ID: 1101089451

View in Genome Browser
Species Human (GRCh38)
Location 12:101270250-101270272
Sequence TTGTCAAAGAAATGCAGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101089449_1101089451 -3 Left 1101089449 12:101270230-101270252 CCATCTCTAAGCCAATGATGTTG No data
Right 1101089451 12:101270250-101270272 TTGTCAAAGAAATGCAGCCTAGG No data
1101089448_1101089451 -2 Left 1101089448 12:101270229-101270251 CCCATCTCTAAGCCAATGATGTT No data
Right 1101089451 12:101270250-101270272 TTGTCAAAGAAATGCAGCCTAGG No data
1101089445_1101089451 16 Left 1101089445 12:101270211-101270233 CCCAGCTTGGGGTACCTGCCCAT No data
Right 1101089451 12:101270250-101270272 TTGTCAAAGAAATGCAGCCTAGG No data
1101089446_1101089451 15 Left 1101089446 12:101270212-101270234 CCAGCTTGGGGTACCTGCCCATC No data
Right 1101089451 12:101270250-101270272 TTGTCAAAGAAATGCAGCCTAGG No data
1101089447_1101089451 2 Left 1101089447 12:101270225-101270247 CCTGCCCATCTCTAAGCCAATGA No data
Right 1101089451 12:101270250-101270272 TTGTCAAAGAAATGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101089451 Original CRISPR TTGTCAAAGAAATGCAGCCT AGG Intergenic
No off target data available for this crispr