ID: 1101074423

View in Genome Browser
Species Human (GRCh38)
Location 12:101113732-101113754
Sequence TAGGGTAGTACAGTGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101074423 Original CRISPR TAGGGTAGTACAGTGATTGC TGG Intronic
900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG + Intronic
904481211 1:30794668-30794690 AATGGTAGTACACTGATTGTGGG + Intergenic
913370374 1:118092463-118092485 CAGGGTAGTTCAGTGATCCCAGG - Intronic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
919060441 1:192625326-192625348 TGGGGCAGAACAGTGAATGCAGG - Intergenic
922004074 1:221511212-221511234 TAGGGTGCTACAGGGATTGATGG + Intergenic
922275216 1:224071242-224071264 TCGGAAAGTACTGTGATTGCAGG + Intergenic
1064376236 10:14798973-14798995 GAGGGTAGAAAAGTGGTTGCTGG + Intergenic
1065699710 10:28412911-28412933 TAGGGGATTACAGGGATTACAGG - Intergenic
1073743912 10:106443861-106443883 AAGGGTAGTAGAGTGATGGAGGG + Intergenic
1075889940 10:125939563-125939585 TAAGTTAGAACAGTGATTTCAGG + Intronic
1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG + Exonic
1079617652 11:22514768-22514790 TTGGGTGGAACAGTGATTCCTGG - Intergenic
1081164293 11:39788328-39788350 AAGGGTAGAATAGTGATTACAGG + Intergenic
1095709466 12:45273116-45273138 GAGAATAGAACAGTGATTGCCGG + Intronic
1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG + Intergenic
1100092391 12:90986679-90986701 TAGGTTGGTACAGTGCTGGCTGG - Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102205891 12:111090563-111090585 TAGTGTAGTAAAGGGATCGCAGG - Intronic
1107198115 13:37679395-37679417 TATGGTAATACATTGATTACAGG + Intronic
1109239068 13:59861015-59861037 TAGGGAGGGACACTGATTGCTGG + Intronic
1111983800 13:95044942-95044964 TAGAGTTGTGCAGTCATTGCAGG - Intronic
1114758018 14:25282192-25282214 AAGGGAAATACAGTGTTTGCTGG - Intergenic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116249274 14:42459324-42459346 TAGGGAGTTACAGTGTTTGCTGG + Intergenic
1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG + Intergenic
1118497364 14:66321559-66321581 GAGAGTAGAACAGTGGTTGCTGG + Intergenic
1133100858 16:3478758-3478780 TAGGGGAGTGGAGTGATTCCAGG - Intronic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1141122629 16:81372670-81372692 TAGGTTAATACAGTCATTCCGGG + Intronic
1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG + Intergenic
1146495543 17:33318878-33318900 TAGGGAAGGAAAGTGATTCCAGG + Intronic
1166381886 19:42359005-42359027 TAGGGAAGTACAGGGGTGGCTGG + Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936532335 2:113284858-113284880 TAGGGTAGTGAAGAGAATGCTGG - Intergenic
941388048 2:164877505-164877527 GAGGGTGGCCCAGTGATTGCTGG + Intergenic
943544705 2:189260361-189260383 TTGGGTAGCCCAGTGACTGCAGG + Intergenic
943698222 2:190959678-190959700 TTGGTGAGGACAGTGATTGCTGG + Intronic
945802201 2:214447882-214447904 GAGGGTAAGACAGTGACTGCTGG - Intronic
948312700 2:237000599-237000621 TAAGGTAATACAGGGATTGAGGG - Intergenic
1185025715 22:48410676-48410698 CAGTGTGGTACAGTGATTCCAGG - Intergenic
953013205 3:39048004-39048026 TTGGGTAGTAGTGGGATTGCTGG - Intergenic
956433581 3:69211359-69211381 TAGTGTAGTACAGTGATGCAGGG - Intronic
962509181 3:136081700-136081722 TAGGGGAGTACAGTGAGTCAGGG + Intronic
963001194 3:140683282-140683304 CAGGGTAGCACAGTGTTTCCTGG - Intronic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
985131752 4:186745538-186745560 CAGGGCAGTGCAGTGATGGCAGG + Intergenic
985737276 5:1591504-1591526 TAGGGAAGAAAAGGGATTGCTGG - Intergenic
985930789 5:3056093-3056115 AAGGGAAGTCCAGTGACTGCCGG - Intergenic
987778896 5:22406340-22406362 TAGGGTAGTGAAGAGATTACAGG - Intronic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
990404319 5:55472898-55472920 TAGAGCAGGACACTGATTGCTGG - Intronic
991151359 5:63375017-63375039 AAGGATAATACTGTGATTGCAGG - Intergenic
995879675 5:116830337-116830359 GAGGGTAGGACAGTGCCTGCTGG - Intergenic
999933156 5:156455684-156455706 TAGGCTATTACAGTGATTGAAGG + Intronic
1001086693 5:168705168-168705190 TTGGCAAGTGCAGTGATTGCAGG - Intronic
1002133794 5:177096368-177096390 TGGGGTAGGACAGTGACCGCCGG - Intronic
1005561204 6:27043398-27043420 GAGAGTAGAACAGTGGTTGCCGG + Intergenic
1008683151 6:53895601-53895623 TAGTTTAGTACAGTGCTTGTAGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1014020792 6:116586747-116586769 TATGGTAGTTCAGTGTTTCCTGG + Intronic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1017377341 6:153786616-153786638 CAGGGTACTAAAGTTATTGCAGG - Intergenic
1018456476 6:163958249-163958271 TAGGGTCATACAGTGCTTACCGG + Intergenic
1021361537 7:19718993-19719015 TATGGTAGGACAGAGACTGCAGG - Intergenic
1022976027 7:35557667-35557689 TAGGGTGGTAGAGTGAGTGCAGG - Intergenic
1026311458 7:69188951-69188973 TAGTATGGTACAGTGATTGAGGG - Intergenic
1031628304 7:124015997-124016019 TAAGGTACACCAGTGATTGCTGG + Intergenic
1031648392 7:124255231-124255253 TAGTTTAGTACAGGGAATGCTGG - Intergenic
1032652889 7:133898034-133898056 GAGGGTAGAACAGCGGTTGCTGG - Intronic
1035062788 7:156081524-156081546 GGGGGTAGTGCAGTGACTGCCGG + Intergenic
1036147163 8:6264644-6264666 TAAGATAGTACAGTGGTGGCCGG - Intergenic
1048552847 8:135449553-135449575 TAGGGTTGTACATTTTTTGCTGG - Intergenic
1058681934 9:107447591-107447613 TAGAGAAGTAGAGTGAGTGCTGG + Intergenic
1059030061 9:110683116-110683138 AAGGGTAGTACAGGGATCGGGGG - Intronic
1061243114 9:129385825-129385847 CAGGGTGGTGCAGTGACTGCTGG + Intergenic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1191182889 X:57581376-57581398 TAGGGTATTATAGTGTTAGCAGG + Intergenic
1191214487 X:57920998-57921020 TAGGGTATTATAGTGTTAGCAGG - Intergenic
1191769275 X:64738410-64738432 AAGGGAATTACAGTGTTTGCTGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG + Intergenic
1195300339 X:103524160-103524182 TAAGAAAGCACAGTGATTGCTGG - Intergenic
1201975088 Y:19840101-19840123 GAGGGTTGGACAGTGGTTGCAGG - Intergenic