ID: 1101079769

View in Genome Browser
Species Human (GRCh38)
Location 12:101171019-101171041
Sequence CAGGAGCAGGATGGTGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101079762_1101079769 29 Left 1101079762 12:101170967-101170989 CCGTCTGATGCTCATGCATTTTA 0: 1
1: 0
2: 2
3: 29
4: 208
Right 1101079769 12:101171019-101171041 CAGGAGCAGGATGGTGTCGTGGG 0: 1
1: 0
2: 1
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101079769 Original CRISPR CAGGAGCAGGATGGTGTCGT GGG Intronic
900709730 1:4106048-4106070 CAGAGGCAGGATGGAGTCATGGG + Intergenic
900998635 1:6136338-6136360 CAGGAGCAGGGTGTTGGGGTGGG - Intronic
901633751 1:10660160-10660182 CAGGGGCAGGATGGTGGCCTTGG + Exonic
901841519 1:11956968-11956990 CAGGACCGGGAGGGTGTCATAGG - Exonic
902079186 1:13809500-13809522 CAGGAGCAGGGTGGAGTGGCAGG + Intronic
903608100 1:24589705-24589727 CAGGGACAGGGTGGTGTGGTAGG + Intronic
905201321 1:36319167-36319189 AAGGAGCAGGATGGGGTTGGGGG + Intronic
909292290 1:73899059-73899081 GAGGAGCAGGATGGTCTGGCTGG + Intergenic
910465278 1:87492605-87492627 CAGAAGGAGGATGGGGTGGTTGG + Intergenic
910971511 1:92860708-92860730 CAGGAGGAGGAGGTTGTAGTGGG + Intronic
912435204 1:109656716-109656738 CAGGAGCAGGCGGATGGCGTGGG - Exonic
912439605 1:109688174-109688196 CAGGAGCAGGCGGATGGCGTGGG - Exonic
914360104 1:146927677-146927699 CAGAAGGAGGATGGGGTGGTTGG + Intergenic
915464706 1:156090029-156090051 CAGGGGCTGGATGCTGTCTTGGG + Intronic
915586706 1:156847657-156847679 CAGGAGCAGGTTGGGGGGGTGGG + Intronic
919813076 1:201421161-201421183 CAGAAGCAAGATGGTTTCCTTGG + Intronic
920034495 1:203056997-203057019 CAGAAGCAGGAAGGTGTACTTGG + Intronic
923428929 1:233901690-233901712 CTGGTGCAGGATGTTGACGTGGG - Intergenic
924955046 1:248917953-248917975 CAGGAGAAGGTGGGTGGCGTTGG + Exonic
1067267965 10:44763499-44763521 CAGCAGCAGGATGCTGCAGTTGG + Intergenic
1067324662 10:45255990-45256012 CAGGAGGAGGATGGTGGTCTGGG + Intergenic
1069111512 10:64453219-64453241 CAGGAGCAGGCTGGTGGCAGGGG + Intergenic
1073437130 10:103525425-103525447 CAGGAGGAGGAGGTTGTAGTGGG - Intronic
1075012617 10:118887567-118887589 CAGGAGCAGGCTGGTGGCAGGGG - Intergenic
1077219283 11:1408285-1408307 CAGGAGCTGGATGGATTCCTGGG - Intronic
1077440136 11:2564661-2564683 CTGGAGCTGGATGGTGGCGATGG - Intronic
1079079926 11:17407014-17407036 CAGGAGCAGGATGCCGGCGGAGG + Exonic
1081709660 11:45208733-45208755 CAGTAGGAGGAGGGTGTGGTGGG + Intronic
1083326605 11:61876242-61876264 CAGGTGGGGGATGGTGCCGTGGG - Intronic
1083797672 11:65027037-65027059 GAGAAGCAGGATGGTGTCATGGG - Intronic
1084157609 11:67322934-67322956 CTGGAGCAGGATGGTGGGGTAGG - Intronic
1084265809 11:68004585-68004607 CTGGAGCAGGATGGGGACATGGG - Intronic
1084287863 11:68143279-68143301 CAGGAGCTGGATGGAGTCTGGGG + Intergenic
1084686191 11:70697174-70697196 CTGGAGCTGGATGGTGGTGTTGG + Intronic
1084731847 11:71078935-71078957 CAAGGGCAGGATGGTGATGTTGG - Intronic
1084974953 11:72791946-72791968 CAGGAGGCGGAGGTTGTCGTGGG - Intronic
1087241802 11:95789466-95789488 GAGGAGCAGGATGGCGGCCTCGG - Exonic
1089002867 11:115066919-115066941 CAGGAGCAGCTTGGTGGGGTGGG + Intergenic
1089522826 11:119077010-119077032 GAGGAGCAGGGTGGTATGGTCGG - Exonic
1089949279 11:122510232-122510254 TAGGCCCAGGATGGTGGCGTGGG + Intergenic
1091271454 11:134314416-134314438 CAGGCTCAGGAAGGTGTCCTTGG - Exonic
1092957451 12:13563308-13563330 CAGGTCCACGAAGGTGTCGTAGG + Exonic
1093101729 12:15036882-15036904 CAGGAGAAGGAAGGAGGCGTTGG + Intergenic
1095977524 12:47949917-47949939 CGAGGGCAGGATGGTGTCCTTGG - Intergenic
1101079769 12:101171019-101171041 CAGGAGCAGGATGGTGTCGTGGG + Intronic
1101379412 12:104201539-104201561 CAGGAGCATGATGCTGTAGGAGG - Intergenic
1101474298 12:105029387-105029409 CAGAGGCAGGATGGTGCAGTGGG - Intronic
1102261427 12:111445678-111445700 CAGGAGCAGGATGGCCACCTGGG - Intronic
1102482526 12:113233518-113233540 CTGGAGCAGGAAGGCGGCGTGGG - Intronic
1102527143 12:113520168-113520190 CAGGACCAGAAGGGTGTCGCCGG + Intergenic
1103511425 12:121477455-121477477 CAGGAGTTGGAGGGTGTAGTGGG - Intronic
1103624295 12:122206595-122206617 CAGGAGCAAGAAGGTATCCTTGG - Exonic
1106229926 13:27813950-27813972 CAGGGGCAGGAGGGTGGCGGGGG - Intergenic
1113382222 13:109814282-109814304 CAGGGGCAAGATGGTGACTTCGG - Intergenic
1113499421 13:110761410-110761432 CAGGAGCAAGATGGTGGGTTGGG - Intergenic
1113814840 13:113162892-113162914 CAGGAGGAGGATGGAGTGGGGGG - Intronic
1114743718 14:25124087-25124109 CAGGAGGAGGAGGTTGTAGTGGG + Intergenic
1115051395 14:29068077-29068099 CAAGAGCAGGCTGGTGGCATGGG + Intergenic
1115634514 14:35278621-35278643 CTGGAGCAGGGTAGTGTCCTAGG + Exonic
1117579375 14:57136878-57136900 CAGCAGCAGGATGCTGTGCTGGG - Intergenic
1122073614 14:99221609-99221631 CAGGAGCAGGATGCCCACGTGGG + Intronic
1122544127 14:102512974-102512996 CAGGAGCATGATGGGGTCAAAGG - Intergenic
1123499687 15:20868043-20868065 CAGGAGCAGGTCGGTGTCCCAGG - Intergenic
1123593161 15:21879006-21879028 CAGGAGCAGGTCGGTGTCCCAGG - Intergenic
1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG + Intronic
1127384699 15:58457863-58457885 CAGGGGCAGGATGGAGACATGGG - Intronic
1129203741 15:74022967-74022989 CAGGAGCAGGATAGTGCCTTTGG + Exonic
1129299959 15:74619802-74619824 CAGCTGGAGGATGCTGTCGTTGG + Intronic
1129538012 15:76329965-76329987 AAGGAGCAGGAAGGTCTCCTAGG - Intergenic
1129717192 15:77859447-77859469 CAGGAGCGGGCTGGTGACCTTGG + Intergenic
1129786553 15:78313822-78313844 CAGGAGCAGGCTGGTGTTGAGGG - Intergenic
1130013870 15:80172940-80172962 CAAGGGCAGGAGGGGGTCGTTGG + Intronic
1131383765 15:91985921-91985943 GAGGAGCAGGATGGAGCCCTGGG + Intronic
1202965279 15_KI270727v1_random:168930-168952 CAGGAGCAGGTCGGTGTCCCAGG - Intergenic
1132579346 16:677967-677989 GAAGAGCAGGAAGGTGCCGTAGG - Exonic
1133981448 16:10635874-10635896 CAGCAGCATGATGGTGTTCTCGG + Exonic
1134109886 16:11508644-11508666 CAGGAAGAGGAAGGTGTCCTAGG + Intronic
1135635923 16:24075479-24075501 AAAGAGCAGGATGGAGTCATGGG + Intronic
1136395851 16:29992006-29992028 AAGGATCAGGATGGGGTCTTGGG + Intronic
1136397515 16:30001245-30001267 CAGCAGCAGGATGCTGTCCTGGG - Intronic
1136648962 16:31649017-31649039 CAGCAGCAGGATGGTCTGGGTGG - Intergenic
1137812387 16:51365098-51365120 CTGGAGCAGGAAGATATCGTGGG + Intergenic
1141490196 16:84367697-84367719 GAGGAGGAGGATGGTGTCATGGG + Intergenic
1142039328 16:87882524-87882546 AAGTGACAGGATGGTGTCGTTGG - Exonic
1144779446 17:17800501-17800523 CAGGGACAGGATGGGGTGGTCGG - Intronic
1147851830 17:43449620-43449642 CAGAAGCAGGATGCTGTCTTGGG + Intergenic
1148114802 17:45169367-45169389 CAGGAACTGGGTGGTGTTGTAGG - Exonic
1151555535 17:74844660-74844682 CTGGAGCAGGATGGTGGGGCGGG + Intronic
1151878154 17:76879018-76879040 CAGCAGCAGCATGGTGGCATGGG - Intronic
1151994804 17:77601779-77601801 CAGGGGCAGGATGGGGGCGGAGG + Intergenic
1152700439 17:81815769-81815791 CTGGAGCAGGCTGGTGGAGTTGG + Intergenic
1153337501 18:3939546-3939568 CATGAACAGAATGGTGTCATAGG - Intronic
1156413950 18:36867288-36867310 CAGGAGCAAGATGGTGGGGGAGG - Intronic
1156914647 18:42451383-42451405 CACGAGAAGGATGGTGTTGGGGG + Intergenic
1157965508 18:52204404-52204426 CAGGATAAGGATGGTGACATGGG - Intergenic
1157987683 18:52458245-52458267 CAGGACCAGGATGGTGGTGGAGG - Intronic
1158123889 18:54081375-54081397 CAGGAGAAGGAGGATGTCTTGGG - Intergenic
1158217529 18:55115703-55115725 CACGAGCAGGATAGTATGGTGGG - Intergenic
1158388793 18:57025755-57025777 CAGCAGCAGGATGGTGTCAGAGG - Intronic
1159935008 18:74358037-74358059 CAGTAGCAGGAAGGTGGCCTGGG - Exonic
1160193296 18:76732881-76732903 CAGGAGAAGGAAGGAGGCGTTGG + Intergenic
1161162512 19:2769024-2769046 CAGGAACTGGATGATGGCGTAGG + Exonic
1161590424 19:5126916-5126938 CAGGAACAGAGTGGTGTCCTTGG + Intronic
1161850506 19:6735783-6735805 CAGGAGCAGGAAGATCCCGTGGG - Intronic
1161984152 19:7644705-7644727 CAGGACCCGGATCTTGTCGTAGG - Exonic
1163722990 19:18907037-18907059 CATGAGCAGGAAGGTGGTGTTGG + Exonic
1164821926 19:31257227-31257249 AGGGAGCAGGACGGTGCCGTGGG + Intergenic
1165059489 19:33198139-33198161 CACCAGCAGGAGGGTGTCCTGGG - Intronic
1167149842 19:47702243-47702265 CAGGTTCAGGATGCTGTCGATGG - Exonic
1168149688 19:54438940-54438962 CAGGGCCAGGATGGTGGCCTGGG - Intergenic
925233483 2:2256465-2256487 CAGCAGCAGAATGGAGTAGTGGG + Intronic
926464969 2:13176763-13176785 CAGGAGCAGAATGATATGGTTGG - Intergenic
927787398 2:25982936-25982958 CAGGAGCAGGGGGGTGTCCGAGG - Intergenic
928163574 2:28952143-28952165 GTGGAGCAGGATGTTCTCGTTGG + Intergenic
929088981 2:38195978-38196000 CAGGAGCAGGAGGGATTCCTCGG - Intergenic
929749884 2:44699678-44699700 CAGGAGCTGGAGGCTGTAGTGGG - Intronic
933854533 2:86400444-86400466 CAGGAGCAGGCTGGTGGCATGGG - Intergenic
936428094 2:112436273-112436295 CAGGAGCAGAGTGGGGTCCTCGG - Intergenic
937274159 2:120673486-120673508 CAGGAGCAGCGTGGTGATGTGGG - Intergenic
937552317 2:123108916-123108938 GAGGAGCAGGATGGTGGAGTAGG - Intergenic
938940081 2:136162238-136162260 CAGAAGCAGAATGGTGCAGTGGG - Intergenic
942250568 2:174044167-174044189 CAGGAGAAGGAGGTTGTGGTGGG + Intergenic
944191635 2:197010037-197010059 CAGGAGCAGGATGGAGGAGGAGG + Intronic
945259343 2:207829859-207829881 CAGGTGCAGGATGGTCTTGGGGG + Intronic
947995380 2:234523060-234523082 CAGGAGCAGGAGGAAGTCGGGGG - Intergenic
948227582 2:236323442-236323464 CAGGAGGAGGATGACTTCGTGGG + Intergenic
948882999 2:240869852-240869874 CAGGAGCAGGAGTGTGCCCTGGG + Intronic
1168978527 20:1985926-1985948 CAGGAGTTAGATGGTGTGGTAGG - Intronic
1171113144 20:22502285-22502307 CAGGAGCGGGATTGTGTGATTGG - Intergenic
1171963778 20:31514655-31514677 CATGAGCAGGAGGCTGCCGTAGG - Exonic
1172520534 20:35562737-35562759 CAGGATCAGGTGGGTGTCCTGGG + Intergenic
1173220056 20:41125224-41125246 CACGAGCAGGTAGGTGTCTTCGG + Intergenic
1173362876 20:42360184-42360206 AAGGAGCAGGATGGTGACACAGG - Intronic
1173823936 20:46035453-46035475 CTGGGGCAGGTTGGTGTAGTTGG - Exonic
1174320141 20:49735273-49735295 CAGAAGCAGGAAGATGTCTTGGG - Intergenic
1176176264 20:63726930-63726952 AGGGAGCATGATGGTGTTGTGGG - Intronic
1176374161 21:6078938-6078960 CAGGAGCAGAGTGGGGTCCTCGG + Intergenic
1177475055 21:21609414-21609436 CAGCAGCATGATGGTGTCACTGG - Intergenic
1179116022 21:38493625-38493647 CAGGAGCACGATGCAGTCATAGG + Intronic
1179749316 21:43459307-43459329 CAGGAGCAGAGTGGGGTCCTCGG - Intergenic
1181027456 22:20134168-20134190 CTGTAGCAGGATGGTGGCCTGGG + Intronic
1182695360 22:32195527-32195549 CAGGAGCCGGATGTTGCAGTGGG - Intronic
1184138076 22:42561242-42561264 CTGGAGGGAGATGGTGTCGTCGG + Intronic
1184274306 22:43401415-43401437 CAGGAGTAGGAGGGTGAGGTGGG + Intergenic
1184775011 22:46618728-46618750 CTGGACCAGGCTGGGGTCGTGGG + Intronic
1185050899 22:48553475-48553497 CAGGAGGAGGATGGGGTCATGGG + Intronic
953686805 3:45084310-45084332 CAGTGGCAGGAAGGTGTGGTAGG + Exonic
954228684 3:49199630-49199652 GAGGAGCCGGATGGGGCCGTGGG + Intronic
954533546 3:51341163-51341185 CAGGAGCAGCCTGGTGTCAGAGG - Intronic
954946999 3:54434647-54434669 CAGTAGCAGGCTGGTGGCCTGGG + Intronic
955682310 3:61514904-61514926 CAGGAGCAAGAGGGTGTGGAGGG - Intergenic
957062749 3:75495439-75495461 CTGGGTCAGGATGGTGTGGTTGG - Intergenic
962808429 3:138943062-138943084 CAGGAGCAGGATGGAGAGGGAGG - Intergenic
963681462 3:148383300-148383322 CTGGAGCAGGATACTGTTGTGGG - Intergenic
964654670 3:159052802-159052824 CAGGAGCAGAATGATATGGTTGG + Intronic
965394549 3:168146474-168146496 GGGGAGAAGGATGGTGTCGGGGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
969006650 4:4025572-4025594 CTGGGTCAGGATGGTGTGGTTGG - Intergenic
970585668 4:17512042-17512064 CAGGAGCAGGATGGCGGCGGCGG - Exonic
971198715 4:24492763-24492785 CAGGAGTTGGAGGGTGTAGTGGG - Intergenic
978545841 4:109872246-109872268 CAGGAGCTGGCTGGTGTCATAGG - Exonic
979657886 4:123218082-123218104 CAGGAGCAGGATGGTGTATTAGG + Intronic
980528569 4:134020646-134020668 CAGGAACAGGTTGGTGTTGTAGG - Intergenic
986710914 5:10487174-10487196 AAGGAGCAGGCTGGTGTCCCAGG - Intergenic
987403506 5:17502133-17502155 CAGGACCAGGATGATGGCCTAGG + Intergenic
989657515 5:43760417-43760439 CAGGAGCAGCATGGAGTCAAAGG - Intergenic
992342473 5:75839559-75839581 CGGGAGCAGGCTGGTGGCATGGG + Intergenic
993195293 5:84734285-84734307 CAGGAGCAGGTTTTTGTGGTGGG + Intergenic
994012535 5:94922560-94922582 CAGGAGGAGGAGGTTGTAGTGGG - Intronic
995746246 5:115407041-115407063 CAGAAGCAGGAGGGTGTCAAGGG - Intergenic
995829411 5:116337117-116337139 CAGGAGTAGAAGGGTGTTGTAGG + Intronic
996703317 5:126471576-126471598 CAGGAGTAGGATGCAGTAGTAGG - Intronic
998401234 5:141850125-141850147 CAGGTGCAGGATGGGGTGGGAGG - Intergenic
1001892332 5:175349997-175350019 CAGGGGCACGAGGGTGTCCTGGG + Intergenic
1002159293 5:177305601-177305623 CAGGAGCAGGATGGGCTGGAAGG + Intronic
1002301111 5:178257641-178257663 CAGGAGCAGACTGGTGTGCTGGG - Intronic
1002560251 5:180076839-180076861 CAGGAGCAGGAGGTGGGCGTGGG - Intergenic
1006848547 6:37080558-37080580 CAGGAGGAGGAGGTTGTGGTGGG + Intergenic
1007622257 6:43222424-43222446 CAGAAGCAGGTTGGGGTGGTGGG + Intronic
1011417119 6:87133505-87133527 AAGGAGCAGGATGGGGTCAGTGG - Intergenic
1016998441 6:149977432-149977454 CAGGAGGGGGATGGTGTGGCTGG - Intergenic
1017889278 6:158625517-158625539 CAGGGCCAGGATGGTGTCCAGGG - Intronic
1018486562 6:164246427-164246449 ATGGAGCAGGATGGAGTCTTAGG - Intergenic
1018752910 6:166822638-166822660 CATGAGCTGGATGGGGTGGTGGG - Intronic
1019512684 7:1425949-1425971 GAGGGGCAGGATGGTGGGGTGGG - Intergenic
1021509926 7:21424703-21424725 AAGGAGCAGGATGGAGTCAGTGG + Intergenic
1021622183 7:22559839-22559861 CAGGAGGAGGAGGTTGCCGTCGG + Intronic
1026128107 7:67597293-67597315 CAGGAGCAGGCTGGTGCAGAGGG - Intergenic
1027112511 7:75452088-75452110 CAGGAGGAGGAGGTTGTAGTAGG + Intronic
1028282528 7:88948587-88948609 CAGGAGCAGGCTGGTGGCATGGG - Intronic
1030288937 7:107853364-107853386 CAGGAGCAGGAGGTTGCAGTGGG - Intergenic
1031764682 7:125763143-125763165 CAGGAGCAGGCTAGTGGCCTGGG - Intergenic
1033099802 7:138460471-138460493 CAGGAGGAGGAGGAGGTCGTCGG + Exonic
1033596479 7:142863178-142863200 CAGGAGCAGGGTGGTGGCTGGGG + Exonic
1035779288 8:2215223-2215245 CATGAGCAGGAGGATGTGGTGGG - Intergenic
1036115893 8:5960534-5960556 CAGGAGCAGAAGGGTCTCCTGGG + Intergenic
1036661851 8:10714181-10714203 CAGGATGGAGATGGTGTCGTGGG + Intergenic
1036662342 8:10716347-10716369 CAGGAGCAGGAGGATGTGGCTGG - Intergenic
1036757499 8:11480995-11481017 CAGGAGCAGGAGGGTGTGGCTGG - Intergenic
1039298085 8:36180283-36180305 CAGGGGCAGAATGGTATGGTTGG - Intergenic
1040835854 8:51731001-51731023 CAGGGGCAGAATGATGTGGTTGG - Intronic
1041587111 8:59534223-59534245 GAGGAAAGGGATGGTGTCGTTGG - Intergenic
1043116058 8:76255200-76255222 CAGGAGCAGGATGATCTCCCAGG - Intergenic
1043886046 8:85601923-85601945 CAGGGGCAAGATGGCGTCCTTGG - Intergenic
1045418814 8:101993655-101993677 CAGGAGCAGCCTGGAGTAGTAGG - Intronic
1046575564 8:116024525-116024547 CAGTAGCAGGATGGTGGATTTGG + Intergenic
1048303355 8:133267103-133267125 CAGAAGCACGATGGTGGCCTGGG - Intronic
1053285942 9:36849687-36849709 AAGGGGCAGGATGGTGTGGTGGG - Intronic
1053592255 9:39526386-39526408 AGGGAGCTGGATGGTGTCTTTGG - Intergenic
1053850106 9:42281727-42281749 AGGGAGCTGGATGGTGTCTTTGG - Intergenic
1054574048 9:66838899-66838921 AGGGAGCTGGATGGTGTCTTTGG + Intergenic
1055529677 9:77171490-77171512 CAGGAGAAGGATGGAGAGGTGGG - Intergenic
1057206336 9:93175187-93175209 CAGCTGCAGGATGGAGTCTTGGG + Intergenic
1057396043 9:94681440-94681462 GAGGAGGAGGATGGTGGCGGTGG - Intergenic
1058417434 9:104803230-104803252 CAGGGGGAGGATGGTGTTGTAGG - Intronic
1061512161 9:131068048-131068070 CAGGAGCAGGAAGGGGTGTTGGG - Intronic
1061516530 9:131093409-131093431 CAGGAGGGGGATGGTGTGGGTGG + Intronic
1061593063 9:131610882-131610904 CTGGGGCAGGAGGGTGTCCTGGG - Intronic
1062573722 9:137197003-137197025 CAGGAGCAGGAAGATGCAGTGGG - Intronic
1062580410 9:137226918-137226940 CAGGAGGAGGCTGGGGCCGTGGG + Intergenic
1062702120 9:137912738-137912760 CAGGAGCAGGATGGAGCCTGAGG - Intronic
1187827478 X:23346390-23346412 AAGGAGCAGGATGGGGTCAGTGG + Intronic
1190720441 X:53143379-53143401 CAGACGCAGGATGGCGTGGTGGG + Intergenic
1191184812 X:57598557-57598579 CAGGACTAGGATGGTGTCAGTGG + Intergenic
1196765880 X:119242402-119242424 CAGGAGCAGGGTGGTGTCCAGGG - Intronic