ID: 1101071900

View in Genome Browser
Species Human (GRCh38)
Location 12:101084473-101084495
Sequence ATGTCATTTTAGAACAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101071900 Original CRISPR ATGTCATTTTAGAACAGTAA AGG Intronic
900468714 1:2839749-2839771 ACATCATTTTACAAAAGTAATGG - Intergenic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
904102041 1:28039162-28039184 CTATTATTTTAGATCAGTAATGG - Intronic
904516911 1:31063139-31063161 ATTTCCTTTTAGAACAGAATGGG - Intronic
904827586 1:33284176-33284198 ATGTCTTTTTATAACCTTAAAGG + Intronic
904984009 1:34529772-34529794 TTGCCATTTTAGAACTATAAAGG - Intergenic
905697744 1:39987963-39987985 ATTTCATTTCAGGACAGGAAAGG - Intergenic
906001454 1:42429790-42429812 GGGCCATTTTACAACAGTAATGG + Intergenic
906579545 1:46925193-46925215 AGGTCATTTTAGCACTGTCAGGG + Intergenic
908588735 1:65605044-65605066 ATGGAATATCAGAACAGTAAAGG - Exonic
909330730 1:74406849-74406871 ATGTCATTTTGGAACAGCAGCGG - Intronic
909670598 1:78184114-78184136 TTCCCATTTTAGGACAGTAAAGG + Intergenic
909761031 1:79287512-79287534 ACGTCATTTTATAACCGAAACGG - Intergenic
909982079 1:82115186-82115208 ATGTCATTATAAAACAGTTTTGG - Intergenic
910327194 1:86023732-86023754 ATGTCATCTTAGAAGACAAAGGG + Intronic
910414786 1:86986245-86986267 ATGTAAATTTATAACAGAAAAGG + Intronic
910968301 1:92829891-92829913 TTGTCATTTTTGAAGAGTACAGG + Intergenic
911058913 1:93731207-93731229 ATGGGATTCTGGAACAGTAAAGG + Intronic
911278867 1:95898278-95898300 ATGTGATTTTTGAACTTTAAGGG + Intergenic
912001410 1:104839586-104839608 TTTTCTTTTTAGCACAGTAAAGG - Intergenic
912234216 1:107831350-107831372 GTGTCATTTCAGAAAAGAAAAGG + Intronic
912238408 1:107878443-107878465 ATGTCATTAAAGAAGAATAAAGG - Intronic
912787375 1:112618015-112618037 ATGTCATCTCTGAACAGGAAAGG + Intronic
912976788 1:114338307-114338329 ATATCATTTTAGCACATTACTGG - Intergenic
913070599 1:115294995-115295017 ATGTCATTCTAGAACTTTATTGG - Intronic
915373019 1:155367728-155367750 ATGTAATTTTATCACAATAATGG - Intronic
915888134 1:159745211-159745233 ATGTCATTCTGGAACAGAAAAGG + Intergenic
917298511 1:173547799-173547821 ATGACATTTTAAAACATAAAGGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919042967 1:192415298-192415320 ATGTTATTATAGAACACAAAGGG + Intergenic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
919956595 1:202423433-202423455 ATGAACTTTTAGAACAGTCAGGG + Intronic
921012271 1:211153947-211153969 ATGTCATTATATAATAATAAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
924102090 1:240614707-240614729 ATAACATTTTCAAACAGTAAAGG + Intergenic
924151155 1:241131242-241131264 ATGACAATTTAGAAATGTAAGGG + Intronic
924820279 1:247482995-247483017 ATGACATTTTAGAAAACTATTGG + Intergenic
1062943455 10:1441753-1441775 ATGTCAATTTTGAAAATTAAAGG - Intronic
1063192129 10:3705451-3705473 ATGTTATCTTAGAATACTAAAGG + Intergenic
1063289302 10:4727031-4727053 ATGTTAATTTTAAACAGTAAAGG - Intergenic
1063648922 10:7913993-7914015 AAGTCATTTTTGAACAATCATGG - Intronic
1064241979 10:13638901-13638923 ATGTTATATGAGAACAGTATTGG + Intronic
1064290766 10:14032128-14032150 ATTTTATTTGAGGACAGTAAGGG - Intronic
1064535993 10:16358500-16358522 ATGTCATTTGTAAACAGTCATGG - Intergenic
1064604513 10:17024850-17024872 ATGTCAATCTAAAACAGAAAGGG - Intronic
1064707606 10:18089392-18089414 ATGGTATTTTAAAACAGTATTGG + Intergenic
1065365491 10:24932020-24932042 ATGTCATTATATTACATTAATGG + Intronic
1065426688 10:25613015-25613037 ATGTCATTACATAATAGTAAAGG - Intergenic
1065552391 10:26881988-26882010 ATGTCATTTTAAAAGATAAATGG + Intergenic
1066580890 10:36880802-36880824 ATGTCATTTTAAAAGATAAATGG + Intergenic
1068025515 10:51638263-51638285 ATCTCATCTTAAAATAGTAATGG + Intronic
1068634384 10:59332371-59332393 ATTTCATTTTAAAACATTTAAGG + Intronic
1069277112 10:66606176-66606198 AGGACATTATATAACAGTAAAGG + Intronic
1069626356 10:69870101-69870123 CTGTAAAATTAGAACAGTAATGG + Intronic
1071142886 10:82532988-82533010 ATGTCATTTTATACCTGTTAGGG - Intronic
1071383057 10:85089728-85089750 ATGACATTTTATAATAATAAAGG + Intergenic
1071443690 10:85726913-85726935 ATGTGAATTTATCACAGTAAAGG + Intronic
1072059082 10:91791083-91791105 AGGTCATTTTATAACAATAAAGG + Intergenic
1072278196 10:93842932-93842954 TAGGCATTTTAGAACTGTAAGGG + Intergenic
1073508975 10:104030733-104030755 AAGTCTTTTTAGAAGAGTAGTGG + Intergenic
1073708348 10:106012144-106012166 AGGTCATTATACAACAATAAAGG - Intergenic
1073935363 10:108625035-108625057 GTGACATTATAGAACAGCAAAGG + Intergenic
1074491185 10:113941056-113941078 ATGTGATTTTATAACATAAATGG - Intergenic
1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG + Intergenic
1075224041 10:120609298-120609320 ATGTCATTTTAGAAAATGTAGGG + Intergenic
1077241694 11:1513950-1513972 CTGACATTTCAGAACACTAAGGG + Intergenic
1078086420 11:8235661-8235683 ATGGCATTTTTGAAGAGTACAGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080728582 11:34922663-34922685 CTATCATTTTAGAACAATTAAGG + Intronic
1081161381 11:39754329-39754351 GTCTCATGATAGAACAGTAATGG - Intergenic
1081267303 11:41040733-41040755 ATGACATTTTAGAAAATCAAAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082715531 11:56607053-56607075 AAGTCATATTAGAAGTGTAAGGG - Intergenic
1083244745 11:61417991-61418013 ATGTAATTTTACAACTGTATTGG - Intronic
1086035841 11:82413365-82413387 AAGTCATTATATAATAGTAAAGG + Intergenic
1086171688 11:83843443-83843465 AATTTATTTCAGAACAGTAAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088196852 11:107283738-107283760 ATGACATTTTTGAAGAGTAAGGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090625607 11:128605776-128605798 ATATCATTTAACAACACTAAGGG + Intergenic
1092795269 12:12104528-12104550 AAGTCATTTAATAATAGTAAAGG + Intronic
1093271737 12:17070965-17070987 ATATCATTTTCCAACAGTATAGG + Intergenic
1093780420 12:23129444-23129466 AAATTATTTTACAACAGTAAAGG + Intergenic
1094096805 12:26714566-26714588 ATTTCATTTTAGAATATTAAAGG + Intronic
1094482462 12:30895728-30895750 ATGTCATTTTAGTAAATTACAGG + Intergenic
1095691192 12:45091082-45091104 ATGGCATTTTAAAAAAATAATGG + Intergenic
1096023604 12:48342554-48342576 AGGCCATTTTAGAATATTAAAGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097374646 12:58826929-58826951 ATGTCATTTTTTTACAGAAATGG + Intergenic
1097572185 12:61347727-61347749 ATTTCATTTTAGAACAATTCAGG - Intergenic
1097820413 12:64123029-64123051 ATGTCATTAAAGAATATTAATGG + Intronic
1098403488 12:70098922-70098944 ATGAGATCTTAGAACAGAAAAGG - Intergenic
1098710489 12:73752412-73752434 ATGTCTTTATACTACAGTAATGG - Intergenic
1099755234 12:86837849-86837871 ATGATATCTTAGAACAGCAAAGG - Intronic
1099882477 12:88483325-88483347 AGGTCATTATAGAATAATAAGGG + Intergenic
1100121879 12:91377828-91377850 ATATTATTTTAGCAAAGTAAGGG - Intergenic
1100776629 12:97982041-97982063 ATGTCACTTTTGAACAGAAATGG + Intergenic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1103493070 12:121338287-121338309 ATGTCATTATAGAAAATTATTGG + Intronic
1104365409 12:128172297-128172319 ATGACATTTTAGAAGAATAGAGG + Intergenic
1104689648 12:130815923-130815945 ACTTCATTTTAGAATAGTAAAGG + Intronic
1105951663 13:25234720-25234742 ACAACATTTTAGAACTGTAAAGG + Intergenic
1106940690 13:34775669-34775691 AAGTCATGTTAGGGCAGTAAAGG + Intergenic
1107891356 13:44917516-44917538 ATGCAATTTTAGAACATTATAGG - Intergenic
1108280859 13:48860184-48860206 ATTTCATTTTAGAATGGTAAAGG + Intergenic
1108696792 13:52909366-52909388 ATGTCATAATAGCTCAGTAAAGG - Intergenic
1108792542 13:53989199-53989221 ATCCCATTTTAGTATAGTAAAGG - Intergenic
1108889530 13:55236598-55236620 ATTTCATTTTAAAACTGTCAGGG - Intergenic
1108980432 13:56504949-56504971 ATGTCATTTCACTACAATAATGG - Intergenic
1109649187 13:65303775-65303797 ATGTAATTTTAAAACACTAAGGG + Intergenic
1109692803 13:65915267-65915289 ATGTCATCTTTGAATAGGAAGGG - Intergenic
1111783601 13:92759162-92759184 ATATAATTTTAAATCAGTAAGGG + Intronic
1112569809 13:100583700-100583722 TTGTCATTTAAGAATAGTAGTGG - Intronic
1112751504 13:102588438-102588460 ATGGCATTTGAGAACTGTCACGG + Intergenic
1113049284 13:106190671-106190693 TTGTCTCTTTAGAACAGTGATGG - Intergenic
1113168479 13:107471347-107471369 ATGTAATTTTAGAACTGTCTAGG + Intronic
1114800217 14:25765928-25765950 TTGTCTTTTTTTAACAGTAATGG + Intergenic
1115268241 14:31524268-31524290 ATAGCATTTTAGAACAGAAAAGG + Intronic
1115951333 14:38725724-38725746 ATGACATTTTATAACAGAAGTGG - Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116991589 14:51283104-51283126 AATTCATTTTAGAAGAATAATGG - Intergenic
1117053830 14:51889854-51889876 ATGTTATTTTTAAAAAGTAAAGG - Intronic
1117288179 14:54307627-54307649 ATATATTTTTAGAACATTAAAGG + Intergenic
1117651394 14:57909507-57909529 ATGACATTTTAGAAAAGAAAAGG - Intronic
1117858084 14:60056521-60056543 ATGACATTATAGTACTGTAAGGG - Intronic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1118454772 14:65934457-65934479 ATGTCATTTTAGGACAACATCGG + Intergenic
1118458907 14:65970435-65970457 ATGTCAGTTGTGAACAATAATGG - Intronic
1119241764 14:73066155-73066177 ATCTCTTTTTAAAACAGAAAGGG - Intronic
1120206590 14:81593784-81593806 GTGTCATTTCAGATCAGTGAGGG - Intergenic
1121699871 14:95944459-95944481 ATGTCCTTTTAGCACAGCTAAGG + Intergenic
1202927971 14_KI270725v1_random:9901-9923 ATGTCATTTTCGTACAGTCTTGG + Intergenic
1124012066 15:25846687-25846709 ATGTCATTTTAGATCACTGAAGG - Intronic
1124438904 15:29673088-29673110 ATGGCATTTGTGAACCGTAATGG + Intergenic
1125362531 15:38879255-38879277 ATGTAATTTGAGGAAAGTAAAGG + Intergenic
1126007946 15:44276583-44276605 ATGGAATTTTAGAACAGGAAGGG - Intergenic
1126692264 15:51296853-51296875 TTGTCTTTTTAAAACTGTAAAGG - Intronic
1126897161 15:53271491-53271513 ACATCATTGTAGAACAGTAGAGG + Intergenic
1127429707 15:58891828-58891850 ATTTCATTTCAGGAGAGTAAAGG + Intronic
1129054353 15:72808263-72808285 TTGTTATTTTAAAACATTAAAGG - Intergenic
1129247839 15:74290686-74290708 ATGACATATGAGAACTGTAATGG + Intronic
1130241477 15:82197141-82197163 TTGTCATTTTAGAAAATTGAAGG + Intronic
1131484892 15:92812009-92812031 ATATCAATTTAGAAGAGTGAGGG - Intergenic
1132177552 15:99727431-99727453 ATTCCATTTGAGAAAAGTAAAGG + Exonic
1134437941 16:14279084-14279106 AGGTCATCTTAGGAAAGTAATGG + Intergenic
1135358914 16:21794451-21794473 AGGTCATTTTATTACAGTAATGG - Intergenic
1135457470 16:22610887-22610909 AGGTCATTTTATTACAGTAATGG - Intergenic
1136739735 16:32506555-32506577 CTGTTTTTTTAGAATAGTAAAGG - Intergenic
1137346209 16:47663539-47663561 ATGTTAGTTCAGAACATTAATGG + Intronic
1137552581 16:49450188-49450210 AGGTCATTTTATAAAACTAAAGG - Intergenic
1141650527 16:85390529-85390551 AAGACATTTCAGAACAATAAAGG + Intergenic
1203013180 16_KI270728v1_random:320782-320804 CTGTTTTTTTAGAATAGTAAAGG + Intergenic
1203031515 16_KI270728v1_random:593941-593963 CTGTTTTTTTAGAATAGTAAAGG + Intergenic
1203040206 16_KI270728v1_random:740490-740512 CTGTTTTTTTAGAATAGTAAAGG - Intergenic
1142751554 17:1991620-1991642 ATGTCTTTTTAGAACCCAAATGG + Intronic
1143979217 17:10853847-10853869 AGGTCATTTTAGAACTTTCAAGG - Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145107174 17:20127971-20127993 ATTTCATTTTAGGATATTAAAGG - Intronic
1149228027 17:54498464-54498486 ATGTCATGGTGGAACAGGAAAGG - Intergenic
1149673309 17:58434879-58434901 ATGTGATTATTGAAGAGTAAGGG + Intronic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1151087324 17:71395343-71395365 ATTACATTTTAAAACAGAAATGG + Intergenic
1153050244 18:896011-896033 ATGTAATTTTATAATTGTAAAGG - Intergenic
1153422418 18:4922326-4922348 ATGTAATTTTAAATCAGGAAGGG + Intergenic
1153458532 18:5306234-5306256 ATAACATTTTAGAACTGGAAAGG - Intergenic
1153475655 18:5495806-5495828 TTGGAATTTTAGAACAGAAAGGG - Intronic
1155901018 18:31390444-31390466 AAGTACTTTTAAAACAGTAAAGG + Intronic
1156192167 18:34732445-34732467 TTCTCATTTTAGATAAGTAAAGG - Intronic
1156274092 18:35565360-35565382 ATGTCATATTAGTAGAGTAAGGG + Intergenic
1156816254 18:41315158-41315180 ACGTGACTTTTGAACAGTAAGGG - Intergenic
1158901237 18:61963656-61963678 ATGTTATTTTGGAAATGTAAAGG + Intergenic
1162067321 19:8133893-8133915 ATGTCAGTTTTAAACAATAAAGG + Intronic
1162225524 19:9218535-9218557 ATGCTATGTTAAAACAGTAAGGG + Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165087641 19:33362185-33362207 ATGATATTTTTGAACAGTACTGG + Intergenic
1165558895 19:36661324-36661346 AAGTCATTTTAGAACACTTCAGG - Intronic
1166985014 19:46654598-46654620 ATCTCATTTTAGAAAAGAGAGGG + Intronic
926384274 2:12320845-12320867 ATGGCATTTGAGTACATTAAAGG + Intergenic
926630315 2:15129630-15129652 AGGGCATTTTAGAAAAGGAAGGG - Intergenic
927407548 2:22788877-22788899 ATTTCATTTTAGACTTGTAAAGG - Intergenic
927624189 2:24696094-24696116 TTGTCATTTAAGAACAGTTTGGG - Intronic
928263457 2:29788662-29788684 CTGTCATAATAGAACAGAAAGGG + Intronic
928862741 2:35878139-35878161 ATTTCATTTTAGGATAATAATGG - Intergenic
929864135 2:45703685-45703707 ATGTCTATTTAGGACAATAAAGG - Intronic
930525689 2:52526361-52526383 ATGAAATTTTAGAATAGCAAAGG - Intergenic
930695581 2:54408234-54408256 ATGTCATTTTGGAATAGTACAGG - Intergenic
931480233 2:62632344-62632366 ATGTTATTTTAAAAGATTAAGGG - Intergenic
932022140 2:68098247-68098269 ATGACATTTTAGCATAGGAAGGG + Intronic
932480953 2:72038848-72038870 ATTTCATTTCAGGATAGTAAAGG - Intergenic
933882767 2:86687554-86687576 ATGTCATATTATAACATTAGTGG + Intronic
934984725 2:98876228-98876250 AGGTGATTTTAGATCTGTAAAGG - Intronic
935647389 2:105351034-105351056 ATGACAGTTTTGAAGAGTAATGG + Intergenic
936765778 2:115847268-115847290 ATGGCATCTTTGAACAGTGAGGG - Intergenic
936814890 2:116447898-116447920 ATGTCATTTTAGAAAGAAAAGGG + Intergenic
936832760 2:116668988-116669010 ATGTCATTTGCAAACAGGAATGG - Intergenic
936992919 2:118385398-118385420 ATGTCAATTTATAACAGTGGAGG + Intergenic
937614376 2:123903811-123903833 ATTTCATTTCAAAATAGTAAAGG - Intergenic
937899465 2:127006763-127006785 ATTTCATTTCAGCACAGTAATGG + Intergenic
938623996 2:133088646-133088668 ATTTCATTTCAGGATAGTAAAGG - Intronic
939817915 2:146919428-146919450 AATTCATTCTAGAACAATAAGGG - Intergenic
940517848 2:154703416-154703438 ATGTGATGTTAGAAGAGGAAAGG - Intronic
940808858 2:158220101-158220123 ATGTAATTTTAGATCTGGAAAGG - Intronic
940941521 2:159566824-159566846 ATCTTATTTTAGAACAGTAAAGG - Intronic
940960825 2:159784053-159784075 ATGTCCCTTTAGAGCAGTAGAGG - Intronic
943287378 2:186019732-186019754 TTGTCAATTTACAACAGCAAGGG - Intergenic
943423003 2:187692486-187692508 CTGACATTATAGTACAGTAATGG + Intergenic
944641935 2:201736298-201736320 CTGTCATTTTAAAAAAATAAAGG + Intronic
945474562 2:210265749-210265771 ATGTATTTTTAAAACAGTAGAGG + Intergenic
945723828 2:213451190-213451212 ATTTCATTTCAGGATAGTAAAGG + Intronic
946607075 2:221416968-221416990 AGCTCATTTTAGAACATTTAGGG + Intergenic
948782497 2:240330435-240330457 ATCTCATTTTGGAAAAGTAGGGG - Intergenic
1169579794 20:7007690-7007712 ATGTCATTTGTAAACAGGAATGG + Intergenic
1169610236 20:7371365-7371387 ATTTCATTTTAGAGTAGTAAAGG + Intergenic
1172323526 20:34016707-34016729 ATGAAATTTTAGAACTGAAAGGG - Intronic
1173456019 20:43201936-43201958 ATTTCATTTTAAAACATTAACGG - Intergenic
1173891968 20:46519705-46519727 ATGGCATTTTAAAACTGTCATGG - Intergenic
1174246102 20:49181948-49181970 ATGTGGGTTTATAACAGTAATGG - Intronic
1175759024 20:61548763-61548785 ATTTCTTTTTAGAAGAATAATGG - Intronic
1176981796 21:15390483-15390505 GTGTCATTTTCGAACAGTATGGG + Intergenic
1177045393 21:16162413-16162435 ATTTCATATTATAACATTAAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177701837 21:24648940-24648962 ATGTCATTTACTAACATTAAGGG - Intergenic
1178729349 21:35085452-35085474 AGGACAGTTTAGACCAGTAATGG + Intronic
1181434612 22:22903261-22903283 ATGTCATTCCAGGACAGTAATGG - Intergenic
1181709852 22:24676866-24676888 ATTTCATTTCAGGATAGTAAAGG + Intergenic
1182450800 22:30419674-30419696 ATTTCACTTCAGAATAGTAAAGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183770158 22:39917645-39917667 ATTACATTTTAGAACAGTTAGGG - Intronic
1184964139 22:47955098-47955120 AAGTCATTTAAGAACATTCAGGG + Intergenic
951044362 3:18021903-18021925 ATGGCATTATGGAACAGAAAGGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951645201 3:24882465-24882487 ATATCATTTTATATCAGGAATGG + Intergenic
951714370 3:25623434-25623456 CCGTCATTTTAGAAAAGTAATGG - Intronic
951870811 3:27360082-27360104 ATGTCCTTTTTAAACTGTAATGG - Intronic
952168164 3:30774729-30774751 GTTTCATTTTAGGAGAGTAAAGG + Intronic
953012845 3:39044104-39044126 ATGTCATTATATAATAATAAAGG + Intergenic
953157633 3:40389015-40389037 ATATGATTTTAGGATAGTAAGGG + Intronic
953314393 3:41912733-41912755 TTGTATATTTAGAACAGTAATGG + Intronic
955185976 3:56715543-56715565 ATCTGATTTTAAAATAGTAATGG - Intergenic
955258420 3:57359223-57359245 CTTTGATTTTAGAACACTAATGG - Intronic
956635041 3:71355555-71355577 ATGACATCTGAGAAGAGTAATGG + Intronic
956761760 3:72449913-72449935 ATGTCATCTTGGACCAGTATGGG + Intergenic
956984744 3:74685804-74685826 ATGACATTTTTGAAGAGTACAGG + Intergenic
957121898 3:76104370-76104392 ATGTTATTTTAAAACTATAAAGG + Intronic
957167792 3:76697469-76697491 ATTTCATTTTTGTACAGAAAGGG - Intronic
957496384 3:80996452-80996474 ATGTCAATTTAAAATACTAATGG - Intergenic
957633229 3:82745377-82745399 AGGTCATTACATAACAGTAAAGG + Intergenic
957714615 3:83909665-83909687 AAGTCATTTGAGAACAGAACAGG + Intergenic
957724799 3:84050001-84050023 ATGTCATTTTAGAAAAGCGAAGG - Intergenic
957726104 3:84069564-84069586 ATGTCATTTATGAACATTAGAGG + Intergenic
958193815 3:90217451-90217473 ATTTCGTTATAGAATAGTAAAGG + Intergenic
958417170 3:93888500-93888522 ATTTCATTATAGAATAGTAAAGG + Intronic
959281022 3:104340470-104340492 ATGTCATTCTAAAACATGAATGG - Intergenic
959752251 3:109852178-109852200 ATGTCATTATATAATGGTAAAGG + Intergenic
960463517 3:117966892-117966914 ATTTCAACTTAGAACAATAAAGG + Intergenic
961055028 3:123780477-123780499 ATGTTATGTTGGAACAGGAAGGG + Intronic
963039178 3:141056195-141056217 ATGACATTTCACAACATTAAAGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963692169 3:148518715-148518737 CTGTCCTGTTAGAACAGAAAGGG + Intergenic
964190160 3:153992198-153992220 ATGCCATTTTAAAAAGGTAACGG + Intergenic
964228308 3:154432640-154432662 ATTTAATTTTAGAACTGGAAAGG - Intergenic
964389938 3:156186392-156186414 ATGTCAGCTTTGAACAGGAAGGG - Intronic
964928519 3:161986209-161986231 TTGTGATGTCAGAACAGTAATGG + Intergenic
965004345 3:162999759-162999781 ATGTCATATTAGTACAGGTAGGG - Intergenic
965391189 3:168106383-168106405 AGGTCATTTCCTAACAGTAAAGG + Intergenic
965637057 3:170793131-170793153 TTTTCATTTTAGAACAGTTGTGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966728121 3:183126952-183126974 ATCTCTTTTTAGAACTCTAAAGG - Intronic
966967214 3:185005831-185005853 ATGTCATTGGCGAACAGTGATGG + Intronic
967164597 3:186769223-186769245 ATGTCATTTTGTTACAGGAAGGG + Intergenic
968081927 3:195852466-195852488 ATTTCATTTCAGTAAAGTAAAGG + Intergenic
968743827 4:2347188-2347210 AAGTCATTTTATAATAATAAAGG + Intronic
970956712 4:21820629-21820651 ATGTAATTTTAGAACTGGAAGGG + Intronic
971486343 4:27164413-27164435 ATGTCATCTTAGAACACACAAGG + Intergenic
972151815 4:36100785-36100807 ATTTATTTTTAGAACACTAATGG + Intronic
972316585 4:37932575-37932597 GTGTCATTTCAGAGCAGGAATGG + Intronic
972678748 4:41285499-41285521 ATTTTATTTTAGGAGAGTAAAGG - Intergenic
973239024 4:47937416-47937438 AAGTCAGTGTAGACCAGTAAAGG + Exonic
973810884 4:54568841-54568863 ATTTCATTTCAAGACAGTAAAGG - Intergenic
974162648 4:58159910-58159932 ATGTTGTTTTAAAACAGTAAAGG + Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974294088 4:59971976-59971998 ATGGCATTTCAGAACAATGAAGG + Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
975118091 4:70701403-70701425 TTGTCACTTTAAAACAGTATAGG + Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
976294058 4:83452041-83452063 GTGTCATTTTAGACCAAGAAGGG - Intronic
976339687 4:83933341-83933363 AGGATATTTAAGAACAGTAAAGG - Intergenic
977072722 4:92412229-92412251 ATGTCAATATGGAACTGTAATGG - Intronic
977494894 4:97762606-97762628 ATCTTATTTTACAACAGCAATGG + Intronic
977982338 4:103339123-103339145 ATACCATTTTAGAATACTAAAGG - Intergenic
978327117 4:107571899-107571921 ATATTATTTTAGAAAATTAAAGG - Intergenic
980212264 4:129804777-129804799 TTGTGATTGTAGAACTGTAAAGG + Intergenic
980544604 4:134243118-134243140 AAGTCATTTCATAACAATAAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981291289 4:143079108-143079130 ATGACATTTTTGAAGAGTATTGG - Intergenic
982332863 4:154201087-154201109 TTGACATTTTAAAACAGTACTGG - Intergenic
982876470 4:160657506-160657528 ATGTCACTTCAGAAGAATAAAGG + Intergenic
982931274 4:161410176-161410198 ATGTATTTTTAGAATAGTTAAGG - Intronic
982953615 4:161733686-161733708 CTGACATTTTATATCAGTAATGG + Intronic
983600845 4:169525433-169525455 ACGTTATTTTAGAATAATAAAGG + Intronic
984124778 4:175794609-175794631 ATGTCATTATAGAAATGTACTGG + Intronic
984577294 4:181465928-181465950 AAGTCATTTTAGAAGGGAAAAGG - Intergenic
984683803 4:182643044-182643066 ATGACAGTTTAGACCAGTAGGGG + Intronic
986624825 5:9713970-9713992 ATGTCATTATATAAATGTAATGG + Intergenic
987157280 5:15102223-15102245 TTGTCTTTTTAAAACAGAAAAGG - Intergenic
987175018 5:15298898-15298920 ATGTCATTTTAAATTATTAATGG - Intergenic
987627186 5:20417692-20417714 ATGTGATTTTGGAAGAGTAAAGG - Intronic
987822991 5:22990693-22990715 CTGTCCTGTTAGAACAGAAAGGG + Intergenic
987848491 5:23318890-23318912 ATGGGATTTTAGAAAAGAAAGGG - Intergenic
988073095 5:26320064-26320086 ATGTCATTTCAGAGCAGAACAGG - Intergenic
988164525 5:27568137-27568159 ATGTCATTTTATAACACAAATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989611089 5:43292379-43292401 ATGTCAGTAAAGAAGAGTAAGGG - Intronic
990270642 5:54134499-54134521 ATGTAATTATAAAACTGTAATGG - Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991287587 5:64995784-64995806 ATATAAGTGTAGAACAGTAAAGG - Intronic
991468200 5:66937105-66937127 ATGTTATTTTAAAACACTTACGG + Intronic
992235242 5:74702396-74702418 ATGACATTTTTGAAGAGTATAGG + Intronic
993740896 5:91538068-91538090 CTGTCATTTTAAATCTGTAAAGG + Intergenic
995124497 5:108566793-108566815 ATTTCATTTCAGGAAAGTAAGGG - Intergenic
996562371 5:124844618-124844640 ATGGAATTTTAGAACTGGAATGG + Intergenic
997018807 5:129971866-129971888 ATCTCACTTTACAACAGTAAGGG - Intronic
998682618 5:144487200-144487222 ATGTCATTCTGGAACAGTGGAGG - Intergenic
999355001 5:150918612-150918634 ATTTCATTTTAAATCAGTTATGG + Intergenic
999389414 5:151179466-151179488 AGGCCATTTAAGAACAGTATAGG + Intergenic
999910221 5:156189419-156189441 ATGGAATTTTAGAACTGGAAGGG + Intronic
1001068177 5:168557090-168557112 ATGTGATTTTAGAAATGTTAAGG - Exonic
1002452401 5:179326383-179326405 ATTCCATTTCAGAACAGTAACGG + Intronic
1002811716 6:637612-637634 ATGTAATTTTCAAACAGTGAAGG - Intronic
1002986468 6:2193634-2193656 ATTTCATTTTAGGATTGTAAAGG + Intronic
1003402349 6:5800861-5800883 ATTGCATGTTAGAACTGTAAAGG - Intergenic
1004061421 6:12201844-12201866 ATGTCTTTTGAAAACAGTATAGG + Intergenic
1005597820 6:27396124-27396146 ATTTTATTTCAGAATAGTAAAGG - Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007049492 6:38812438-38812460 AAGACATTTTAGACAAGTAAGGG - Intronic
1008202502 6:48608576-48608598 ATGGCATTTTGGAACAATGAAGG - Intergenic
1008581399 6:52910943-52910965 GTGGCATTTTTGAAGAGTAATGG + Intergenic
1009388642 6:63118398-63118420 ATGGCATTTTAGAACTTGAAAGG - Intergenic
1009584625 6:65582990-65583012 ATTTCATTTCATCACAGTAATGG + Intronic
1009925227 6:70112745-70112767 TTGTCATTTTGGAACAGAAGTGG - Intronic
1010047658 6:71465746-71465768 ATTTCATTTTAGTAGAGTACTGG - Intergenic
1010065743 6:71680719-71680741 ATGTCATCTTAAAATTGTAATGG + Intergenic
1011336319 6:86264984-86265006 AGGTAATTTTGCAACAGTAAAGG + Intergenic
1011369857 6:86624785-86624807 ATGTAATTCTGGAACAGAAAAGG - Intergenic
1012163423 6:95917265-95917287 AGTTCATTTTAGAAAAGAAAGGG + Intergenic
1012178809 6:96124702-96124724 ATGTCATTTAAAAAAAGAAAAGG - Intronic
1012257639 6:97052021-97052043 ATTTCATTTTAGGATAGTAAAGG - Intronic
1012773620 6:103475677-103475699 AAGTTATTTTAGGTCAGTAAAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014350828 6:120343164-120343186 ATGTAATTTTGAAACATTAAAGG + Intergenic
1014406625 6:121060496-121060518 ATGAGATTATAAAACAGTAAGGG - Intergenic
1015735622 6:136396894-136396916 ATTTCAGTTTAGAAAATTAAAGG + Intronic
1016178198 6:141107112-141107134 ATCTCATTTTAAAACAGTAATGG + Intergenic
1017059937 6:150473258-150473280 ATATCATTTTATACCAGTCAGGG - Intergenic
1017608840 6:156162811-156162833 ATATCATTTTGGAACTGTACCGG + Intergenic
1018378563 6:163236524-163236546 ATCTCATTTTAGAACTCTGATGG + Intronic
1018578230 6:165282932-165282954 ATTGCATTTTAAAACAGTAATGG - Intronic
1019632031 7:2054592-2054614 ATGTCAGTCTAGAAAGGTAATGG + Intronic
1019910585 7:4098280-4098302 ATGTCATTTTCGAAAAATAGAGG + Intronic
1020395197 7:7707767-7707789 ATGACATTTCTGAACAGAAAAGG - Intronic
1020530689 7:9330373-9330395 ATGTCATTTTATACCTTTAAAGG - Intergenic
1020980099 7:15056471-15056493 ATGTCATTTCAGAAGACTATAGG - Intergenic
1021327006 7:19284781-19284803 ATGTCTTTTTAGAAGTTTAAAGG + Intergenic
1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG + Intronic
1021632959 7:22664883-22664905 AGGTCATTTTACACCAGTCACGG + Intergenic
1023954557 7:44873855-44873877 CTGTTAGTTTAGAACAGTCAGGG + Intergenic
1024490793 7:49983562-49983584 ATGTAATTTTAGAACAAATAAGG + Intronic
1024622392 7:51173094-51173116 ATGCAATTTTAAAACAGTAGTGG + Intronic
1025527237 7:61830216-61830238 CTGTTTTTTTAGAATAGTAAAGG - Intergenic
1027771520 7:82412907-82412929 TTGTCATTTGAGAAAAATAACGG - Intronic
1028186890 7:87797089-87797111 ATGTAATTTTGTGACAGTAACGG + Intronic
1028321697 7:89467184-89467206 ATTTCATTTTAGAAAAATCATGG - Intergenic
1028357106 7:89923880-89923902 ATCACATTTTGGAAGAGTAAAGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030085890 7:105815352-105815374 ATCTCAATGTAGAACAGTTAGGG - Intronic
1030158517 7:106482558-106482580 ATGGCATTTTAAAACACCAAAGG - Intergenic
1030423606 7:109342030-109342052 ATGTAATGTTAGAATAGTCATGG + Intergenic
1031277939 7:119755086-119755108 ATGTCCTTTCAAAACAGTATAGG + Intergenic
1033106005 7:138524098-138524120 ATGTCATATTAAAAGAATAAAGG + Intronic
1033529848 7:142250844-142250866 ATGTGATGCTAGGACAGTAACGG - Intergenic
1033778414 7:144640579-144640601 ACGTCTTTTTAGAACAGCACAGG + Intronic
1033822237 7:145148490-145148512 ATGTGGTTCTAGAAAAGTAAGGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1035117495 7:156536907-156536929 ATGACATTTTAAAAAAGAAAGGG - Intergenic
1035117773 7:156539068-156539090 ATGACATTTTAAAAAAGAAAGGG - Intergenic
1035295065 7:157862533-157862555 CTCTCTTTTTAGAACAGAAATGG + Intronic
1037446603 8:18971695-18971717 ATAGTATTTTAGAACAGGAAGGG - Intronic
1038518938 8:28212607-28212629 ATGTGATTTTCCAACAGTAGGGG + Intergenic
1039786059 8:40835032-40835054 ATGTTTTTGTAGAACACTAATGG + Intronic
1040544727 8:48389909-48389931 ATCTCTTTTTAAAACAGTACTGG + Intergenic
1040711891 8:50198632-50198654 ATGACATTTTAAAAAAGAAATGG - Intronic
1040884998 8:52252476-52252498 ATGTTATAGTAGAACACTAATGG + Intronic
1043027213 8:75084850-75084872 ATGTTGTTTTAGCACAGTGATGG + Intergenic
1043554206 8:81411388-81411410 AGGTCACTATATAACAGTAAAGG + Intergenic
1044269607 8:90226214-90226236 ATTTCTTTTTGGAACATTAATGG + Intergenic
1044336675 8:90992147-90992169 ATGTTATTTTAGAAGAAAAAAGG - Intergenic
1045130097 8:99141499-99141521 ATGTAATTCTAGAAATGTAATGG + Intronic
1045390035 8:101706024-101706046 ATGTCTGTTTAGGAGAGTAAAGG + Intronic
1045783343 8:105894237-105894259 ATATCATTCTAGAAAAATAAGGG + Intergenic
1046336261 8:112792227-112792249 ATGGAATTTTATAATAGTAAAGG - Intronic
1046992991 8:120481780-120481802 ATGTAATTTTACATCATTAAAGG + Intronic
1047752955 8:127896301-127896323 AAGTCAGTTTAGAACAGTATTGG + Intergenic
1047916168 8:129586048-129586070 ATGACATTTTAGAAAAGTACTGG - Intergenic
1048416095 8:134229419-134229441 ATTTCATGTTTGAAAAGTAACGG - Intergenic
1050218702 9:3361119-3361141 ATGGGATATTAGAACAGTTACGG + Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050510155 9:6385812-6385834 AGGTCATTATATAATAGTAAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050831379 9:10018498-10018520 AAATCATTTTAGCAGAGTAATGG - Intronic
1050901390 9:10953221-10953243 ATGTCATTTTTGAACAGTTTGGG + Intergenic
1051152034 9:14092183-14092205 ATGTCATTGCAGAACAGCTAAGG + Intronic
1053185170 9:36009859-36009881 ATGTTTTTTTATAAAAGTAAGGG + Intergenic
1053296197 9:36914647-36914669 ATGTAATTTCAGGAGAGTAAAGG + Intronic
1053305737 9:36983545-36983567 ATTTCATTTTAGGATAGCAAAGG + Intronic
1054813475 9:69453227-69453249 ATTTCATTTCAGGATAGTAATGG + Intronic
1054890987 9:70251421-70251443 ATGTCAAATTAGTAGAGTAATGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056502393 9:87222860-87222882 ATTTCATTTCAGGGCAGTAAAGG + Intergenic
1057504791 9:95625377-95625399 ATGTCATCTTAAAACTGTGAGGG + Intergenic
1057924225 9:99129154-99129176 CTGTGATTTTAGAACTGGAAGGG + Intronic
1058599699 9:106655997-106656019 ATGGCATTTGGGAACAGTAAGGG + Intergenic
1058842305 9:108921724-108921746 TTGACTTATTAGAACAGTAAAGG - Intronic
1059610420 9:115886544-115886566 ATGTCCTTTTTGAACAGTGGTGG + Intergenic
1061830399 9:133289130-133289152 ATGTCATTTTTGGACATTAGAGG + Intergenic
1203620010 Un_KI270749v1:117211-117233 ATGTCATTTTCGTACAGTCTTGG + Intergenic
1186006834 X:5081452-5081474 ATATCATTTTAGAGCAAAAAAGG + Intergenic
1186831521 X:13395067-13395089 AAGTCATTTTGGAAGAGCAACGG - Intergenic
1187379566 X:18787967-18787989 ATTTCATTTTTGAAAAATAAAGG + Intronic
1187439639 X:19306659-19306681 ATGTCAAATGAGAAAAGTAAAGG - Intergenic
1187961119 X:24567496-24567518 ATGGCATTTTCCAAGAGTAAAGG + Intronic
1188823819 X:34805587-34805609 ATTTTATTATATAACAGTAATGG + Intergenic
1188850829 X:35129747-35129769 AAGTCATTTTAGAATGTTAATGG - Intergenic
1188871164 X:35374596-35374618 ATATAATTTAAGAACTGTAATGG - Intergenic
1189725107 X:43960339-43960361 GTGGCATTTTAGAACACAAAGGG - Intronic
1189961532 X:46329160-46329182 ATGTCATTTTTAAAAAGTAGAGG - Intergenic
1190808020 X:53857766-53857788 AGGTCATTATATAACAATAAAGG - Intergenic
1191903136 X:66059181-66059203 ATGTGATTTTAGAACAATGGAGG - Intergenic
1192893386 X:75414239-75414261 ATGTCATTTTTGAAAATAAAAGG - Intronic
1193528448 X:82622965-82622987 ATGCCATTTTATAAAAGGAAAGG + Intergenic
1194679649 X:96836663-96836685 ATTTCATTTTAAAGCAGTACAGG + Intronic
1196007072 X:110848381-110848403 GTCTCATTTTAGGACAGTAAAGG - Intergenic
1196304089 X:114080461-114080483 ATGACATTTTTGAACAGTACGGG + Intergenic
1196326679 X:114413714-114413736 TTGGCATCTTAGACCAGTAATGG - Intergenic
1197564168 X:128060837-128060859 AAGTTATTATATAACAGTAAAGG + Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198897261 X:141469282-141469304 ATGTGAATCTATAACAGTAAAGG - Intergenic
1198976994 X:142347281-142347303 ATTTCAAATTAGAACAATAAGGG + Intergenic
1200732804 Y:6760762-6760784 ATGTCAGTTAAGTACAGTTATGG + Intergenic
1201681581 Y:16650920-16650942 ATGTTCTTTTATAATAGTAAAGG + Intergenic
1202577998 Y:26347747-26347769 ATGAACTTTTAGAACAGTCAGGG - Intergenic