GAAAATGGACTAATACAGACAGG + Intergenic
1179124447 21:38578596-38578618 GAACATGGCCAGATGCATGCGGG + Intronic
1179561008 21:42216255-42216277 GAAAATGGACTAATACAGACAGG + Intronic
1180029350 21:45193837-45193859 ATAAATGGAGAGATACATCATGG + Intronic
1180756806 22:18168066-18168088 GAAAATGGACTAACACATACAGG - Intronic
1181074961 22:20369377-20369399 GAAAATGGACTAACACATACAGG + Intronic
1182369101 22:29798496-29798518 GAGACTGGAAAGATACATTCTGG + Intronic
1182533156 22:30977923-30977945 GAAAATGAACAATTACATACAGG - Intergenic
1182758784 22:32704425-32704447 GAAAATGTACATATACACCATGG - Intronic
1183581692 22:38730251-38730273 CAGAATGGACAGACAGATCCAGG - Intronic
1184024736 22:41846795-41846817 GAGAAAGGACTGATCCATCCTGG - Intronic
1184262217 22:43325002-43325024 GAAATTGGACACAGACATACAGG + Intronic
1184312096 22:43652464-43652486 GAAAACGGACTGATACACCCAGG + Intronic
949386861 3:3512524-3512546 GAAAATGTACATATACACCATGG + Intergenic
949575031 3:5330885-5330907 GAAAATGGACTGATACAGGAGGG - Intergenic
950898070 3:16471609-16471631 AAAAATGGAAAAATAGATCCAGG - Intronic
951492320 3:23285239-23285261 GAAAATGGACACATACACAACGG - Intronic
951693108 3:25417696-25417718 GAAAATAGACTAATACAGCCTGG + Intronic
955015087 3:55062407-55062429 GAAAATGAGAAGATACAGCCAGG - Intronic
955899762 3:63740050-63740072 GAAACTTGACAGATACATAAAGG + Intergenic
957544022 3:81613510-81613532 GAAAATAGACAGATACATGTTGG - Intronic
958047927 3:88307778-88307800 GAAAAGGGCCAGCTTCATCCCGG - Intergenic
958710514 3:97711359-97711381 GAAAATGGACTAATACAGTCAGG + Intronic
959479254 3:106851443-106851465 GAAAATGGAGATATACATGTAGG + Intergenic
960336048 3:116418944-116418966 GCAAAAGCACAGATACATACAGG - Intronic
960428367 3:117537037-117537059 GAAAATGGACCGATACAAGAAGG + Intergenic
960502224 3:118452104-118452126 GAAAATAAACAGAGACATTCAGG - Intergenic
960535436 3:118809852-118809874 GAAAATGGACTAATACAGACAGG - Intergenic
961378217 3:126481160-126481182 TAAAATGGACAGATCCAGCGGGG - Intergenic
962888290 3:139648376-139648398 GAAAATGGACTGATATATGTAGG + Intronic
963127709 3:141830562-141830584 GAAAGTGGAAAGTTACAGCCAGG + Intergenic
963916521 3:150863964-150863986 GAAAATGGACTAATACACCCAGG - Intergenic
963957459 3:151270593-151270615 GAAAGTAGACAGATACATGTTGG - Intronic
964208981 3:154207876-154207898 GAAAATGTACATATACACCATGG + Intronic
964369863 3:155988622-155988644 GAAAGTAGACAGATACATATTGG - Intergenic
964600182 3:158491935-158491957 GAAAATGGACTAATACACACAGG - Intronic
966517763 3:180837974-180837996 GAAAATGTACATATACACCATGG + Intronic
967281279 3:187826535-187826557 GTAGATGGGCAGACACATCCTGG + Intergenic
967866002 3:194190362-194190384 GAAAATGTACATATACACCATGG - Intergenic
969211241 4:5689095-5689117 GAATATGTACAGATACTTCCAGG - Intronic
970279933 4:14443884-14443906 GAAAATGGACTAATACATCTGGG + Intergenic
970426622 4:15951963-15951985 GAAAGGGAACAGATACTTCCAGG + Intergenic
970799703 4:19958120-19958142 GAAAATGGACTAATACACCCAGG - Intergenic
971070128 4:23081462-23081484 GAAAATGGACTAATACAACTGGG + Intergenic
971729350 4:30357198-30357220 GAAAATGTACATATACACCATGG - Intergenic
971901855 4:32670251-32670273 GAAAATGGACCGATATACCTAGG + Intergenic
972294158 4:37720533-37720555 GAAAATGTATATATACATCATGG + Intergenic
972823298 4:42727059-42727081 GGAAATGGCCAGATAAATCAGGG - Intergenic
972892150 4:43570926-43570948 CAAAATGAACATATACATACGGG + Intergenic
973669945 4:53206868-53206890 GAAAATGGACTAAGACAACCAGG - Intronic
974484115 4:62484862-62484884 GAAAAAGGAAAGATAAATTCAGG - Intergenic
975253810 4:72211984-72212006 GAAAATGGACCAATACACCTGGG - Intergenic
975334504 4:73160180-73160202 AAAAATGGATAGATACTTCAAGG - Intronic
975551005 4:75612334-75612356 TTAGATGTACAGATACATCCAGG - Intronic
975846594 4:78531744-78531766 GTACATGCACAGATACATGCTGG - Intronic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
977013949 4:91669451-91669473 GAAAATGGACTAATACATGAAGG - Intergenic
977898595 4:102393548-102393570 GAAAATTGGCAGCTAAATCCAGG - Intronic
978416753 4:108485027-108485049 GAAAATAGACAGATAGATGAAGG + Intergenic
978547207 4:109883725-109883747 GAAAATGTACATATACATAACGG + Intergenic
978660092 4:111115702-111115724 GAAAAAGCTCAGATAAATCCAGG + Intergenic
978977870 4:114901210-114901232 AGAAATGGACAGATTCATCAGGG - Intronic
979203284 4:118005021-118005043 GAGAATGGACTAATACACCCTGG - Intergenic
979452466 4:120888491-120888513 GTAAATGGACAAATACATTCTGG - Intronic
979810297 4:125028407-125028429 GAAAATGGACTGACACATCATGG - Intergenic
980553093 4:134365893-134365915 GAAAATGGCCTAATACAACCAGG + Intergenic
980751868 4:137100891-137100913 GAAAATGTACATATACATCAAGG + Intergenic
982195204 4:152904755-152904777 GAAAATGTACATATACACCATGG - Intronic
982301364 4:153882192-153882214 GAGAATGGACCAATACATTCTGG + Intergenic
982632735 4:157852773-157852795 GAAAATGTACATATACACCATGG - Intergenic
982797253 4:159661257-159661279 GAAAATGGACTAATACAGGCAGG - Intergenic
985076952 4:186225171-186225193 GAAACTGGACTAATACATCTGGG + Intronic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986134553 5:4963097-4963119 GAAAATAGACACATAGATCAAGG + Intergenic
986173006 5:5328775-5328797 GAAAACGGACGAATACACCCTGG - Intergenic
986221974 5:5776267-5776289 GGAAATGGACTAATACAGCCTGG + Intergenic
986296280 5:6441338-6441360 GAAAATGTACATATACACCAAGG - Intergenic
986503584 5:8427256-8427278 GAAAATGGATGAATACACCCAGG - Intergenic
986820967 5:11466384-11466406 GTAAATTGACAGATAAGTCCTGG - Intronic
986945393 5:13012287-13012309 GAAACTGTACAGATACACCATGG - Intergenic
987490515 5:18575280-18575302 GAAAATGTACATATACACCATGG + Intergenic
989244637 5:39240950-39240972 GAAAATGTACATATACACCATGG + Intronic
989266773 5:39483787-39483809 GAAAATGGACATCTAGGTCCAGG - Intergenic
989651453 5:43695648-43695670 GAAAATGGACTAATACACCTTGG - Intronic
990228922 5:53689390-53689412 GAAAATGTACGTATACACCCTGG + Intergenic
990479296 5:56192704-56192726 GATAATGGACAGAATCATCTAGG + Intronic
990873494 5:60459412-60459434 GAAAATAGACAGATACATGTTGG + Intronic
991158506 5:63467000-63467022 GAAAACGGACTAATACATCAGGG + Intergenic
991195297 5:63924979-63925001 GAAAATGGACTAATACATGTGGG + Intergenic
992224505 5:74606954-74606976 TAATATGGACAGATACATTGTGG - Intergenic
993221390 5:85101931-85101953 GAAAATGTACATATACACCATGG + Intergenic
994351184 5:98748407-98748429 GAAAATGTACATATACACCATGG + Intergenic
994866364 5:105276867-105276889 GAAAATGGACTAATACATACTGG + Intergenic
995244338 5:109919533-109919555 GAAAATGGACTAATACACCCTGG + Intergenic
995431082 5:112078310-112078332 GAAAATGTACACATACATCATGG - Intergenic
997218185 5:132132201-132132223 GTAAATAAACTGATACATCCAGG - Intergenic
997785993 5:136714512-136714534 GAAAATGTACATATACACCATGG - Intergenic
1000609541 5:163359296-163359318 GATAATGGACAATGACATCCAGG + Intergenic
1001202719 5:169733123-169733145 GAAAAAGGACAGAAAAATCAGGG - Intronic
1003329003 6:5113965-5113987 GAAAATGGAGAGATGGATGCTGG - Intronic
1003665434 6:8107277-8107299 GAAAATGGACTAATACATGGTGG - Intergenic
1003822419 6:9913783-9913805 GAAAATGTACATGTACATCATGG - Intronic
1004624331 6:17360630-17360652 GAAAATGTACATATACATCACGG + Intergenic
1005909704 6:30297745-30297767 GAAAATGTACATATACACCGTGG - Intergenic
1006018282 6:31100465-31100487 GAAAATGTACATATACATAATGG - Intergenic
1006170751 6:32090821-32090843 GAAAATGAACAAATAAATTCTGG - Intronic
1006251177 6:32786857-32786879 GAAAATGGAAAGATATTCCCTGG + Intergenic
1007749716 6:44064445-44064467 TCAAATGGACATCTACATCCCGG + Intergenic
1007805634 6:44443370-44443392 GGAAATGGAAAGCTAGATCCAGG - Intronic
1007872492 6:45056460-45056482 GAAAATGTATAGGTACATCATGG + Intronic
1008190866 6:48454983-48455005 GGAAATGGATAGAAACAACCAGG + Intergenic
1008463138 6:51799297-51799319 AAAAATGGAGAGATGAATCCAGG - Intronic
1008596980 6:53052260-53052282 GAAAATGTACATATACACCATGG - Intronic
1009496222 6:64351121-64351143 GAGAATGGATTAATACATCCAGG + Intronic
1009825207 6:68858135-68858157 GAAAATGGACTAATACAGTCAGG + Intronic
1010477331 6:76304095-76304117 GAAAATGTACATATACACCATGG - Intergenic
1010757722 6:79686066-79686088 GAAAATGGAACAATACTTCCTGG - Intronic
1012016485 6:93858818-93858840 GATAAGGGTAAGATACATCCTGG + Intergenic
1012865239 6:104610971-104610993 GAGAATGGACTAATACACCCAGG - Intergenic
1013107722 6:107039980-107040002 GAAAAAGGAAAAATACATTCTGG - Exonic
1013121199 6:107142860-107142882 GAAAATGGTAAAATACAGCCAGG + Intergenic
1013253474 6:108359074-108359096 CAAAATAGACAGATACAGGCTGG - Intronic
1013378806 6:109545684-109545706 GAAAATGGACTAATACACCAAGG + Intronic
1014155956 6:118110013-118110035 ACAAATGTACAGATACATCACGG + Intronic
1014821586 6:125994735-125994757 GAAAATGTACATATACACCATGG + Intronic
1014888422 6:126811399-126811421 AAAAATGGACAGAGAGCTCCTGG + Intergenic
1015622812 6:135150321-135150343 GAAAAAAGAAAGATACAACCGGG - Intergenic
1016601978 6:145872816-145872838 GAAAATGTACATATACAACATGG + Intronic
1016861834 6:148728064-148728086 GATGATGGACATATACAACCAGG + Intergenic
1017435756 6:154414279-154414301 GACAATGGACAGCAACATACCGG + Exonic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1018712989 6:166510316-166510338 GAAGATGGAGAGAGACATCTTGG - Exonic
1020378030 7:7509856-7509878 GAAAATGAATAGATTCTTCCTGG - Intronic
1020716907 7:11685997-11686019 GAAAATGTACATATACACCATGG + Intronic
1020808738 7:12825079-12825101 GAAAATGTACATATACACCATGG + Intergenic
1021137707 7:16986080-16986102 GATAATGGTCAGAGTCATCCCGG + Intergenic
1021242788 7:18224988-18225010 TAAAATGGACTGATACTTACAGG + Intronic
1021622557 7:22563112-22563134 GAATATGGAAGGATCCATCCAGG + Intronic
1021665592 7:22975069-22975091 GAAAATGGACTAATACACTCAGG + Intronic
1021706473 7:23372921-23372943 GAACTTGGACAGATAAATGCTGG + Intronic
1022186039 7:27970100-27970122 GAACTTGCACAGATACTTCCAGG - Intronic
1023505421 7:40895090-40895112 GAAAATGTACATATTCATCATGG + Intergenic
1023510839 7:40951996-40952018 GAAAATGGACAAGGATATCCAGG - Intergenic
1023674490 7:42616001-42616023 GAAAATGGAGAGATTCATTTTGG - Intergenic
1024182469 7:46909874-46909896 GAAAATGAAACGATACACCCCGG - Intergenic
1024383377 7:48724369-48724391 GAAAATAGACTAATACAGCCAGG - Intergenic
1025223158 7:57133453-57133475 GAAAATGGACTAATACATGCGGG + Intronic
1025719557 7:63997791-63997813 GAAAATGGACTAATACATTCAGG - Intergenic
1025742083 7:64206029-64206051 GAAAATGGACTAATACATGCAGG - Intronic
1025746539 7:64247963-64247985 GAAAATGGACTAATACATGCAGG - Intronic
1025784256 7:64630084-64630106 GAAAATGTACATATACACCATGG + Intergenic
1026295107 7:69044775-69044797 GAAAATGGACTAATACACCTGGG - Intergenic
1026302752 7:69112078-69112100 CAAATTTGATAGATACATCCTGG + Intergenic
1027770010 7:82394481-82394503 GGAGATGGATAGATACAGCCAGG + Intronic
1028264272 7:88703829-88703851 AAAAATGGACAAATACGGCCAGG - Intergenic
1029162869 7:98565021-98565043 GCAAATGGACTAACACATCCTGG + Intergenic
1029462159 7:100701529-100701551 GAAAATGGGCAAATCCAGCCTGG - Intergenic
1029734923 7:102460345-102460367 AAAAAAGGAAAGACACATCCTGG + Intronic
1030956211 7:115855847-115855869 GAAAATGGACTAATACACCCAGG - Intergenic
1031785378 7:126024351-126024373 GAAAATGGACTAATACAGGCTGG + Intergenic
1031816454 7:126443776-126443798 GAAAATAGAGAAATACATGCAGG + Intronic
1031881222 7:127200670-127200692 GAGATTGGAGTGATACATCCAGG - Intronic
1032043539 7:128582659-128582681 TAAAATGTTCAGATACATCCCGG + Intergenic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033435757 7:141332051-141332073 GAAGATGGACAGTCACAACCAGG - Intronic
1033831582 7:145260448-145260470 GAAAAGAGACAGAAACCTCCAGG - Intergenic
1033976933 7:147114353-147114375 GAAAATTAACAAAGACATCCAGG - Intronic
1034041694 7:147884281-147884303 GAAAATGGGGCGATGCATCCAGG + Intronic
1034083610 7:148303124-148303146 GAAAATGGACTAATACACCATGG + Intronic
1034831513 7:154312127-154312149 CAGAATGAACAGATACCTCCAGG - Intronic
1034882034 7:154770119-154770141 GAAAATAGACAAATACATAAGGG - Intronic
1034943273 7:155245694-155245716 GAGAATGGACTAATACATCAAGG - Intergenic
1036510116 8:9392264-9392286 GAAGCTGGACAGATAGATGCTGG + Intergenic
1038345393 8:26727481-26727503 GAAAATGAGCAGATCCATCAAGG - Intergenic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG + Intergenic
1040449891 8:47534411-47534433 GAAAATGTACATATACACCATGG + Intronic
1040577578 8:48667255-48667277 GAAAATGAACTAATACAGCCAGG - Intergenic
1041499401 8:58523577-58523599 GAAAATGGACAGTAACTTCTGGG - Intergenic
1043346634 8:79304937-79304959 GAAAATTAACAGATAAATTCTGG + Intergenic
1044529506 8:93291361-93291383 GAAAATGGACTAACACACCCGGG - Intergenic
1045358523 8:101411200-101411222 GAAAAGGGGCAGAAGCATCCAGG + Intergenic
1046165760 8:110432614-110432636 GAAAATGGACTAATACAGACTGG + Intergenic
1046454940 8:114446415-114446437 GAAAATGTAAATATACATCATGG + Intergenic
1046838709 8:118832257-118832279 GAAAATGTACATATACACCATGG + Intergenic
1046886157 8:119369510-119369532 GAAAATGTACATATACACCATGG + Intergenic
1047239258 8:123071608-123071630 GAAGAGGAAAAGATACATCCAGG + Intronic
1047519136 8:125580947-125580969 AAAAATGGACAAATACACCTTGG - Intergenic
1048417721 8:134245011-134245033 GAAAATGTACATATACACCATGG - Intergenic
1048761410 8:137799475-137799497 GAAAATGTACATATACACCACGG - Intergenic
1050045708 9:1542675-1542697 GAAAATGTACATATACATCATGG - Intergenic
1050050221 9:1592332-1592354 CTAAATGTAAAGATACATCCCGG + Intergenic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1050946374 9:11525446-11525468 GAAAATTCACAGATATGTCCTGG + Intergenic
1051780867 9:20687438-20687460 GAGAAGGGAAAGATACACCCTGG - Intronic
1051852461 9:21525544-21525566 GAAAATGTACATATACACCATGG - Intergenic
1051907598 9:22114431-22114453 GAAAATGGAGAGGTACATAGAGG + Intergenic
1052078915 9:24179491-24179513 GAAAATGGACTAATACAGGCAGG - Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052636815 9:31117059-31117081 GAAAATGTACATATACACCATGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053459797 9:38259431-38259453 GACAATGGACACAGACACCCTGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053649696 9:40153765-40153787 AAAAATAGACAAATCCATCCAGG + Intergenic
1053756055 9:41310182-41310204 AAAAATAGACAAATCCATCCAGG - Intergenic
1054330207 9:63745528-63745550 AAAAATAGACAAATCCATCCAGG + Intergenic
1054534885 9:66222439-66222461 AAAAATAGACAAATCCATCCAGG - Intergenic
1055631181 9:78225437-78225459 TTAAATGGACAGATACATCATGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058083088 9:100719617-100719639 GAAAACGGACTAATACATTCAGG - Intergenic
1058086301 9:100752157-100752179 GAAAATGGACTAACACATCAAGG - Intergenic
1058516883 9:105785050-105785072 GAAAATGTACATATACACCATGG - Intergenic
1059363523 9:113767102-113767124 GAAAATGGACTAATACAGGCTGG + Intergenic
1059415474 9:114159709-114159731 GAAATTGGCCAGATACATTAGGG - Intronic
1059471306 9:114506361-114506383 CAAAATGGGAAGATACACCCAGG + Intergenic
1059531486 9:115039538-115039560 GGAAATGGTCAGATTCATGCTGG - Intronic
1059831541 9:118101674-118101696 AAAAAAGGACAGATACATCTGGG + Intergenic
1060476985 9:123994337-123994359 GAAAATCAGAAGATACATCCTGG - Intergenic
1060570239 9:124632029-124632051 GAAAATGTACATATACATCATGG - Intronic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1061128841 9:128695112-128695134 GAAAGTAGACAGATACATGTTGG - Exonic
1185702575 X:2242361-2242383 GAGAATGTACAAATACATCACGG + Intronic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1185974285 X:4701681-4701703 GAAAATGGACAAATACACTCTGG + Intergenic
1186233683 X:7484109-7484131 GAAAATGGACTGATACACTAAGG - Intergenic
1186700599 X:12085882-12085904 GAGATTGGACAGATACATGCTGG + Intergenic
1187255059 X:17635013-17635035 GAAGCTGGACAAATAAATCCAGG - Intronic
1187928864 X:24275772-24275794 GAAGAGGGACAGAAACATGCAGG + Intergenic
1188295897 X:28447903-28447925 GAAAATGTACATATACACCATGG + Intergenic
1188828594 X:34868202-34868224 AAAAATGGACTAATACATCCTGG - Intergenic
1189132040 X:38509695-38509717 GAAAATGTACATATACACCATGG + Intronic
1189237603 X:39499762-39499784 GAAAATGTACATATACACCATGG - Intergenic
1189478990 X:41378573-41378595 GAAAATGGTCACATTCAGCCAGG - Intergenic
1189704350 X:43744913-43744935 GAAAAAGGACAGTTACAGGCTGG - Exonic
1191118053 X:56871571-56871593 GAAAGTTAACAGATAAATCCAGG + Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1193371054 X:80697679-80697701 GAAAATGTACATAGACATCATGG - Intronic
1193826491 X:86232971-86232993 GAAAATGTACATATACACCATGG + Intronic
1193920236 X:87415931-87415953 GAAAATGTACATATACATCATGG - Intergenic
1194151931 X:90337076-90337098 GAAAATGGGCAGTAACTTCCAGG + Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1194903198 X:99540749-99540771 GAAAACGGACATACAAATCCAGG + Intergenic
1195844688 X:109213508-109213530 GAGAATGGACAAATACAGTCTGG - Intergenic
1196301471 X:114053654-114053676 GAAAATGGACTAATACACTCAGG - Intergenic
1196480625 X:116142652-116142674 GAAAATGGACTAATACACCCAGG + Intergenic
1196985930 X:121270914-121270936 GAAAATGTACACATACACCGTGG + Intergenic
1197275900 X:124478663-124478685 GAAAATGGAAATGTACATCTAGG - Intronic
1197440787 X:126486842-126486864 AAAGATGGAGAGATACATACTGG - Intergenic
1199921417 X:152408573-152408595 GAAAATGGAAAGATAGTTCACGG + Intronic
1200498291 Y:3913842-3913864 GAAAATGGGCAGTAACTTCCAGG + Intergenic
1201183620 Y:11375155-11375177 GAAAATGGACAAAGATATTCAGG + Intergenic
1201704609 Y:16922362-16922384 GAAAATGTACATATACACCCTGG - Intergenic