ID: 1101089446

View in Genome Browser
Species Human (GRCh38)
Location 12:101270212-101270234
Sequence GATGGGCAGGTACCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101089446_1101089451 15 Left 1101089446 12:101270212-101270234 CCAGCTTGGGGTACCTGCCCATC No data
Right 1101089451 12:101270250-101270272 TTGTCAAAGAAATGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101089446 Original CRISPR GATGGGCAGGTACCCCAAGC TGG (reversed) Intergenic
No off target data available for this crispr