ID: 1101097494

View in Genome Browser
Species Human (GRCh38)
Location 12:101357851-101357873
Sequence CAGTATCAGCAGCATCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101097486_1101097494 11 Left 1101097486 12:101357817-101357839 CCCCTCGCTGCTCCAAGCATGGC 0: 1
1: 0
2: 6
3: 36
4: 231
Right 1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 196
1101097490_1101097494 -1 Left 1101097490 12:101357829-101357851 CCAAGCATGGCACCTGGACAGAC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 196
1101097487_1101097494 10 Left 1101097487 12:101357818-101357840 CCCTCGCTGCTCCAAGCATGGCA 0: 1
1: 0
2: 0
3: 21
4: 180
Right 1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 196
1101097488_1101097494 9 Left 1101097488 12:101357819-101357841 CCTCGCTGCTCCAAGCATGGCAC 0: 1
1: 0
2: 0
3: 9
4: 170
Right 1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101097494 Original CRISPR CAGTATCAGCAGCATCTGAG GGG Intronic
900994043 1:6110700-6110722 CAGTATCAGCAGACACTGACAGG + Intronic
903358212 1:22761056-22761078 CAGCATCAGCATCACCTGGGAGG + Intronic
903997698 1:27318030-27318052 CAGTATATGCAGCATGTGGGAGG - Intergenic
904422805 1:30405051-30405073 GAGGATCTGCAGCATCTGGGTGG - Intergenic
904740241 1:32669267-32669289 CAGTGTGAGCATCAACTGAGTGG - Exonic
904817600 1:33217179-33217201 CAGTAACAGCACCATCTCAGTGG + Intergenic
904847145 1:33429096-33429118 CACTAGAGGCAGCATCTGAGAGG - Intronic
905214358 1:36396484-36396506 GTGTATCAGAATCATCTGAGGGG + Intronic
906194215 1:43920030-43920052 CCCTATCTGCAGCAGCTGAGGGG - Intronic
907466388 1:54640598-54640620 GGGAATCACCAGCATCTGAGAGG - Intergenic
907834352 1:58094880-58094902 CAGTGTCAGCATCAGCTGAGTGG - Intronic
908828711 1:68158234-68158256 CAGTGGCAGCATCACCTGAGAGG - Intronic
910461421 1:87451653-87451675 AAGTAAGAGCAGCATCTGATCGG - Intergenic
910567369 1:88659589-88659611 CAGCATCAGCAGCAACTCAGAGG + Intergenic
911372077 1:97005730-97005752 AAGTATCAGAAGTATCTTAGGGG - Intergenic
911507676 1:98773854-98773876 CAGTTTCAGCAACATCTGAGGGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
924897465 1:248357283-248357305 CAGTTTCAGCTGCATTTGTGGGG - Intergenic
1063349875 10:5344223-5344245 CAGTAGCAGCAGCAGCTGCTTGG - Intergenic
1064419569 10:15179261-15179283 CAGCAGCAGCAGTATCTGTGAGG - Intergenic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1069249093 10:66245810-66245832 CAGTATGACCAGAACCTGAGAGG - Intronic
1069819745 10:71220137-71220159 CAGAGTCAGAAGCAGCTGAGAGG - Intronic
1070457706 10:76633546-76633568 CTGTATCTGCAGCATCTGTGAGG - Intergenic
1071166379 10:82812212-82812234 GAATATCAGCATCAACTGAGAGG - Intronic
1076850441 10:133089885-133089907 CAGCACCAGCAGCACCTCAGGGG + Intronic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1081398859 11:42618905-42618927 CTATATTAGCAGCATCTGAAAGG - Intergenic
1081773299 11:45662811-45662833 GAGTCACAGCAGCAGCTGAGCGG + Intronic
1081993696 11:47350751-47350773 CAGCATGAGCTGCCTCTGAGGGG - Intronic
1082096068 11:48130288-48130310 CAGAAACAGCAGTTTCTGAGGGG + Intronic
1083067054 11:59935442-59935464 CAGTATCTTCAGCCTCTGAAAGG + Intergenic
1085401551 11:76238810-76238832 CAGCAGCAGCAGCTTCTGTGGGG - Intergenic
1086556050 11:88112252-88112274 AAGTCTCAGCATGATCTGAGTGG - Intergenic
1089925978 11:122258181-122258203 CATGATTAGCAGCATCAGAGGGG - Intergenic
1091591444 12:1845302-1845324 CAGTCTTAGAAGCCTCTGAGAGG + Intronic
1092708615 12:11310384-11310406 CAGAATCAGCAGCATCTCGCTGG + Exonic
1095726387 12:45457837-45457859 AAGCAGCAGCAGCATTTGAGAGG + Intergenic
1097122586 12:56746756-56746778 AAGTATCAGCAGTTTCTGAATGG - Intronic
1097506444 12:60478705-60478727 TAGAATCAGCAGCCTCAGAGAGG - Intergenic
1099544601 12:83962677-83962699 CTTTATTAGCAGCATCTGAACGG + Intergenic
1099865139 12:88270385-88270407 CAGTATCAGCAGCATGAAAACGG + Intergenic
1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG + Intronic
1101130930 12:101690386-101690408 CATTATCAGCAATATCTGGGAGG - Intergenic
1102571181 12:113827857-113827879 CAGTAACTGCAGAAACTGAGAGG - Intronic
1104488281 12:129171094-129171116 AAGTAGCAGCAGGATTTGAGAGG - Intronic
1104642011 12:130473419-130473441 GAGCAGCAGCAGCATCTGGGGGG + Intronic
1105554981 13:21438670-21438692 AAGTATCAGCAGGGTTTGAGAGG + Intronic
1114323253 14:21564610-21564632 CAGTGTAAGCATCAACTGAGTGG - Intergenic
1116334283 14:43637700-43637722 CAGCATCAGCAACATCTGGCAGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117190436 14:53284999-53285021 AATTATCAGTATCATCTGAGAGG + Intergenic
1118991813 14:70803538-70803560 TAGCACCACCAGCATCTGAGTGG - Intronic
1120227324 14:81805441-81805463 CAGCTTCAGCAACATCTTAGAGG - Intergenic
1121592434 14:95126116-95126138 CATCATCAGCAGCATCTGGGTGG - Intronic
1124430460 15:29603296-29603318 CAGCATCAGCAGCATCTGCAGGG + Intergenic
1125600095 15:40910759-40910781 CAGTTTCCCCACCATCTGAGGGG + Intergenic
1126141636 15:45444166-45444188 CAGCATCAGCATTACCTGAGAGG + Intronic
1127630923 15:60826949-60826971 TAGAATTAGCAGCATCTTAGTGG + Intronic
1127961555 15:63894405-63894427 CAGCATCAGCAGGGTCAGAGAGG + Intergenic
1128497997 15:68209221-68209243 CAGCATCCTCATCATCTGAGAGG + Intronic
1130215979 15:81970245-81970267 CATGATCACCAGCATATGAGAGG + Intergenic
1130431397 15:83850986-83851008 CAGTATCAGCATCACCTGGGAGG + Intronic
1131925732 15:97381795-97381817 CAATATCTGCATCATCTGAAAGG - Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1135183455 16:20294643-20294665 CTGTATTAGCATCACCTGAGGGG - Intergenic
1139821107 16:69722065-69722087 CATTATCAGGAGCAACTGTGGGG - Intronic
1140030688 16:71335948-71335970 CAGTCTCACCAACATCTGTGGGG + Intergenic
1140216884 16:73015803-73015825 CTGTCTCCGCAGCACCTGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143473755 17:7191768-7191790 CGGTTTCAGCAGCCCCTGAGGGG - Intronic
1147964826 17:44188980-44189002 CAGCATCAGCAGAGCCTGAGGGG - Intronic
1149092567 17:52801728-52801750 CATCAGCAGCAGCATCTGAAGGG + Intergenic
1149849906 17:60028215-60028237 CACCAGCAACAGCATCTGAGAGG + Intergenic
1149860262 17:60118309-60118331 CACCAGCAACAGCATCTGAGAGG - Intergenic
1150469953 17:65428791-65428813 GAGTAGCAGAATCATCTGAGGGG + Intergenic
1151204176 17:72493313-72493335 CACTTTCTCCAGCATCTGAGAGG + Intergenic
1151372730 17:73658965-73658987 CACCATCAGCAGCATATGAAAGG - Intergenic
1151737538 17:75953920-75953942 CAGTAAAAGAAGCATCAGAGTGG + Intronic
1152816361 17:82410420-82410442 CAGCACCAGTAGCCTCTGAGTGG + Intronic
1155359252 18:24983658-24983680 CAGTATGAAGAGAATCTGAGAGG - Intergenic
1159047769 18:63385652-63385674 CAGCATCACCAGCATCTAACTGG - Intergenic
1159320179 18:66838268-66838290 CAGTATGTGCAGTATGTGAGAGG + Intergenic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1162809454 19:13155287-13155309 CAGTATCAGGTGGAGCTGAGCGG + Intergenic
1164909109 19:31991407-31991429 CAGTCCCAGCACCATCTGGGAGG - Intergenic
1164952847 19:32353109-32353131 TAGTATCAGCAGCAGGTGACTGG - Exonic
1165779470 19:38423895-38423917 CAGGAACAGCAGCCTCTGGGAGG - Intronic
1166268133 19:41697319-41697341 CAGAACCAGCAGCATCTGGCTGG - Intronic
1166644692 19:44522898-44522920 CAGGATCAGGACCATCTGAGAGG + Exonic
1167251004 19:48398430-48398452 CAGCAGCAGCAGCATCTTAGCGG - Exonic
1167681099 19:50921939-50921961 CAGCATCAGCAGGTGCTGAGTGG + Intergenic
1168385559 19:55960207-55960229 CAGTTTCAGCACCGACTGAGTGG - Intronic
925478016 2:4240381-4240403 CAGCACCACCAGCATCTCAGAGG - Intergenic
925818123 2:7773351-7773373 GGGTATCAGCAGCATCGGAAGGG + Intergenic
928170934 2:29002599-29002621 CACCCTCAGCAGCCTCTGAGAGG - Exonic
928924482 2:36563977-36563999 GAGGCACAGCAGCATCTGAGAGG - Intronic
931266658 2:60666360-60666382 CATTTTCAGGGGCATCTGAGAGG + Intergenic
935719956 2:105971318-105971340 CAGCATCAGCAGGATTTCAGGGG - Intergenic
937121041 2:119440113-119440135 CAGGACCAGCATCATCTGAGAGG - Exonic
937843559 2:126552575-126552597 CAGAATCCACAGCATCTGAGAGG + Intergenic
938168823 2:129057039-129057061 AAGCAGCAGCAGCATCTGAGAGG - Intergenic
939681347 2:145137839-145137861 CATTATCATCAGCATCTTCGTGG - Intergenic
939741929 2:145918640-145918662 CAGTTTCAGCATCACCTGGGAGG - Intergenic
940985728 2:160050250-160050272 CAGTGTCACCAGACTCTGAGCGG + Intronic
944952257 2:204765216-204765238 CAGCATCAGTATCACCTGAGAGG + Intronic
946588461 2:221216963-221216985 GAGGATCAGCAGCTTCTGACAGG + Intergenic
947240918 2:227993661-227993683 CACTGTCAGCAGCATGTTAGAGG - Intronic
948815992 2:240510570-240510592 CAGGGTCTGCCGCATCTGAGGGG - Intronic
1170330199 20:15201046-15201068 CAGCAGCAGCAGCACCTGGGAGG - Intronic
1172511372 20:35503468-35503490 CTGCATCAGCTGCCTCTGAGTGG - Exonic
1172546823 20:35768248-35768270 CAGTCACAGTAGCATCTGAAAGG - Intergenic
1173471057 20:43323981-43324003 CAGTAAGAGCAGCCTCTGAGGGG + Intergenic
1174396179 20:50248158-50248180 CAGGACCAGCCGCATCTGTGGGG + Intergenic
1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG + Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1176360185 21:5988718-5988740 CAGCAGCAGCAGCATCTGGCAGG - Intergenic
1178270334 21:31183587-31183609 CATTTTCTGCAGAATCTGAGTGG - Intronic
1179170293 21:38967853-38967875 AAGACTCAGCAGCATATGAGTGG - Intergenic
1179763333 21:43549832-43549854 CAGCAGCAGCAGCATCTGGCAGG + Intronic
1180188852 21:46153294-46153316 CAGGAGCAGCAGCACCTGAGCGG + Intronic
1181412894 22:22737268-22737290 CAGCATCAGCAACATCTGTGAGG - Intronic
1181773292 22:25142269-25142291 GAGTATCAGCGCCATCTCAGTGG - Intronic
1181785175 22:25221623-25221645 CAGTATCAGCTCCAACTGTGTGG - Intronic
1183327606 22:37202943-37202965 CAGCATCAGCATTATCAGAGGGG - Intergenic
950246210 3:11421332-11421354 AAGTGGCAGCAGCATTTGAGAGG - Intronic
950866162 3:16190803-16190825 GAGGACCAGCAGCAGCTGAGCGG - Intronic
953789295 3:45934975-45934997 CAGCATCAACAGCTTGTGAGTGG + Intronic
953832456 3:46312215-46312237 CAGTATTAGCAGAAACTTAGTGG - Intergenic
954754404 3:52831412-52831434 CAGTGCCAGCAGCTCCTGAGGGG + Exonic
955741401 3:62094803-62094825 AAGTTTCAGCAGCAGCTGAGGGG - Intronic
955906496 3:63813348-63813370 TGATATCAACAGCATCTGAGAGG + Intergenic
963969277 3:151411431-151411453 CAGATTCAGCAGCAGCCGAGTGG + Exonic
965997463 3:174902097-174902119 CAGCATCAGCAACACCTGGGCGG - Intronic
970873427 4:20842759-20842781 CAGTGACAGCAGCGTGTGAGAGG + Intronic
971741558 4:30527571-30527593 CAGTAACAGCAGAATATGACTGG + Intergenic
975440061 4:74399785-74399807 CAGAATCAGCAGCCCCTCAGAGG - Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
983757740 4:171362166-171362188 CTGTTTCAGCAGTAACTGAGTGG - Intergenic
983868919 4:172802224-172802246 CAGTTTCAGCACTAGCTGAGTGG + Intronic
986198664 5:5561267-5561289 CAGTACCAGAGGCATCTCAGAGG - Intergenic
986431169 5:7682625-7682647 CAGTTTCAGCATCATCAGGGAGG + Intronic
986873583 5:12079813-12079835 CATTATCAGCAGCATATAAATGG - Intergenic
989598002 5:43175001-43175023 CAGCCTCAGCAGCATCTGCTTGG - Exonic
991077653 5:62559455-62559477 AAGCAGCAGCAGAATCTGAGAGG - Intronic
994961209 5:106604995-106605017 AAGCAGCAGCAGGATCTGAGAGG + Intergenic
998510493 5:142709855-142709877 CAGAAGCAGCAGCATTTGAGAGG + Intergenic
998608279 5:143659670-143659692 CTGTATCAGCAGTGTCTGGGAGG - Intergenic
998856609 5:146400474-146400496 CAGCATCTGCTGCATCTCAGAGG - Intergenic
1000782537 5:165500563-165500585 AAGCAGCAGCAGCATTTGAGAGG - Intergenic
1000943458 5:167391850-167391872 GAGAATCAGCAGCATAGGAGTGG + Intronic
1002839269 6:892252-892274 CAATATCAGCAGCATCTGCATGG - Intergenic
1002870745 6:1165427-1165449 CAGTATCCACAGCATTTCAGGGG - Intergenic
1004813161 6:19282031-19282053 CAGGATCACCAGCATGTGGGTGG + Intergenic
1007446855 6:41913217-41913239 CAGCATTAGCATCATCTGAAAGG - Intronic
1009919734 6:70042725-70042747 AAGTAACAGCAGCATTTGAGAGG - Intronic
1011019902 6:82801336-82801358 AAGCAGCAGCAGCATTTGAGAGG + Intergenic
1014210224 6:118700768-118700790 CAGTAACAGCATCATCAGACAGG + Intronic
1016343948 6:143090948-143090970 AAGCAGCAGCAGGATCTGAGAGG - Intronic
1016568767 6:145489739-145489761 CAGCCTCAGCAGCATCTGCTTGG + Intergenic
1016946484 6:149539247-149539269 CAGTAGTAGCAGGGTCTGAGAGG + Intronic
1017911469 6:158796462-158796484 CAATATCAGCAGCAAGGGAGAGG - Intronic
1018213146 6:161501699-161501721 CAGTTTCTCCAGCATCTGAGAGG - Intronic
1020083758 7:5299627-5299649 GAGTGTCAGCTGCATCTGGGAGG + Intronic
1020460353 7:8423338-8423360 CAGACTGAGCAGCATCTGAAGGG - Intergenic
1020725663 7:11810547-11810569 CAGTAACAGCAGCATTGGGGTGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021148425 7:17118773-17118795 AAGTAGCAGCAGGATTTGAGAGG - Intergenic
1021340514 7:19457943-19457965 CAGTATCAACAGCAGCTCATTGG + Intergenic
1021341540 7:19469225-19469247 CAGTAGGAGCAGTATCAGAGTGG - Intergenic
1022898925 7:34782284-34782306 CAGTATCACCAGTGTCTGATGGG - Intronic
1025796072 7:64739032-64739054 CAGCATCCGCCCCATCTGAGAGG - Intergenic
1025923987 7:65941630-65941652 CAATACCAGCAGCACCTTAGAGG - Intronic
1026473306 7:70712522-70712544 CAATATCTGCATCCTCTGAGTGG + Intronic
1028485156 7:91349284-91349306 CAGTATTACCACCATTTGAGAGG + Intergenic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1032466571 7:132149669-132149691 CAGAAGTATCAGCATCTGAGAGG - Intronic
1033321670 7:140345489-140345511 CTGTCTCAGCAGCATCTTAAGGG + Intronic
1034516161 7:151581881-151581903 CAGTATCTGCAGCATTTTGGGGG - Intronic
1035418109 7:158706057-158706079 CAGACTCAGCATCCTCTGAGTGG - Intergenic
1037233750 8:16691469-16691491 CATTCTCAGCAGAATGTGAGCGG - Intergenic
1038652852 8:29421393-29421415 CAGCATCAGCATCACTTGAGAGG - Intergenic
1039085641 8:33776985-33777007 AAGCATCAGAAGCATCTGTGTGG - Intergenic
1039438056 8:37574477-37574499 GAGTCTCAGCAGCCTCTAAGAGG + Intergenic
1039782182 8:40796662-40796684 CAGTCTCTGCAGCAGCTGTGCGG - Intronic
1042678418 8:71349480-71349502 TAGTACCAGTGGCATCTGAGTGG - Intronic
1043314538 8:78903874-78903896 CAGTATGAGCACAAGCTGAGAGG - Intergenic
1047777857 8:128088389-128088411 CACTTTCAGCAGCAGCAGAGGGG + Intergenic
1048199743 8:132362445-132362467 CAGTTCCAGCAGAAACTGAGAGG + Intronic
1048298574 8:133234752-133234774 GGGTTTCAGCAGCATCTGGGAGG - Intergenic
1051084807 9:13336195-13336217 AAATATCAGCAGGATTTGAGAGG - Intergenic
1055434936 9:76283183-76283205 AAGTAGCAGCAGAATTTGAGAGG + Intronic
1055659080 9:78483714-78483736 CAGTCTCAGAAGCATAGGAGAGG - Intergenic
1055912907 9:81372241-81372263 CTTTAGCAGGAGCATCTGAGGGG - Intergenic
1056578438 9:87872901-87872923 CACTCTCAGAAGCATCTTAGGGG + Intergenic
1057977825 9:99625190-99625212 CAGCATCAGCATCACCTGGGAGG - Intergenic
1058939910 9:109803534-109803556 CAAAATCACCAGCATCTCAGGGG - Intronic
1058989971 9:110246107-110246129 CAGTATCAGAATTACCTGAGGGG + Intronic
1059509245 9:114828494-114828516 CAGTATCAGTATCATCAGAATGG - Intergenic
1060014890 9:120078633-120078655 CTGCCTCAGCAGCATCTGAAGGG + Intergenic
1060378301 9:123139174-123139196 GAGTATCAGCAGTAACTGATGGG - Intronic
1185691435 X:2158353-2158375 CATTATCAGCAGCATCCAAACGG + Intergenic
1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG + Intergenic
1185922507 X:4109244-4109266 CAGATTCAGCAGCATTGGAGTGG - Intergenic
1187733740 X:22282944-22282966 CAATATCAGCAGCATCATCGGGG + Intergenic
1187886259 X:23891547-23891569 GAGCATCAGTAGCATATGAGTGG - Intronic
1188422809 X:30010103-30010125 CAGTGTCAACTGCAACTGAGTGG + Intergenic
1188834869 X:34943644-34943666 CAGTATCAGGAGGCTCTGGGTGG - Exonic
1190433194 X:50397626-50397648 TTGTATCAGAAGCATCTGAAAGG - Intronic
1190827602 X:54031946-54031968 CAGCATCAGCATCACCTGAGAGG - Intronic
1192276820 X:69640582-69640604 CAGTCTCAGCAACTTATGAGAGG - Intronic
1192772014 X:74203017-74203039 CAGTAGCAGCAGCACCTCAAAGG - Intergenic
1195219695 X:102734525-102734547 CAGAATCAGTAGAACCTGAGAGG + Intronic
1197733193 X:129829230-129829252 CAGAATCAGCAGCACCTCAAGGG + Intronic
1197798525 X:130324085-130324107 CATTATTAGCAGCATGAGAGAGG - Intergenic
1197874278 X:131087213-131087235 CATTATCTGAAGCATCTGCGTGG - Intronic
1199900376 X:152166791-152166813 CAGAATCAGCACAATCTCAGCGG - Exonic