ID: 1101073983

View in Genome Browser
Species Human (GRCh38)
Location 12:101109124-101109146
Sequence GCGTTTGCACAATTGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101073978_1101073983 0 Left 1101073978 12:101109101-101109123 CCTTCAATTCAGGTTTGTCTCGT 0: 1
1: 0
2: 0
3: 30
4: 237
Right 1101073983 12:101109124-101109146 GCGTTTGCACAATTGGGTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101073983 Original CRISPR GCGTTTGCACAATTGGGTTG GGG Intronic
900783857 1:4635149-4635171 GAGTTTGCAGGACTGGGTTGCGG + Intergenic
904197344 1:28795677-28795699 GAGATTGCAAAATTGTGTTGAGG - Intergenic
905024835 1:34842962-34842984 TTGGTTGCACAATGGGGTTGGGG - Intronic
915822067 1:159034776-159034798 GCATTTAAACAATTGGGGTGTGG + Intronic
917463527 1:175253912-175253934 GTGTTTGCATGATTGGGTTCTGG + Intergenic
921568609 1:216751491-216751513 GGGTTTGCACAGCTGGGCTGAGG - Intronic
1064476313 10:15692673-15692695 GTGTATGTACAATTGTGTTGAGG - Intronic
1075584581 10:123648384-123648406 ACGTTCACACCATTGGGTTGTGG + Intergenic
1077694963 11:4385564-4385586 GCTTCTGGACAATTTGGTTGTGG - Exonic
1080037249 11:27722454-27722476 GCGTTTGCTCTAATGGGTTATGG + Intergenic
1084711119 11:70844330-70844352 GCGTTTTTCCATTTGGGTTGGGG + Intronic
1087241944 11:95790021-95790043 ACATTTGCTCAATTGGATTGGGG - Intronic
1101073983 12:101109124-101109146 GCGTTTGCACAATTGGGTTGGGG + Intronic
1102826513 12:115951688-115951710 GCGGTTTCAGAAGTGGGTTGTGG - Intergenic
1116140402 14:40986138-40986160 GCTTATTCACAAATGGGTTGTGG + Intergenic
1116539180 14:46077174-46077196 GTGTTAGCAAAATTTGGTTGAGG + Intergenic
1132537366 16:489255-489277 GTGTTTGCACACTTGGCTTGCGG + Intronic
1147599760 17:41738581-41738603 GGGTGTGCACAATTAGGTGGTGG - Intergenic
1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG + Intronic
1152515003 17:80817869-80817891 GTGGTTGCACAAATGGGGTGTGG + Intronic
1159458782 18:68695573-68695595 TGGTTTGAACAATTGGGTAGAGG - Intronic
1164082607 19:21873392-21873414 GCATTCGCACATTTGGGTTAGGG + Intergenic
1164190584 19:22913452-22913474 GCATTTGCACATTTGGGTTAGGG + Intergenic
1164738271 19:30558442-30558464 GCGTTTCCACATCTGGGATGGGG - Intronic
926824683 2:16892685-16892707 GCTTATTCACAAATGGGTTGTGG - Intergenic
935878801 2:107540347-107540369 GCTTTTGCAGAATTTGGATGTGG + Intergenic
943622989 2:190170103-190170125 GCGACAGCACAATTGGGTTCTGG + Intronic
1172709688 20:36911812-36911834 TCGTTTTCACATTTGTGTTGAGG - Intronic
1177767993 21:25480473-25480495 GCATTGGCTCACTTGGGTTGGGG - Intergenic
961234757 3:125356836-125356858 GCCTTTCCAGAATTGGGCTGTGG - Intronic
967832726 3:193934444-193934466 TTGTTTGCACAATTGGGATGTGG + Intergenic
968178837 3:196575064-196575086 GAGTTTGGAGAATTTGGTTGGGG + Intronic
969926542 4:10591044-10591066 GCGTTTGCACCATGGAGCTGTGG + Intronic
970498316 4:16650897-16650919 GGGTTTTCACATTTGGGTTTGGG - Intronic
977905103 4:102468059-102468081 ACGTTTGCCCTATTGGGTTTTGG + Intergenic
980754986 4:137147395-137147417 GGGTTTGCTCCATTGGGTTTTGG - Intergenic
982873439 4:160613578-160613600 GAGAATGCAGAATTGGGTTGTGG - Intergenic
994995352 5:107055289-107055311 GTGATTGCCCATTTGGGTTGGGG + Intergenic
1002612665 5:180431697-180431719 GCTTTTGCACATCTGGTTTGAGG - Intergenic
1011778448 6:90759312-90759334 AATTTTGCACAATTGGGATGTGG - Intergenic
1012287140 6:97404545-97404567 GAGTTTGCACATTTAAGTTGAGG - Intergenic
1022127204 7:27370004-27370026 GAAATTGCACAATTGGCTTGGGG + Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1028030416 7:85905082-85905104 TGGTTTTCACAATTGGGTTAGGG + Intergenic
1036562882 8:9912694-9912716 GCGTTTGGCCACCTGGGTTGGGG + Intergenic
1036609665 8:10338937-10338959 GTTTTGGCAGAATTGGGTTGTGG + Intronic
1038765938 8:30427739-30427761 GAGTTTATACAAGTGGGTTGTGG + Intronic
1042391640 8:68242574-68242596 TCTTTTGCACACTTGGGTTTGGG + Intergenic
1042968605 8:74383209-74383231 GCCCTTCCAAAATTGGGTTGGGG + Intronic
1047249041 8:123167682-123167704 GAAATTGCACAATTGGATTGTGG + Intergenic
1048817287 8:138345560-138345582 GGGCTTGAACAAATGGGTTGGGG - Intronic
1186360824 X:8839447-8839469 AAGTTGCCACAATTGGGTTGGGG - Intergenic
1188632760 X:32388126-32388148 GCATTTGCTCAATTGGTTTCTGG - Intronic
1195464100 X:105160524-105160546 GCATTTGCACAATTGAAATGGGG - Intronic
1200267216 X:154652986-154653008 GCGTGTGCACAGTTGGGTGCTGG - Intronic