ID: 1101083644

View in Genome Browser
Species Human (GRCh38)
Location 12:101213786-101213808
Sequence CCTCACAATCAGAAGGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101083644_1101083647 -6 Left 1101083644 12:101213786-101213808 CCGTTCTCCTTCTGATTGTGAGG 0: 1
1: 0
2: 1
3: 22
4: 236
Right 1101083647 12:101213803-101213825 GTGAGGTCTCCCCAGCCGTGTGG 0: 4
1: 210
2: 3168
3: 6845
4: 7125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101083644 Original CRISPR CCTCACAATCAGAAGGAGAA CGG (reversed) Intergenic
901775332 1:11556726-11556748 CCGCAGAATCAAAAGGAGGATGG + Intergenic
902727684 1:18348069-18348091 CCTCACAATCCTTAGGAGATGGG + Intronic
903083978 1:20838469-20838491 CCTCACAATCAGATTGAATATGG - Intronic
903377265 1:22874647-22874669 CGTCACAATCAGATGGAGTAGGG - Intronic
903582486 1:24382148-24382170 CCTGACTATCTGGAGGAGAAGGG - Intronic
904989078 1:34576737-34576759 CCTCACTATCATGTGGAGAATGG - Intergenic
906652931 1:47525936-47525958 AGCCACAATCAGAAGGAGACTGG + Intergenic
907214887 1:52854229-52854251 CCTCAAAATCTGTAGGAGATTGG - Intronic
907996255 1:59635891-59635913 CTTCAGAATCACAAGGAGAAGGG + Intronic
908457078 1:64314252-64314274 CCTCACAATAAAAAAGAGGAAGG - Intergenic
910349757 1:86281804-86281826 CCTCAGTCTCAGAAGGAGAAAGG + Intergenic
911709023 1:101048040-101048062 AATACCAATCAGAAGGAGAATGG + Intergenic
911864486 1:102999934-102999956 TCTTACCATCAAAAGGAGAAAGG - Intronic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
914402263 1:147333167-147333189 CCACACAAGCAGGAAGAGAATGG + Intergenic
915607160 1:156959816-156959838 ACTCATGATTAGAAGGAGAAGGG + Intronic
916388176 1:164300645-164300667 CCTCAAACACAGAAGAAGAAAGG - Intergenic
916610947 1:166390936-166390958 CCTCCCACTCAGAAGCAGGAGGG + Intergenic
916754753 1:167758485-167758507 CATCACAATCACAAAGAAAAAGG - Intronic
917542161 1:175924797-175924819 CCCCACAGACAGAAGGAGACAGG - Intergenic
918736410 1:188069672-188069694 ACACACAATGAGAAAGAGAATGG - Intergenic
919057245 1:192586389-192586411 CCACAGGAGCAGAAGGAGAAGGG - Intergenic
920560733 1:206936699-206936721 CCTCACATTCAGATGGAAAAAGG - Intronic
922800787 1:228363941-228363963 CCAAACAAGGAGAAGGAGAAGGG - Intronic
923663597 1:235979661-235979683 CCTGACAACCAGAAGGATAAGGG + Intronic
924228146 1:241939918-241939940 CCTCATAATCAGAACCAGAAGGG - Intergenic
924258489 1:242205927-242205949 CCTGACATTAACAAGGAGAAAGG - Intronic
1063278774 10:4601769-4601791 CCTCACAATTGGAAGGTGAAAGG + Intergenic
1063817484 10:9792251-9792273 CCTCAGAATCTAGAGGAGAAAGG + Intergenic
1065024920 10:21533250-21533272 CCTCACAAACAAATGGAAAATGG - Intergenic
1065115908 10:22482207-22482229 CCTCAGGATCAAAAGGAGGAGGG + Intergenic
1065411529 10:25434629-25434651 GCTCACAATCTAATGGAGAAAGG + Intronic
1067775259 10:49159989-49160011 CCTCAACAAAAGAAGGAGAAAGG + Intronic
1068021620 10:51592647-51592669 ACTCAAAATGAGAAGGAGAAGGG - Intronic
1068826900 10:61451078-61451100 CCTCAAAATCAGACAGATAATGG - Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072166820 10:92821567-92821589 GCTTACAATCAGAAGGTGAAGGG + Intergenic
1073051240 10:100668818-100668840 CCTCTCACTCCAAAGGAGAATGG - Intergenic
1073053576 10:100685123-100685145 CCCCACAATCAGGATGAGAAAGG + Intergenic
1075551648 10:123397110-123397132 AACCACAGTCAGAAGGAGAAGGG - Intergenic
1076195906 10:128518047-128518069 CCTTACCCTCAGAAGGGGAAAGG + Intergenic
1078271885 11:9803591-9803613 ACTCACAATCAGTAAGAGATAGG - Intronic
1078871289 11:15347571-15347593 CCTGAGAATCAAAAAGAGAAAGG - Intergenic
1079730762 11:23936195-23936217 CATCAAAATGGGAAGGAGAAGGG - Intergenic
1080418020 11:32087822-32087844 CCTCAGAAACAGTAGGGGAAAGG - Intronic
1083601605 11:63952149-63952171 CCTCAGAATCACAGGGAGGAAGG - Intronic
1084278253 11:68067747-68067769 CCTCACCACCAGAAGGGCAAGGG + Intronic
1085793907 11:79519569-79519591 CCTCTCAAAGCGAAGGAGAAAGG + Intergenic
1092459312 12:8672463-8672485 CCTTAGAATCGGGAGGAGAAAGG + Intergenic
1092680560 12:10975233-10975255 CCCTACAAACAGAAAGAGAATGG + Intronic
1094241820 12:28236221-28236243 CCAAACAATCACAAAGAGAAAGG - Intronic
1095264140 12:40133751-40133773 TCTAGGAATCAGAAGGAGAATGG - Intergenic
1097235818 12:57538762-57538784 CCTCACCACCAGAGGGAAAAGGG - Intronic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1099716016 12:86295026-86295048 CATCACAATTACATGGAGAATGG + Intronic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1101291727 12:103377425-103377447 CCTCACCGTCAGAATGGGAAAGG + Intronic
1101525590 12:105526018-105526040 CTCCACAAACAGAAGCAGAATGG - Intergenic
1102425281 12:112839044-112839066 CCTGAGACTCACAAGGAGAAAGG - Intronic
1102724552 12:115049413-115049435 ACTGACACACAGAAGGAGAAAGG + Intergenic
1104754909 12:131262923-131262945 CATCACAGAAAGAAGGAGAAAGG + Intergenic
1105711823 13:23017569-23017591 CCCCACAACCAGTAGAAGAAAGG - Intergenic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1107085009 13:36417655-36417677 CCTCACAATTACAAGGAATATGG - Intergenic
1107202213 13:37734941-37734963 CCTAACACTCCAAAGGAGAAAGG + Intronic
1107312151 13:39090733-39090755 CCTCACAAAAGAAAGGAGAAAGG + Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109800845 13:67376508-67376530 CCTGACAATCAGAATATGAAAGG + Intergenic
1110819236 13:79895347-79895369 CCACAAAAGCGGAAGGAGAAAGG + Intergenic
1115259700 14:31438910-31438932 CCTCACACTCAGAATTAAAAAGG - Intronic
1116360230 14:43985225-43985247 CTTAACAAACAAAAGGAGAAAGG - Intergenic
1120379775 14:83761927-83761949 CCTAACAATCAGAAACAGTATGG - Intergenic
1120673988 14:87397482-87397504 CCACAGAATTAGAAGGAGGAAGG - Intergenic
1120744967 14:88144574-88144596 CCTCAGAATCTGGAGGAAAATGG + Intergenic
1121193987 14:92053800-92053822 CCCAGCAATCAGAAAGAGAAAGG - Exonic
1124585562 15:31002871-31002893 CCTCACATTCAGAAGAAGCCCGG + Exonic
1127262974 15:57339200-57339222 CCCCAGAATCAGGAGGGGAAGGG + Intergenic
1128242407 15:66109986-66110008 CTTCACAACCAGCAGGACAAGGG + Intronic
1129656852 15:77530100-77530122 CATCACAACCAGAAGCAGAGTGG - Intergenic
1129946477 15:79543119-79543141 CCTGCCAATCATAGGGAGAATGG + Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1130677565 15:85967194-85967216 CCTCACAAACACATGGAGTAGGG - Intergenic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1133602087 16:7349593-7349615 CCTCAGAATCAAAATGAGGATGG + Intronic
1134494635 16:14723044-14723066 TCTCACAAGCAAAGGGAGAATGG - Intronic
1134500018 16:14762164-14762186 TCTCACAAGCAAAGGGAGAATGG - Intronic
1134545843 16:15107563-15107585 TCTCACAAGCAAAGGGAGAATGG + Intronic
1135349019 16:21713219-21713241 CCTCCCAAAGAGAAGGAGTAGGG + Intronic
1135953070 16:26933386-26933408 CTTCACTAGCAGATGGAGAACGG - Intergenic
1137525250 16:49229603-49229625 CCTGAAAATGACAAGGAGAATGG + Intergenic
1137872890 16:51967650-51967672 ACACACAAACAGATGGAGAAAGG - Intergenic
1139115377 16:63944924-63944946 CCTCACAAAAAGAAGGTGACTGG + Intergenic
1140417444 16:74786108-74786130 CCTCACAATCAGAAGGTAAAAGG + Intergenic
1142950542 17:3475536-3475558 TTTCACAATCAGAAACAGAAGGG - Intronic
1146113865 17:30116632-30116654 CCTCAAAATCTGTAGGAGAAAGG - Intronic
1150322705 17:64229859-64229881 CCTCACATTGAGAAGCTGAATGG - Intronic
1150361020 17:64534266-64534288 CCTCACAAGGAGTAGGAAAATGG - Intronic
1151374624 17:73678269-73678291 CCTCAGTATCAGAGGAAGAAGGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1156369586 18:36460886-36460908 CCTCACTTTCAGCAGGTGAAGGG - Intronic
1160056108 18:75482464-75482486 CCTCACAAGTATCAGGAGAAGGG - Intergenic
1160083269 18:75751332-75751354 ACACACAAGCAGAGGGAGAAAGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1166113774 19:40640245-40640267 CCTCACCACCAGCAGAAGAATGG + Intergenic
1166237095 19:41464546-41464568 CCTGACATTCAGAAGGGGAGAGG - Intergenic
1166814816 19:45537551-45537573 CCTGCCAATCAAAAGGGGAAGGG + Intronic
1168094179 19:54105241-54105263 CCTTACAAACTGGAGGAGAAAGG - Intronic
926559818 2:14403716-14403738 TTTCATAATAAGAAGGAGAAGGG + Intergenic
927190559 2:20514144-20514166 CCTCACAGTCAGAAGTCCAAAGG - Intergenic
928691589 2:33805051-33805073 CCTTACCAGAAGAAGGAGAAAGG + Intergenic
929073781 2:38060567-38060589 GCTCACATTCAGAAGGCCAAAGG - Intronic
929479627 2:42292368-42292390 CCTGCCCATCAGCAGGAGAATGG + Intronic
930283577 2:49400682-49400704 CCTCACATACAGATGGAGATAGG + Intergenic
937453132 2:122018884-122018906 CCTCTCAATCACAGGGAGCATGG - Intergenic
937482854 2:122280843-122280865 CTGCACAATGAGAAGCAGAATGG - Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
938707070 2:133941389-133941411 ACTCAAAATCAGATAGAGAATGG + Intergenic
938795238 2:134713319-134713341 CCTGACAAAAACAAGGAGAAAGG + Exonic
939148458 2:138444695-138444717 GCTCCCAAGCAGAAGGAGAGAGG - Intergenic
941065762 2:160900776-160900798 CCTCACAGACAGAACTAGAAGGG + Intergenic
942118575 2:172753814-172753836 CCTCACAAACCGAAAGAGGAAGG - Intronic
942407375 2:175669848-175669870 CCTGACAATGACAGGGAGAATGG + Intergenic
942744242 2:179213531-179213553 CCTGAAAGTGAGAAGGAGAATGG + Intronic
942841634 2:180368949-180368971 CATGAAAATCAGGAGGAGAACGG - Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
944099312 2:196005330-196005352 ACTCAAAACAAGAAGGAGAAGGG + Intronic
944131967 2:196356627-196356649 CATCACAAAAAGAAGAAGAAGGG + Intronic
946476484 2:220011285-220011307 ACTCACAATCAGAAAGGGGAGGG - Intergenic
947709008 2:232299539-232299561 CCTCTGAATCAGGAGGAGGAGGG - Intronic
948872129 2:240806958-240806980 CCTCAGTATCAGTAGGAGATTGG + Intronic
1169652206 20:7882041-7882063 CCTAGCATTTAGAAGGAGAAAGG + Intergenic
1172511212 20:35502303-35502325 CCACAAAATAAGAAAGAGAAGGG + Intronic
1175411519 20:58772889-58772911 CCGCACAATGATAAGGAGACAGG + Intergenic
1175857309 20:62129047-62129069 CCTCTGAATCAGGAGGAAAATGG - Intronic
1178178061 21:30128053-30128075 CGGAACAATGAGAAGGAGAATGG + Intergenic
1178970133 21:37167090-37167112 CCTCAGAAAGAGAAGGAAAAAGG + Intronic
1181870368 22:25893565-25893587 CCTCACAATCACAAGCAGCATGG - Intronic
1182143473 22:27982447-27982469 CGGCACAATAAGAAGGAGGAGGG - Exonic
1182525482 22:30914909-30914931 CCTGACAAACAGTATGAGAATGG + Intergenic
1185299386 22:50071743-50071765 CCTCACAATAAGTGGGAAAAGGG - Intronic
950366474 3:12488752-12488774 TCTCAAAATCAGACGGTGAAGGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951167413 3:19499322-19499344 CCTGAAAGTCACAAGGAGAATGG + Intronic
951175553 3:19594869-19594891 CCTGAAAGTCACAAGGAGAATGG - Intergenic
951317086 3:21201388-21201410 CCTTACAAGCAGGAAGAGAATGG - Intergenic
951349346 3:21586402-21586424 CCTCAGTATCTGAAGGATAATGG - Intronic
951576685 3:24121717-24121739 CCTCAGAGTCAGAGGGAAAAAGG + Exonic
952684163 3:36130513-36130535 CCTCAAATTCAAAATGAGAAAGG + Intergenic
953717507 3:45328610-45328632 CCTCACAGCCAGCAGGGGAAGGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955473461 3:59311829-59311851 CCTCAGAATCAGCAGGAGACTGG + Intergenic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
959154842 3:102654309-102654331 CCTCACATTCAGGAGAACAATGG + Intergenic
960518259 3:118625696-118625718 GTTCACAATCAGAAGGCTAATGG + Intergenic
961318633 3:126057355-126057377 CCTCACCCAGAGAAGGAGAAGGG + Intronic
961540159 3:127593950-127593972 CATCACAGTCTGAAGGAGACTGG + Intronic
962031813 3:131608879-131608901 CCTGACAGTGAGAAGGAAAATGG - Intronic
962470866 3:135707285-135707307 CCTCACCATCACTGGGAGAATGG + Intergenic
963122886 3:141791178-141791200 CCTCACATTCAGAGGGATAATGG + Intronic
966802195 3:183774696-183774718 CCTCTGAATCAGAAGTAGAAGGG + Intronic
966951771 3:184826103-184826125 CCTCACAATTATAAGCAGAAAGG + Intronic
967332236 3:188302127-188302149 TCTCAGAATCAGAAGAAAAATGG - Intronic
967913297 3:194559467-194559489 AATCACAATCAGAAGGTTAATGG - Intergenic
968592152 4:1464672-1464694 CCCACCAATCAGAAGGCGAAGGG - Intergenic
969593582 4:8135517-8135539 CCTCACACTCAGAAGGGGCGAGG - Intronic
969920088 4:10530186-10530208 CCTCACACCCAGCAGGAGATAGG - Intronic
970587282 4:17526641-17526663 CCACACAGTATGAAGGAGAAAGG - Intronic
971552015 4:27969228-27969250 CCCCACAACCAGAATAAGAAGGG + Intergenic
976900054 4:90162200-90162222 CTTCACACTCAGAAGGAAATGGG - Intronic
982382329 4:154762293-154762315 CCTCACAATCAGAATGCAGAGGG + Intergenic
983766241 4:171488543-171488565 ACTTACTATCAAAAGGAGAAGGG - Intergenic
986345221 5:6828564-6828586 AGTGACAATCAGAAGGGGAAAGG - Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
989107289 5:37875537-37875559 CCACACATTCAGAAGGAAACTGG + Intergenic
990681070 5:58245000-58245022 CATTACAATCAGAGGAAGAAGGG + Intergenic
991041926 5:62185313-62185335 CCTGCCAGTCAGAAGGAGATGGG - Intergenic
993496082 5:88610557-88610579 CCTGCCAATAAGAAGAAGAAGGG + Intergenic
995400144 5:111731739-111731761 CCTCACAATCCTGATGAGAAAGG + Intronic
995866448 5:116697161-116697183 CCTCACAATCAGATTGGGCAGGG + Intergenic
995868242 5:116716170-116716192 CCTCACAATGGGAACAAGAATGG - Intergenic
996831431 5:127744357-127744379 CCTGTCAAGCAGAAGGAGAGAGG + Intergenic
998618877 5:143772543-143772565 CCTTACAATCACAATGAGATTGG + Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
1000207305 5:159074810-159074832 CCTCTGAATCAGAAGGTGAAAGG - Intronic
1000531881 5:162432879-162432901 CCTAAAAATCAGTAGGAAAAAGG - Intergenic
1000835966 5:166154332-166154354 CCTCCCATTCAGAGGGAGTAGGG + Intergenic
1001455376 5:171856023-171856045 CCTCAGCGTCAGAAGGAGCAAGG + Intergenic
1002434032 5:179220461-179220483 CCTCACACTCAGAAGGTCCAGGG + Intronic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1003241156 6:4346956-4346978 ACTCACAGTCAGAAGCAGAGGGG - Intergenic
1003521915 6:6865471-6865493 CCACACAATCAAAAGCAAAAAGG - Intergenic
1003747305 6:9017133-9017155 CCTCAAAATCAGGAGGAGGATGG - Intergenic
1003846131 6:10175201-10175223 CCACAGCATGAGAAGGAGAATGG - Intronic
1004410136 6:15373770-15373792 ACCCACAACCAGAAGGATAATGG - Intronic
1005491518 6:26351830-26351852 CCTCATCATCATAAGAAGAAGGG + Intergenic
1005517566 6:26569420-26569442 CATGACAATTAAAAGGAGAAGGG - Intergenic
1006637676 6:35472211-35472233 CTTTGCAATCAGAAGGAAAAGGG + Intergenic
1007219695 6:40268784-40268806 TGTCTCAATCAGAAGAAGAAAGG + Intergenic
1008089478 6:47279017-47279039 CTTCACAGTCTGAAGGAAAAAGG + Intronic
1009228893 6:61040877-61040899 CATCATATTTAGAAGGAGAAAGG - Intergenic
1009778161 6:68233052-68233074 CCACACATACAGGAGGAGAAGGG + Intergenic
1009925376 6:70114302-70114324 CCTCACAGTGAGAAGGATGATGG - Intronic
1010039782 6:71367941-71367963 CCCCACAACCACTAGGAGAATGG + Intergenic
1011364661 6:86568637-86568659 CCTCCCAATAAGTATGAGAAGGG - Intergenic
1012324544 6:97899640-97899662 CATCACGAACACAAGGAGAATGG - Intergenic
1012547498 6:100436152-100436174 ACTCACAATTAGAAGGAAGAGGG - Intronic
1013599737 6:111692738-111692760 CCTCAGACTCAGAAGGAGAGTGG - Intronic
1014558104 6:122857270-122857292 CCTCAGAAAAATAAGGAGAAAGG - Intergenic
1014787747 6:125637793-125637815 CCTAACAATCAGAAGTAGGTAGG - Intergenic
1014836407 6:126165891-126165913 CCTCAAAATGACAGGGAGAAAGG - Intergenic
1016025361 6:139281506-139281528 CCTCTCACTCAGTAGGAGAGTGG + Intronic
1016025830 6:139286056-139286078 CCTCTCACTCAGTAGGAGAGTGG + Intronic
1016839176 6:148508670-148508692 GCTCAGTATCCGAAGGAGAAAGG - Intronic
1017015326 6:150095096-150095118 CCTGACACTGAGCAGGAGAAAGG + Intergenic
1017146442 6:151239926-151239948 CCTCCCCATTAGCAGGAGAAAGG - Intergenic
1017437715 6:154432973-154432995 CCTCAACATCAGTAGGAGGAAGG + Intronic
1017601828 6:156091984-156092006 CCTCACAATAAGAAAGACATGGG + Intergenic
1019720816 7:2569489-2569511 CCTCACCCTCAGCAGGAGGAGGG + Intronic
1020731064 7:11881264-11881286 CCTCAGAAGCAGTAGGAGAATGG + Intergenic
1021466697 7:20952421-20952443 ACTGACAATCACAGGGAGAATGG + Intergenic
1021943013 7:25698069-25698091 CCTAACAAAGAGAATGAGAAGGG - Intergenic
1022637555 7:32151228-32151250 CCCCACAAACAGAATGATAAAGG + Intronic
1023625318 7:42109516-42109538 CCACACAATCAGAAAGTGAGAGG + Intronic
1026086877 7:67270012-67270034 GCTCACAGTCACAAGGAAAAAGG - Intergenic
1027932606 7:84556971-84556993 TCCCAAAATCAGAAAGAGAAAGG + Intergenic
1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG + Intronic
1032716098 7:134510580-134510602 ACACACAAGCAGGAGGAGAAGGG - Intergenic
1033254494 7:139788543-139788565 CCCCACATTCAGAAGGACCATGG - Intronic
1033886824 7:145959727-145959749 CTTCACCATAAGAAAGAGAAGGG + Intergenic
1035400728 7:158563761-158563783 CTTCACAATCTGAGGGATAAGGG - Intronic
1036223060 8:6937003-6937025 CCTCTCACTCAGAAGGCCAAAGG - Intronic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1041205609 8:55495370-55495392 CCACCCACTCAGAAGGAGCAGGG + Intronic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1042313962 8:67405828-67405850 CCTTTCAATCTCAAGGAGAAAGG - Intergenic
1045483310 8:102610367-102610389 CCTCCCACTCAGAGGGAAAATGG + Intergenic
1045925399 8:107575412-107575434 CCTCATAATCATCAGGAGAGAGG + Intergenic
1047627205 8:126668359-126668381 GCTCTCAATCAGAAGGAGACTGG - Intergenic
1047794012 8:128235425-128235447 CCTCCCAGTGAGAAGGACAAAGG + Intergenic
1047895155 8:129358410-129358432 CCCCATAAACAGAATGAGAATGG - Intergenic
1048544117 8:135370173-135370195 CTTCACATTCTGAAGAAGAATGG + Intergenic
1049100059 8:140572818-140572840 CCTCCCAATCGGAAGGGGCATGG + Exonic
1050489135 9:6168646-6168668 CCATACAATCAGAAGGAGTGTGG - Intergenic
1051841718 9:21405354-21405376 CCTCACTATCACATGGAAAATGG + Intergenic
1057009998 9:91592116-91592138 CCACACAAACTTAAGGAGAAGGG - Intronic
1057944263 9:99310990-99311012 TCTCACAATCATAAGGACAGGGG - Intergenic
1058648300 9:107151268-107151290 TCTCACAGCCTGAAGGAGAAGGG + Intergenic
1060759599 9:126236092-126236114 CCGCACAATCCGAAGGCGACTGG - Intergenic
1189546527 X:42047970-42047992 GCTCAGAACCAGACGGAGAAAGG - Intergenic
1189921100 X:45903992-45904014 CCACAAAAACAGAGGGAGAAGGG + Intergenic
1190478722 X:50853233-50853255 CCTCAGAAAGAGAAGGAAAAGGG - Intergenic
1190503560 X:51102862-51102884 CTTCATAATGAGAGGGAGAATGG + Intergenic
1191127048 X:56968110-56968132 ACTGACAACCAGAAGGAAAATGG + Intergenic
1192488756 X:71554793-71554815 ACTCCCAATGAGAAGGATAACGG - Intronic
1193804829 X:85982703-85982725 CCTCCCAACCAGAACCAGAATGG - Intronic
1196164016 X:112518527-112518549 ACTTACAACCAGAAGGTGAAGGG + Intergenic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic