ID: 1101089326

View in Genome Browser
Species Human (GRCh38)
Location 12:101268664-101268686
Sequence CAGTGGTACTAGAGTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101089326_1101089330 27 Left 1101089326 12:101268664-101268686 CCCCACTCACTCTAGTACCACTG No data
Right 1101089330 12:101268714-101268736 CTTTTCTAGAATGTCATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101089326 Original CRISPR CAGTGGTACTAGAGTGAGTG GGG (reversed) Intergenic
No off target data available for this crispr