ID: 1101073121

View in Genome Browser
Species Human (GRCh38)
Location 12:101097144-101097166
Sequence ATGAATTCCCTTACATCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101073118_1101073121 -1 Left 1101073118 12:101097122-101097144 CCCTGGGTAGTGGTAATGTCGCA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1101073121 12:101097144-101097166 ATGAATTCCCTTACATCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 121
1101073119_1101073121 -2 Left 1101073119 12:101097123-101097145 CCTGGGTAGTGGTAATGTCGCAT 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1101073121 12:101097144-101097166 ATGAATTCCCTTACATCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 121
1101073114_1101073121 28 Left 1101073114 12:101097093-101097115 CCAGCAGTTATGAGGATTTGGGA 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1101073121 12:101097144-101097166 ATGAATTCCCTTACATCTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101073121 Original CRISPR ATGAATTCCCTTACATCTGG AGG Intronic
915892316 1:159783399-159783421 ATGAGTTCTGTTAGATCTGGAGG + Intergenic
917362729 1:174194651-174194673 ATCAGTTACCTGACATCTGGTGG + Intronic
923343756 1:233031481-233031503 TTGTATTACCTTACATATGGTGG + Intronic
923443510 1:234044555-234044577 AGGAATTCTCATACATCTGGTGG - Intronic
1065674330 10:28157945-28157967 ATGAATTTCCTTACCGATGGGGG - Intronic
1068065285 10:52122503-52122525 ATGAATTAACATAAATCTGGTGG - Intronic
1068622044 10:59196952-59196974 ATGAATTCCCTGGGCTCTGGAGG + Intronic
1072748910 10:97962357-97962379 ATTAATTCCTTTACAGCTGCTGG - Intronic
1073077410 10:100832932-100832954 ATGAATTGCCATACATTTTGGGG - Intergenic
1074806845 10:117062420-117062442 ATGAATTAGCTTACATTTTGAGG + Intronic
1076229782 10:128810624-128810646 ATGCAGACCCTTTCATCTGGGGG - Intergenic
1077945845 11:6897292-6897314 TTGAATTGCCGTCCATCTGGTGG + Intergenic
1086450104 11:86906950-86906972 ATGAGTTCCCTGACATCAGCCGG - Intronic
1091491936 12:940176-940198 AAGAATTCCGTTAAATCGGGAGG + Intronic
1092341172 12:7677474-7677496 ATGAAAACCCTTACGTCTGGGGG - Intergenic
1093922528 12:24875240-24875262 ATGAATTGCGTAACATCTGTAGG + Intronic
1095366174 12:41408592-41408614 ATGGCTTCTCTTACAACTGGAGG + Intronic
1098115334 12:67170156-67170178 ATGTTTTCCCTTAAATTTGGGGG + Intergenic
1100222279 12:92518218-92518240 ATGCATTCCCATACATCTGCTGG + Intergenic
1100326722 12:93546487-93546509 ATGAATTCACCCACATATGGTGG - Intergenic
1101073121 12:101097144-101097166 ATGAATTCCCTTACATCTGGAGG + Intronic
1112744798 13:102514557-102514579 AGGAATTCCCTATTATCTGGGGG - Intergenic
1113400923 13:109992625-109992647 ATGAATTCCCCTACGGCTGCCGG + Intergenic
1115569176 14:34650945-34650967 ATTTATTCTCTTACTTCTGGAGG + Intergenic
1116111172 14:40584925-40584947 ATTAATTCCCTGATATCTGAGGG - Intergenic
1116484985 14:45436873-45436895 ATGAAGTACTTTACAACTGGTGG + Intergenic
1117019332 14:51553294-51553316 ATGAATGCCCTTAACTCTGCAGG + Intronic
1117221871 14:53614214-53614236 ATGCTTTTCCTTTCATCTGGTGG + Intergenic
1117942521 14:60983232-60983254 CTGAAATCCTTTACAACTGGAGG + Intronic
1118888963 14:69891488-69891510 ATGACTTTCCTTTCATCTGAAGG + Intronic
1120405249 14:84086098-84086120 ATGTTTTCCCTTACAAGTGGGGG - Intergenic
1122340869 14:101027760-101027782 TTGACTTCCTTTAAATCTGGAGG + Intergenic
1130339419 15:82986498-82986520 ATAATTTCCCTCACTTCTGGAGG + Intronic
1130608214 15:85336641-85336663 ATGATTTCCTTTACTTCTAGGGG - Intergenic
1133143925 16:3769659-3769681 ATTAATTCCCTTCAATATGGTGG + Intronic
1135883799 16:26285393-26285415 ATGAATTCCCTGCTATCTTGTGG - Intergenic
1136111322 16:28065085-28065107 ATGAATTGCCTTACTCCTGTGGG + Intergenic
1137909386 16:52361001-52361023 ATAAATTCCATTATATCTTGAGG - Intergenic
1138690949 16:58768287-58768309 ATGATTTCCCATAAATCTGTGGG + Intergenic
1143276488 17:5715126-5715148 ATGTCTTCACTTATATCTGGAGG + Intergenic
1143334463 17:6162033-6162055 AGGAATTCCCAAACATATGGGGG - Intergenic
1146073936 17:29710604-29710626 ATGAATTCCTTTCCACCTAGTGG - Intronic
1148358063 17:46989474-46989496 ATGCATCCCCTTATATCTGGGGG - Intronic
1153651620 18:7246037-7246059 ATGAATTCAATTACATTTGATGG - Intergenic
1154075623 18:11198165-11198187 TTGGATTCCTTTAAATCTGGGGG + Intergenic
1164426507 19:28146549-28146571 ATGCATCACCTCACATCTGGAGG + Intergenic
1164668819 19:30061668-30061690 ATGACTTCCCTGTCACCTGGGGG + Intergenic
929277522 2:40042250-40042272 AGCAATTCCATGACATCTGGTGG + Intergenic
931200253 2:60090854-60090876 ATGATTTGCCTTAATTCTGGAGG + Intergenic
935381082 2:102451676-102451698 ATGGATTCTCTTACATAAGGAGG - Intronic
939937109 2:148306153-148306175 AGGAATTCACTTAAATCTGTAGG - Intronic
941440068 2:165523627-165523649 TTGATTTCCCTCACATCTTGTGG + Intronic
943039863 2:182791127-182791149 ATGAATTGCCCTACTTCTGAGGG - Exonic
943174790 2:184456969-184456991 ATGAATTCCCTTTCCTCAGCTGG - Intergenic
943178831 2:184515115-184515137 ATGAATTCCTTTACCTCTTTTGG - Intergenic
947768428 2:232652195-232652217 ATGAATTCCTTTGCATATGTCGG + Intronic
1169453892 20:5735372-5735394 ATGAATTCCTTTATATCTTGTGG + Intergenic
1170571027 20:17632767-17632789 ATGAATTCCCATCCGTCTGCTGG - Intronic
1173262527 20:41449504-41449526 TTGATTTCCCTTCCATTTGGAGG - Intronic
1175095774 20:56540517-56540539 ATGCATTCCCTTGCAGCTGTAGG + Intergenic
1177531033 21:22358219-22358241 ATAAATTCACTTTCCTCTGGAGG - Intergenic
1177705809 21:24702772-24702794 ATGAATACTGTTACAGCTGGAGG + Intergenic
952289126 3:31998254-31998276 ATTTCTTCCCTTTCATCTGGGGG - Intronic
952568757 3:34687709-34687731 TTGAATTCCACTTCATCTGGAGG - Intergenic
958574177 3:95926410-95926432 ATGAATTCTCTCACATTTGTTGG - Intergenic
960003729 3:112760579-112760601 ATGAATTACCATAAATGTGGTGG + Intronic
960429178 3:117547748-117547770 ATGAATTCTCATACCTTTGGTGG - Intergenic
963494322 3:146041258-146041280 ATCAATTCCTTTAAATCTGCTGG + Intergenic
967200815 3:187070973-187070995 AGGAACTTCCTTACATCTGTAGG + Intronic
970998229 4:22292404-22292426 ATGTATTCACTTAGTTCTGGAGG + Intergenic
973766684 4:54169261-54169283 ATGAATTCCCATAAAACTTGAGG - Intronic
980338071 4:131501238-131501260 ATAAATTCCCTTCCCTCAGGTGG - Intergenic
980709689 4:136549044-136549066 ATGAATTTCCTTTCACCTTGTGG - Intergenic
982434441 4:155367468-155367490 ATGTATTCTCTTAGTTCTGGAGG - Intronic
982650567 4:158083187-158083209 ATGTATTCCCTTACATTTGGGGG + Intergenic
984191273 4:176608583-176608605 TTGAATTTCCTTACATCTCCAGG - Intergenic
984280047 4:177659167-177659189 ATGAATTCACTTAATTCTTGAGG - Intergenic
986095104 5:4546930-4546952 ATGAAGTGCCTGAAATCTGGTGG - Intergenic
987618520 5:20307604-20307626 ATGCATTGCCTACCATCTGGAGG + Intronic
988570219 5:32357891-32357913 ATTAATTCCCTTATATCTAATGG + Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989801256 5:45543605-45543627 ATTGATTGCCATACATCTGGAGG - Intronic
990796127 5:59543207-59543229 ATTAATCCACTTAAATCTGGAGG + Intronic
992670337 5:79053898-79053920 ATGGAAACCCTTAGATCTGGGGG + Intronic
993679433 5:90857734-90857756 ATGAATTCCCATCCCTCTGATGG + Intronic
995442294 5:112205407-112205429 ATGATTCCCTTTACCTCTGGGGG + Exonic
1001366450 5:171145840-171145862 ATGTTTTCCCTTACTTTTGGGGG - Intronic
1003749195 6:9037676-9037698 AGCATTTCCCTTCCATCTGGAGG + Intergenic
1005108176 6:22248113-22248135 ATGGATTCCATTTCCTCTGGAGG + Intergenic
1006042345 6:31266952-31266974 ATCAGATCCCTTACAACTGGAGG + Intergenic
1006527141 6:34616193-34616215 ATGAATGCCCTGGCATCAGGAGG + Intronic
1007203896 6:40133406-40133428 ATGTTTTCCATTGCATCTGGGGG + Intergenic
1008390044 6:50939873-50939895 AGGAATTCTCTTACATCAGTTGG - Intergenic
1015202894 6:130602683-130602705 ATGAACGCCCTTTCATCTGAGGG + Intergenic
1016867254 6:148779473-148779495 ATGAACTTGCTGACATCTGGAGG + Intronic
1017646070 6:156541018-156541040 CTGAATTCCCTCACTCCTGGTGG - Intergenic
1019669918 7:2271956-2271978 ATGAACTCCCTGTCAGCTGGAGG + Exonic
1022509840 7:30928139-30928161 ATGAATCCCCTTGATTCTGGAGG - Intergenic
1023746660 7:43328596-43328618 AAGGATTCCATTGCATCTGGGGG + Intronic
1027348916 7:77290442-77290464 ATGAATTTCCTTATCTTTGGGGG - Intronic
1033434468 7:141320563-141320585 AGGAAATCCCTCACACCTGGAGG + Intronic
1033959736 7:146899737-146899759 ATGCATTCACCAACATCTGGAGG + Intronic
1034332470 7:150294744-150294766 GTCAATTCCCTTACATAAGGTGG + Intronic
1034665566 7:152815131-152815153 GTCAATTCCCTTACATAAGGTGG - Intronic
1035039663 7:155918320-155918342 ATGACTTCCATCACATCTGTCGG + Intergenic
1035378638 7:158424315-158424337 CGGAATTCCATTACAGCTGGGGG - Intronic
1036238846 8:7065687-7065709 ATGACTTCCCATACAGCAGGAGG - Intergenic
1036817961 8:11916094-11916116 ATGACTTCCCATACAGCAGGAGG + Intergenic
1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG + Intergenic
1040679587 8:49792557-49792579 ATGAATTCCATTAGATCTTAAGG + Intergenic
1043270066 8:78322165-78322187 ATGAAGTCCCATACATATGTGGG - Intergenic
1043502278 8:80869985-80870007 ATTCATTCCCTTGCATCTGTAGG - Intronic
1048823442 8:138400271-138400293 ATCAATTGCCTTGCATCTGTTGG - Intronic
1048927003 8:139280450-139280472 ATGCATTGCCTCACTTCTGGAGG + Intergenic
1049638388 8:143701914-143701936 ATGAATTCTCTCAGTTCTGGGGG + Intronic
1057055176 9:91954912-91954934 ATGAACTCCCTTTCACCAGGGGG + Intergenic
1057110324 9:92463668-92463690 ATAAAATCCCTTTCATCTGCTGG - Intronic
1060777238 9:126384005-126384027 ATGAATGCCCATCCATCTGCGGG + Intronic
1188839846 X:35002715-35002737 ATCAACTCTCTTCCATCTGGAGG - Intergenic
1189511672 X:41668638-41668660 ATGAATTCCTTTCTATTTGGAGG + Intronic
1190282257 X:48938841-48938863 CTGAATTCCCCTACCTCTGCAGG - Intronic
1190407235 X:50100386-50100408 ATGATTGCACTGACATCTGGTGG - Intergenic
1191256387 X:58281390-58281412 AGGAAGTCCCTGACCTCTGGCGG + Intergenic
1193667980 X:84347578-84347600 ATGATTTCCCTTGTATCTGAAGG + Intronic
1194429936 X:93789852-93789874 ATGATTTTCCATACATTTGGAGG + Intergenic
1195773610 X:108378708-108378730 ATGGAATCCTTTACATCTGAGGG - Intronic
1197234509 X:124044453-124044475 CTGAATTACCTTACATCTCTAGG + Intronic
1199991522 X:152990089-152990111 GTGAAGTCCCTTCCAGCTGGTGG + Exonic