ID: 1101094085

View in Genome Browser
Species Human (GRCh38)
Location 12:101318075-101318097
Sequence TGGTGGGGAAGGTGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2835
Summary {0: 1, 1: 2, 2: 25, 3: 268, 4: 2539}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101094085_1101094096 21 Left 1101094085 12:101318075-101318097 CCTTCCACCCACCTTCCCCACCA 0: 1
1: 2
2: 25
3: 268
4: 2539
Right 1101094096 12:101318119-101318141 CCTTTTAACTTGCCTTCTACTGG 0: 1
1: 0
2: 1
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101094085 Original CRISPR TGGTGGGGAAGGTGGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr