ID: 1101075138

View in Genome Browser
Species Human (GRCh38)
Location 12:101121231-101121253
Sequence CACTGGGGACTACTATAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2435
Summary {0: 1, 1: 12, 2: 144, 3: 514, 4: 1764}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101075138 Original CRISPR CACTGGGGACTACTATAGAG GGG (reversed) Intronic
Too many off-targets to display for this crispr