ID: 1101094524

View in Genome Browser
Species Human (GRCh38)
Location 12:101323454-101323476
Sequence GTGTTGGAATGGTGTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101094524 Original CRISPR GTGTTGGAATGGTGTGAAAC AGG (reversed) Intronic
900312455 1:2040580-2040602 GTGGGAGAATGGTGTGAACCCGG + Intergenic
901600630 1:10420955-10420977 GTGGGAGAATGGTGTGAACCCGG - Intergenic
902491677 1:16786906-16786928 GTGGCAGAATGGTGTGAACCTGG - Intronic
903026678 1:20434402-20434424 GTGGGAGAATGGTGTGAACCCGG - Intergenic
904391333 1:30188254-30188276 CTGTGGGAATGGTGTGACGCTGG - Intergenic
906444950 1:45888454-45888476 GTGGGAGAATGGTGTGAACCCGG - Intronic
908183442 1:61628857-61628879 GTGAGAGAATGGTGTGAACCTGG - Intergenic
908734871 1:67265843-67265865 GTCTTGGTATGTTGTGAAGCTGG - Intergenic
909645824 1:77915533-77915555 GTGGGAGAATGGTGTGAACCCGG + Intronic
910697490 1:90035972-90035994 GAGGTAGAATGGTGTGAACCCGG + Intergenic
914918319 1:151831572-151831594 GGGTTGGCAGGGAGTGAAACTGG - Intronic
915633240 1:157168128-157168150 GTGTGGGAGAGGTGTTAAACAGG - Intergenic
918935354 1:190914528-190914550 GTGTTAGAATGGAGTGAGAGTGG + Intergenic
920443388 1:205997128-205997150 GGGTTGGCATGGTGAGAAATGGG + Intronic
920711709 1:208301615-208301637 GTTTTTGAAGGTTGTGAAACCGG + Intergenic
921531001 1:216283178-216283200 GTGGGAGAATGGTGTGAACCTGG - Intronic
922641782 1:227239876-227239898 GTGTTGAAATGGTGTCACAAGGG - Intronic
923267258 1:232326989-232327011 GTAGGAGAATGGTGTGAAACCGG - Intergenic
923528770 1:234795633-234795655 GTGGCAGAATGGTGTGAACCTGG + Intergenic
924632424 1:245753447-245753469 GTGGATGAATGGTGTGACACAGG + Intronic
1066513502 10:36128711-36128733 GTGGGAGAATGGTGTGAACCCGG + Intergenic
1066977714 10:42384807-42384829 GTGAGAGAATGGTGTGAACCTGG + Intergenic
1066979887 10:42403082-42403104 GTGGGAGAATGGTGTGAACCTGG + Intergenic
1068261530 10:54589692-54589714 GTGGGAGAATGGTGTGAACCCGG - Intronic
1071056145 10:81510287-81510309 GTGGGAGAATGGTGTGAACCCGG - Intergenic
1071879940 10:89886100-89886122 GTTTTGGTTTGGTGGGAAACAGG + Intergenic
1073161001 10:101394996-101395018 CTGTTGGAATCATGTGAGACTGG - Intronic
1073340653 10:102741990-102742012 GTGTTGGAAAAATGGGAAACAGG - Exonic
1073879526 10:107964564-107964586 TTGCTGGAATGGTTAGAAACTGG - Intergenic
1073997097 10:109328102-109328124 GAGTTGGGAGGGGGTGAAACTGG + Intergenic
1075237001 10:120739514-120739536 GTCTTGTAATGGTCTAAAACAGG - Intergenic
1075751498 10:124776009-124776031 GTGGGAGAATGGTGTGAACCCGG - Intronic
1076801018 10:132828335-132828357 GTGTTGGGAGGGTGTGGAACCGG - Intronic
1080740613 11:35060628-35060650 TTTTTGGTATGGTGTGAGACAGG - Intergenic
1082267258 11:50132308-50132330 ATGTGTGAATGGTGTGAAACAGG - Intergenic
1082288829 11:50346260-50346282 ATGTGTGAATGGTGTGAAACAGG + Intergenic
1083484307 11:62973830-62973852 GGCTTGGAGTGGTGTGAAACTGG + Intronic
1084237839 11:67799566-67799588 GGGATGGAATGGTGTAATACCGG + Intergenic
1087051164 11:93887802-93887824 GAGGTAGAATGGTGTGAACCTGG - Intergenic
1087663663 11:101017005-101017027 GCTTTGCAATAGTGTGAAACTGG + Intergenic
1088280173 11:108127356-108127378 GTGGGAGAATGGTGTGAACCCGG - Intronic
1088666556 11:112099498-112099520 GTGGGAGAATGGTGTGAACCTGG - Intronic
1090829331 11:130410062-130410084 GTGGTGGAAAGGTGTGAGAAGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092408513 12:8237163-8237185 GGGATGGAATGGTGTAATACCGG + Intergenic
1093163642 12:15779962-15779984 ATGTAAGAATGGTTTGAAACAGG + Intronic
1096265575 12:50119954-50119976 GTTATGGAATGGCGTTAAACAGG + Intronic
1097100623 12:56586236-56586258 GTGGGAGAATGGTGTGAACCCGG + Intronic
1097607388 12:61772320-61772342 GTTTTGGAATAGTGTGAATAGGG - Intronic
1101094524 12:101323454-101323476 GTGTTGGAATGGTGTGAAACAGG - Intronic
1101307518 12:103543985-103544007 GTGTGAGAATGGTGTGAACCCGG - Intergenic
1104986310 12:132599438-132599460 GTGGGAGAATGGTGTGAACCCGG - Intergenic
1105911254 13:24870033-24870055 GTGGGAGAATGGTGTGAACCCGG - Intronic
1109894436 13:68665825-68665847 TTGTTGCAATAGTTTGAAACTGG + Intergenic
1112293751 13:98168076-98168098 GTGGGAGAATGGTGTGAACCCGG + Intronic
1113871569 13:113563046-113563068 GTGTGGGAGTGGGGTGTAACTGG - Intergenic
1115615824 14:35093738-35093760 ATGGTGTAATGGTGTGAACCCGG - Intronic
1119910438 14:78345015-78345037 GTGTTGGGAGGGTATGAATCAGG + Intronic
1120130944 14:80807256-80807278 GTGATTGGATGGTGTGAAATTGG - Intronic
1123390143 15:19862796-19862818 GAGTTGCAATGGTGTGATATCGG - Intergenic
1127919989 15:63486588-63486610 GTGATGAAATGTTCTGAAACTGG - Intergenic
1130749211 15:86692082-86692104 CCTTTGGAATGGTGTGAACCCGG + Intronic
1131471732 15:92703729-92703751 GTGTTGGAGTTTGGTGAAACGGG - Intronic
1133186223 16:4100651-4100673 GTGTTAGAATGGTCTGATACAGG + Intronic
1133872530 16:9702577-9702599 CTGTTGGAATGGTTTTACACTGG - Intergenic
1134480789 16:14617288-14617310 GTAGGAGAATGGTGTGAAACTGG + Intronic
1138312545 16:56040288-56040310 GTGGGAGAATGGTGTGAACCTGG + Intergenic
1139536377 16:67577322-67577344 GTGGGAGAATGGTGTGAACCTGG + Intronic
1140075799 16:71697939-71697961 GTGGGAGAATGGTGTGAACCCGG - Intronic
1140226823 16:73084612-73084634 GTGGGAGAATGGTGTGAACCCGG - Intergenic
1140287970 16:73622466-73622488 GTGGGAGAATGGTGTGAACCGGG + Intergenic
1142051491 16:87961222-87961244 GTGTTGGTGTGGTGTCAAAGAGG + Intronic
1143214523 17:5214460-5214482 GTGGGAGAATGGTGTGAACCTGG + Intronic
1144223901 17:13125829-13125851 GTGTTGGAGATATGTGAAACAGG + Intergenic
1144423931 17:15123520-15123542 GTGTTGGGATGATGTGACATTGG + Intergenic
1145972967 17:28967746-28967768 GGGCTGGAATGGGGTGGAACTGG + Intronic
1149088299 17:52747304-52747326 GTGTGTGTATGGTGTGAGACAGG + Intergenic
1149521721 17:57322934-57322956 GTGTTGTGTTGGTGAGAAACAGG + Intronic
1149881206 17:60292913-60292935 TAGTTGGAATGGTGTGAACAAGG - Intronic
1149888905 17:60368174-60368196 AGGTTGGAATTGTATGAAACAGG - Intronic
1149901188 17:60481002-60481024 TTGATGGAGTGCTGTGAAACTGG - Intronic
1150653728 17:67025905-67025927 ATGCTGGAATGGTGTAGAACCGG - Intronic
1151471673 17:74322223-74322245 GTGAGGGAATGGAGTCAAACTGG + Intergenic
1153605875 18:6831070-6831092 GTGTTGCAATGATGTGGAAATGG - Intronic
1157111872 18:44828263-44828285 ATGTTGAAATGCGGTGAAACAGG + Intronic
1159132193 18:64291705-64291727 GTGTTGGAATTGAATCAAACTGG + Intergenic
1159320598 18:66842555-66842577 GTTTTGGTATGGGGTGATACTGG - Intergenic
1160906626 19:1454655-1454677 GTGGGAGAATGGTGTGAACCCGG - Intronic
1161654894 19:5508164-5508186 GTGGGGGAATGGCGTGAACCTGG - Intergenic
1163149500 19:15402612-15402634 GTGGTGGCAGGGTGTGGAACAGG - Intronic
1165574495 19:36802523-36802545 GTGGGAGAATGGTGTGAACCCGG - Intergenic
1165633956 19:37324866-37324888 GTGGGAGAATGGTGTGAACCCGG - Intronic
1167868250 19:52345796-52345818 GTGGGAGAATGGTGTGAACCCGG - Intronic
1167906667 19:52666068-52666090 GTGGGAGAATGGTGTGAACCCGG + Intronic
927013361 2:18929651-18929673 GTGTAGGAATGCTGTCAAATAGG - Intergenic
928530979 2:32190635-32190657 TTTTTGGTATGGTGTGAAGCAGG + Intronic
928853669 2:35779923-35779945 ATGTTGGGATGTTGTGAAACTGG + Intergenic
930009738 2:46927448-46927470 GTGGGAGAATGGTGTGAACCCGG - Intronic
931217692 2:60261881-60261903 GGGTTGGAAGGGTGGGAAAGGGG - Intergenic
931323177 2:61192524-61192546 GTTTTGGAATGGTGGAAAAGAGG + Intronic
931996238 2:67841939-67841961 GACATGGAATGGTGTGGAACTGG - Intergenic
935609748 2:105009527-105009549 GTGTGGTATTGGTGTAAAACTGG + Intergenic
943999460 2:194814034-194814056 GTGTTGCAAAGGTTTGAAAAGGG + Intergenic
945375249 2:209072232-209072254 GTGTTTGAATGGTGAGAATATGG - Intergenic
945482548 2:210360685-210360707 GTGGTAGTATGGTGAGAAACTGG + Intergenic
946138960 2:217671786-217671808 GTTTGGGGATGGAGTGAAACTGG - Intronic
946330718 2:219007589-219007611 GTGTAGGAAGGTTGTGAAATTGG + Intronic
946609835 2:221445494-221445516 GTGGGAGAATGGTGTGAACCAGG + Intronic
946896458 2:224329016-224329038 GAGTAGGAATGGTGTCAGACTGG + Intergenic
946948904 2:224850948-224850970 GTGTGAGAATGGAGTGATACAGG + Intronic
947239914 2:227983429-227983451 GTGTTAGGATGTTGTGAAAAGGG + Intronic
947357534 2:229312436-229312458 GTGCTGCCATGGTGTCAAACAGG - Intergenic
948604366 2:239125503-239125525 GTGCAGGAATGGCCTGAAACAGG + Intronic
948786703 2:240356387-240356409 GTGTGGGAAGGGTGTGAAGAGGG + Intergenic
1175312260 20:58020035-58020057 GTGTTGGCATGGTGTGAGGATGG + Intergenic
1180513288 22:16114844-16114866 GAGTTGTAATGGTGTGATATCGG - Intergenic
1184542849 22:45140991-45141013 GTGTTAAAATGGTGAAAAACAGG + Intergenic
1185136301 22:49075061-49075083 GTGGGAGAATGGTGTGAACCCGG + Intergenic
1185146510 22:49139940-49139962 GTGTCGGAATGGGGAGACACAGG - Intergenic
950290925 3:11783782-11783804 ATGTTTGAATGGTCTGAATCCGG - Intergenic
954018094 3:47713222-47713244 GAGGTAGAATGGTGTGAACCCGG + Intronic
954184083 3:48903522-48903544 GTGGGAGAATGGTGTGAACCCGG + Intergenic
955288823 3:57671434-57671456 GTGAGAGAATGGTGTGAACCCGG + Intronic
956891265 3:73616516-73616538 GTGGTGGAAATGTGTGAAAGAGG - Intronic
956994234 3:74805923-74805945 GTGGGAGAATGGCGTGAAACCGG - Intergenic
957053784 3:75429328-75429350 GGGATGGAATGGTGTAACACCGG + Intergenic
958486114 3:94711734-94711756 GTTGAGGAAGGGTGTGAAACGGG - Intergenic
960001310 3:112734927-112734949 GTGGTGAAGTGGAGTGAAACTGG - Intergenic
961245452 3:125448767-125448789 GTGGTAGAATGGTGTGAACCCGG - Intronic
961301063 3:125922351-125922373 GGGATGGAATGGTGTAATACCGG - Intergenic
962144694 3:132828562-132828584 GTGTTGGAATGATGTGTATATGG - Intergenic
962565874 3:136658916-136658938 GTATTTGGATGGTGTGAAAAGGG - Intronic
963311171 3:143711782-143711804 TTGCTGGAGTGGTGAGAAACAGG - Intronic
966797662 3:183730964-183730986 TAGTTGGATTGGGGTGAAACTGG + Intronic
967208854 3:187148999-187149021 GTAGGAGAATGGTGTGAAACTGG + Intronic
968996587 4:3949640-3949662 GGGATGGAATGGTGTAATACCGG + Intergenic
969333412 4:6492976-6492998 GTGTTGGAATGGAGTGAGGAGGG - Intronic
969757414 4:9159042-9159064 GGGATGGAATGGTGTAATACCGG - Intergenic
969817370 4:9696578-9696600 GGGATGGAATGGTGTAATACCGG - Intergenic
972868756 4:43269251-43269273 GTGGGAGAATGGTGTGAACCCGG + Intergenic
974225755 4:59041184-59041206 GTGTTTAAATTCTGTGAAACAGG - Intergenic
974804586 4:66861479-66861501 GTGGGAGAATGGTGTGAACCCGG - Intergenic
975696111 4:77014816-77014838 ATGTTGGAATTGTGTAAAAATGG + Intronic
976177083 4:82365653-82365675 GTGGTGCAATGGTGTGATCCTGG + Intronic
976330711 4:83828139-83828161 GAATTGGAATGGTGTGAGTCTGG + Intergenic
977350066 4:95872892-95872914 ATGTTGTAATTGTGGGAAACAGG + Intergenic
977784163 4:101013546-101013568 GTGGGAGAATGGTGTGAACCCGG + Intergenic
978396123 4:108281891-108281913 GTTTTGGAATGCTGAGAAAATGG + Intergenic
979920023 4:126484846-126484868 GTGTAGGAATGGTGGTAAAGAGG - Intergenic
981823397 4:148912371-148912393 GTCTTGAAATGCTGTGAAATTGG + Intergenic
981857977 4:149317794-149317816 GTGTTGGAGTGGAGTGAGAGAGG - Intergenic
984271759 4:177556934-177556956 GTGGGAGAATGGTGTGAACCCGG - Intergenic
986875215 5:12099039-12099061 GTGTTTGAAGGATGTAAAACAGG + Intergenic
990390962 5:55320309-55320331 GAGGTAGAATGGTGTGAACCCGG - Intronic
991421013 5:66442036-66442058 GAGTTGGATTTGTGTGAATCAGG + Intergenic
991689918 5:69215907-69215929 GTGGGAGAATGGTGTGAACCAGG + Intergenic
991716184 5:69453172-69453194 GTGGCAGAATGGTGTGAACCCGG + Intergenic
993105272 5:83593193-83593215 GTGTTGAAATGGTAAGAACCTGG + Intergenic
998479735 5:142452842-142452864 ATGGAGGAATGGTGAGAAACTGG - Intergenic
999966346 5:156813848-156813870 GTGTGGAAATGGTATGAAAATGG + Intergenic
1000883921 5:166728895-166728917 GTGTTTTAATAGTGTGGAACAGG - Intergenic
1003323493 6:5073979-5074001 GTGTTGGAATAGTGTCAGAATGG - Intergenic
1003446860 6:6192836-6192858 GGGGTGGAGTGGTGTGAAAGAGG + Intronic
1003891591 6:10568517-10568539 GTGTTAGAATGGTTTGAAGAGGG - Intronic
1003909080 6:10727173-10727195 GTGTTGGAGAGGAGGGAAACAGG - Intronic
1003912106 6:10752275-10752297 GTGTTGGAAAGGAGGGAAACAGG - Intronic
1003945687 6:11073094-11073116 GTGGGAGAATGGTGTGAACCCGG + Intergenic
1006345173 6:33475207-33475229 GTGGGAGAATGGTGTGAACCCGG + Intergenic
1007689818 6:43693255-43693277 GTTTTGTTATGGTCTGAAACTGG + Intergenic
1010695426 6:78968039-78968061 GAGGTAGAATGGTGTGAACCTGG + Intronic
1011383061 6:86763526-86763548 CTGTAGGAATGGTGTGGGACAGG + Intergenic
1012053801 6:94379100-94379122 GTGTTCGAATGGTGAAAAGCAGG - Intergenic
1012309068 6:97698384-97698406 GATTTGGAATGATGTGAGACTGG + Intergenic
1015212600 6:130715177-130715199 ATGCTGGCAAGGTGTGAAACTGG + Intergenic
1017180670 6:151548991-151549013 GTGAGAGAATGGTGTGAACCAGG - Intronic
1019201806 6:170322723-170322745 GGGTTGGAAAGGGGAGAAACTGG + Intronic
1020320871 7:6938054-6938076 GGGATGGAATGGTGTAATACTGG + Intergenic
1021823961 7:24529230-24529252 TTGTTTGAATGTTCTGAAACAGG - Intergenic
1021923248 7:25508338-25508360 GTGGGAGAATGGTGTGAACCCGG + Intergenic
1022439983 7:30425291-30425313 GTGTTGGAATGAGGTGAGGCTGG + Exonic
1027151434 7:75736793-75736815 GTGTCTGGATGGTGTGAAGCAGG - Intronic
1027182380 7:75949950-75949972 GTGGGAGAATGGTGTGAACCCGG - Intronic
1027669189 7:81074891-81074913 ATGTTGGAATGGTGTGCAGCAGG + Intergenic
1027679960 7:81207903-81207925 TTGTTGGAATTGTGTGATTCTGG - Intergenic
1027885741 7:83902056-83902078 GTGGTGGAATGGCGTGAACCCGG + Intergenic
1028582959 7:92425561-92425583 GAGTTGGAATGCAGGGAAACTGG + Intergenic
1029092327 7:98057975-98057997 GTTATGGAAAGATGTGAAACTGG + Intergenic
1029097572 7:98101087-98101109 GTGAGAGAATGGTGTGAACCCGG - Intergenic
1029949218 7:104565006-104565028 GTGATGGAATCTTGTGAACCTGG + Intronic
1031256990 7:119465557-119465579 CTGGTGGAAGGGTGTGAAAAAGG - Intergenic
1031337495 7:120554256-120554278 TACTTGAAATGGTGTGAAACTGG - Intronic
1035955231 8:4070449-4070471 GTGGGAGAATGGTGTGAACCCGG - Intronic
1036373538 8:8181050-8181072 GTGTGGTAAGGGTGAGAAACAGG - Intergenic
1036848916 8:12188264-12188286 GGGATGGAATGGTGTAATACCGG + Intronic
1036870277 8:12430542-12430564 GGGATGGAATGGTGTAATACCGG + Intronic
1039691894 8:39872942-39872964 GTAGTAGAATGGTGTGAACCTGG + Intergenic
1040573290 8:48628077-48628099 GTAGTGCAATGGTGTGATACTGG + Intergenic
1041476901 8:58277365-58277387 TTGCTGGTATTGTGTGAAACTGG + Intergenic
1042227815 8:66528192-66528214 GGGTTGGAATGATGTGAAGAAGG - Intergenic
1042418265 8:68553044-68553066 GTTTTGGAATTATGTAAAACTGG + Intronic
1044427079 8:92064139-92064161 GTGTGGGTATGCTTTGAAACAGG - Intronic
1045731195 8:105243714-105243736 GTGTTGGAAAAGAGTCAAACTGG + Intronic
1048173860 8:132134015-132134037 GTTTTGTAACAGTGTGAAACAGG + Intronic
1048609191 8:136003426-136003448 GGGTGGGAATGGTGTGAAAATGG + Intergenic
1048859991 8:138717239-138717261 GTGGGAGAATGGTGTGAACCCGG - Intronic
1048979179 8:139694019-139694041 GGGTTGGGATGGTGTCAAGCCGG - Intronic
1050901993 9:10961019-10961041 GTGGGAGAATGGTGTGAAACCGG + Intergenic
1052253466 9:26426846-26426868 GTGTGGGAGCGGGGTGAAACCGG + Intergenic
1053708962 9:40785812-40785834 GAGTTGCAATGGTGTGATATCGG + Intergenic
1054418872 9:64906614-64906636 GAGTTGCAATGGTGTGATATCGG + Intergenic
1055928025 9:81530845-81530867 TTGGTGGAGTGGTTTGAAACTGG - Intergenic
1055967627 9:81881087-81881109 GTGCTGGTGTGGGGTGAAACGGG + Intergenic
1057248026 9:93474685-93474707 GTGGGAGAATGGTGTGAACCTGG - Intronic
1059159444 9:112020028-112020050 GTGGGAGAATGGTGTGAACCCGG + Intergenic
1059840344 9:118208534-118208556 GTGTGGCAATGGTGTGAACAGGG + Intergenic
1061535239 9:131243923-131243945 GTGGGAGAATGGTGTGAACCCGG + Intergenic
1061653118 9:132067074-132067096 GTATTTGAATGGAGTGAAATTGG - Intronic
1062447782 9:136602830-136602852 GTGTAGGAATGGTGGGATGCTGG - Intergenic
1062666840 9:137678278-137678300 GTGTTTGAATGCTGTGGAAGTGG + Intronic
1185548638 X:966213-966235 GTGTGAGAATGGCGTGAACCCGG + Intergenic
1186269837 X:7874986-7875008 GTGTTGGAATCTTGTATAACTGG - Intergenic
1188923588 X:36010549-36010571 GTGGCAGAATGGTGTGAACCCGG - Intergenic
1189526918 X:41832342-41832364 TTGTTGGACTGGTGTGGAACTGG - Intronic
1191583700 X:62795045-62795067 GTGGGAGAATGGTGTGAACCTGG + Intergenic
1192348276 X:70331239-70331261 GTGTTGGAAGGGTCTGAGATAGG + Intronic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1193751306 X:85348437-85348459 GTGTTGGAAGGGTGGTAAAGTGG - Intronic
1200129632 X:153834089-153834111 GTGGGAGAATGGTGTGAACCCGG - Intergenic
1201100748 Y:10670909-10670931 GGTTTGGAATGGAGTGAAATGGG - Intergenic