ID: 1101101071

View in Genome Browser
Species Human (GRCh38)
Location 12:101393237-101393259
Sequence CTGTTGAAATGTAAGCTCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101101071_1101101072 -5 Left 1101101071 12:101393237-101393259 CCTCAGAGCTTACATTTCAACAG 0: 1
1: 1
2: 3
3: 22
4: 259
Right 1101101072 12:101393255-101393277 AACAGTTTAAAGTGCATCTCAGG 0: 1
1: 0
2: 1
3: 20
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101101071 Original CRISPR CTGTTGAAATGTAAGCTCTG AGG (reversed) Exonic
903278115 1:22234167-22234189 CTGGAGGAATGTAAGCTATGAGG - Intergenic
904268632 1:29333369-29333391 CGGATGACATGGAAGCTCTGTGG - Intergenic
904401822 1:30261902-30261924 ATGTTGAAATGTAATCTCCAAGG - Intergenic
905741105 1:40372644-40372666 CTGATGAGATGAAAGCTTTGAGG + Intronic
907330527 1:53668143-53668165 CTGTTAAAATATCAGTTCTGAGG - Intronic
908466417 1:64400512-64400534 CTGCTAAACTGTAAGCTCCGTGG + Intergenic
910556626 1:88541615-88541637 CTGTTGAAATGTAATCCCTAAGG - Intergenic
913046751 1:115080072-115080094 CTGGAGAAATATAAGCTCAGGGG + Intronic
913077417 1:115352845-115352867 GCGTTGGGATGTAAGCTCTGTGG + Intergenic
915274911 1:154781830-154781852 CCCCTGAAATGTAAGCTCTGTGG - Intronic
915952601 1:160199514-160199536 TTTTAGAAATGTAAGATCTGAGG + Intronic
916391528 1:164335994-164336016 GTTGAGAAATGTAAGCTCTGGGG - Intergenic
916400786 1:164446524-164446546 CTATTAAAATGTATGCTCAGAGG + Intergenic
917450876 1:175146469-175146491 CTGTTTAGATATTAGCTCTGGGG - Intronic
918592125 1:186251875-186251897 CTCCTTAAATGTAAGCTCTGAGG - Intergenic
919002229 1:191847371-191847393 TTGTTGAAGTGTGAGCTCAGAGG - Intergenic
919855717 1:201704730-201704752 CTGTTGAATCAGAAGCTCTGGGG + Intronic
920830415 1:209459924-209459946 ATGTTGAAATGTAACCTCCAAGG + Intergenic
921600432 1:217100872-217100894 CTGTTGAAATGTAATCCCCAAGG - Intronic
921845150 1:219871216-219871238 CTGTTTAGATGTAAGGTGTGAGG - Intronic
922252185 1:223859539-223859561 CTGTTCAAATGTCATCTCTTTGG - Intergenic
922907293 1:229183939-229183961 TTGTTCTCATGTAAGCTCTGGGG - Intergenic
1062962485 10:1583168-1583190 ATATTGAAATGTGACCTCTGTGG - Intronic
1062992621 10:1834480-1834502 CTGTTGCAATGAGAGCTCAGTGG - Intergenic
1063391831 10:5654784-5654806 CTGTGTAAAAGTAAGATCTGGGG - Intronic
1064218133 10:13417575-13417597 CTGTGCAAATGTCAGGTCTGTGG + Intergenic
1065738437 10:28774806-28774828 ATGTTGAATTGTAATCCCTGGGG + Intergenic
1067739659 10:48885194-48885216 CTGTTGAATTGAAACTTCTGGGG + Intronic
1067915821 10:50396889-50396911 CTGTTAAAAAGAAAGCTGTGTGG + Intronic
1067971712 10:50978717-50978739 CTGTTGAACTGTAAGGTCCTAGG + Intergenic
1069281559 10:66660874-66660896 CTATTGAAATGTGAGCTCCATGG + Intronic
1069647060 10:70008082-70008104 CTGGTAAAAAGTAAGGTCTGGGG - Intergenic
1071400067 10:85260245-85260267 CTGTGGAACTATAAGCTTTGAGG + Intergenic
1071654906 10:87437224-87437246 CTGTTGCACTGTAAATTCTGAGG - Intergenic
1074401071 10:113141461-113141483 GTGTTGAAAAGGAAGCTCTTTGG + Intronic
1074736372 10:116438366-116438388 CTGATGGAAAGTAAGCCCTGAGG - Intronic
1075140171 10:119826471-119826493 CTGTTTTAATGTCAACTCTGAGG + Intronic
1076146185 10:128124740-128124762 CAGGTGAAATGTCACCTCTGAGG - Intronic
1078535752 11:12172221-12172243 CTGCTAAAATGTAAGCTCCATGG + Intronic
1079961474 11:26929377-26929399 CTGATCAAATGTCAGCTGTGAGG + Intergenic
1083390608 11:62347073-62347095 CTGTTTTAATGTAACTTCTGAGG + Intronic
1083557853 11:63646189-63646211 CGCTTAAAAAGTAAGCTCTGTGG - Intronic
1084586590 11:70066034-70066056 CCGCTGGAAGGTAAGCTCTGTGG + Intergenic
1085619114 11:78023932-78023954 GTGTTAAAATGTAAAGTCTGAGG + Intronic
1086569452 11:88264926-88264948 ATGTTGAAATGTAATCTCAGGGG - Intergenic
1086968504 11:93055185-93055207 CTCTTGAAAGCTAATCTCTGTGG - Intergenic
1087288613 11:96295484-96295506 CTCTTCAAATGTAAGCTATGAGG + Intronic
1088527132 11:110769104-110769126 CTGTTGCATTGTGAGTTCTGAGG - Intergenic
1089338105 11:117739497-117739519 CTGTTGATATGTAGGCTTTGTGG - Intronic
1095762795 12:45858925-45858947 CTTTTGAGTTCTAAGCTCTGAGG - Intronic
1097357885 12:58622118-58622140 ATATTGAAATGTATGCTTTGAGG + Intronic
1097471159 12:59993840-59993862 CTTTTGAAATGTAAACATTGAGG - Intergenic
1098611540 12:72464483-72464505 ATGTTGAAATGTAATCTCTGTGG - Intronic
1098881352 12:75920517-75920539 CTCTGGAAATGTAAGCTCAGTGG + Intergenic
1101101071 12:101393237-101393259 CTGTTGAAATGTAAGCTCTGAGG - Exonic
1101142471 12:101810650-101810672 CCTTTAAAATGTAGGCTCTGTGG - Intronic
1101587484 12:106097810-106097832 CTGCTGAATTGGAAACTCTGGGG - Intronic
1102767110 12:115443108-115443130 CTGATGAAAACTCAGCTCTGGGG + Intergenic
1103392328 12:120583656-120583678 CTGTTGAAATGAAGGCTGGGAGG - Intergenic
1104570505 12:129920995-129921017 CTGGAAAAATGAAAGCTCTGGGG - Intergenic
1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG + Intronic
1106635173 13:31521380-31521402 CTGTTGAAATGTTAATTCTTTGG + Intergenic
1106809065 13:33341807-33341829 TTTTTGAGATGGAAGCTCTGTGG + Intronic
1108412081 13:50159776-50159798 CTGTTGCCATGTAAACACTGAGG - Intronic
1109372036 13:61435214-61435236 CTGAGGAAAAGTAAGGTCTGTGG + Intergenic
1110093155 13:71480066-71480088 TTATTAAAATGTAAGCTCTCTGG + Intronic
1110392095 13:74985708-74985730 CTTTTAAAATGTAAATTCTGTGG + Intergenic
1110854444 13:80280577-80280599 GTTTTGAAATGTATCCTCTGTGG - Intergenic
1112469259 13:99673019-99673041 CTGCTGAATTGTAAGCTCTAGGG - Intronic
1113043760 13:106131808-106131830 CTGCTGAGATCTGAGCTCTGTGG - Intergenic
1116529239 14:45947261-45947283 CTGTTAAAATGTAAGCCAAGTGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118661087 14:68013249-68013271 TTTTTGAAATGTTTGCTCTGAGG - Intronic
1118707771 14:68495732-68495754 CTGTAGAAGTGTCAGCTCTGAGG + Intronic
1119790353 14:77344443-77344465 CTGTTTAAATGCAAGTCCTGGGG - Intronic
1119910942 14:78348719-78348741 CTGTTGAATTAGAAACTCTGGGG + Intronic
1119970538 14:78965300-78965322 CTTTTGAATTCTAAACTCTGAGG + Intronic
1120984757 14:90324784-90324806 CTGTTCAAATGTACGCACAGAGG - Intronic
1122082664 14:99276598-99276620 CTGTTGAAAGGCAAGTTTTGTGG - Intergenic
1122475468 14:102005398-102005420 CTGTTGAAAGGTAATCTCAGGGG + Intronic
1123158957 14:106258718-106258740 CTGACCAAATGTGAGCTCTGGGG - Intergenic
1123192827 14:106587322-106587344 CTCTGCAAATGTGAGCTCTGGGG - Intergenic
1124591950 15:31061429-31061451 CTGCTGAAAGGTGAGCTCTCAGG - Exonic
1126112290 15:45182452-45182474 CTGAATAAATGTTAGCTCTGAGG + Intronic
1126257837 15:46649015-46649037 CTGTTGCAGTGTCAGCACTGAGG + Intergenic
1126275791 15:46879222-46879244 CTGTTGAATTGATAGCTCTGAGG - Intergenic
1126983463 15:54274069-54274091 CAATTGTAATGAAAGCTCTGGGG - Intronic
1127286030 15:57534516-57534538 CTCTTGAAATGAAGGCTCTCTGG + Intronic
1129153162 15:73701999-73702021 CCATTAAAATGTAAGTTCTGTGG + Intronic
1129786808 15:78315176-78315198 CTGCTGAAAGGTAAGGTCTCAGG + Intergenic
1130356507 15:83135997-83136019 CTATTGAAAGGGAAGCACTGGGG - Exonic
1132237633 15:100234049-100234071 CTGTTGAAGAGGAAGCTCCGTGG + Intronic
1135388326 16:22065411-22065433 TTGCTGAAATAGAAGCTCTGGGG - Intronic
1136929994 16:34410090-34410112 CTGTGCAAATGTCAGGTCTGTGG - Intergenic
1136974580 16:35001715-35001737 CTGTGCAAATGTCAGGTCTGTGG + Intergenic
1137507540 16:49067442-49067464 CTGCTGGATTGGAAGCTCTGGGG + Intergenic
1137550717 16:49435714-49435736 CTTTAGAAATGTCAGATCTGGGG - Intergenic
1141759255 16:86016691-86016713 CTGTTGAATTCAAATCTCTGAGG - Intergenic
1142590239 17:1001615-1001637 CTTTTGAACTGTAAGGTGTGTGG - Exonic
1143035411 17:3992888-3992910 CTGTTAAACTGTAAGCTCCATGG - Intergenic
1146217490 17:30989404-30989426 CTATTAAAATATAATCTCTGGGG + Intronic
1146647466 17:34584674-34584696 CAGTTGAAAAGGGAGCTCTGGGG + Intronic
1147887338 17:43692984-43693006 CTGATTAAATGTTAGCTATGTGG - Intergenic
1148149776 17:45389727-45389749 CTGGAGAAATGTCTGCTCTGAGG + Intergenic
1148536080 17:48440232-48440254 CTCCTGCAATGGAAGCTCTGTGG + Intergenic
1149095095 17:52830089-52830111 ATGTTGAAACTTAAGCCCTGAGG - Intergenic
1150047559 17:61928181-61928203 ATGATGAAATTTAAGTTCTGAGG - Intergenic
1151123112 17:71814932-71814954 CTGCTGAAATGTAAACTCAAGGG - Intergenic
1153166791 18:2270820-2270842 ATGTTGAAATGTAATCTCCAAGG + Intergenic
1155569852 18:27181202-27181224 TTGTTGAATTGTTAGTTCTGTGG - Intronic
1156584418 18:38415930-38415952 CTGGTGGAATTTCAGCTCTGTGG + Intergenic
1157203493 18:45679194-45679216 CAGTTGAAATGTAAACTTTTGGG - Intronic
1157870294 18:51224104-51224126 CTCTTGAAATGTAAGATATAGGG - Intergenic
1158225201 18:55193712-55193734 CTGGTAAAATCCAAGCTCTGTGG + Intergenic
1158772589 18:60538201-60538223 CTGTTTAAATTTAATATCTGGGG - Intergenic
1163092003 19:15026728-15026750 CAGCTGAAATCTCAGCTCTGAGG - Intergenic
1166253973 19:41589430-41589452 CTGCTGAAATGTAGGATGTGAGG - Intronic
1168423655 19:56221897-56221919 CTCTTTCAATGTAATCTCTGTGG - Exonic
926012311 2:9417866-9417888 CAACTGAAATGGAAGCTCTGAGG + Intronic
927274125 2:21247074-21247096 CTAATAGAATGTAAGCTCTGTGG + Intergenic
927403039 2:22735575-22735597 CTGTTAAACTGTAAGATTTGTGG - Intergenic
927655312 2:24940234-24940256 CTGATGAAATTTTAGCTATGAGG - Intergenic
927911176 2:26901116-26901138 CTGTAGAAATGGGAGATCTGGGG - Intronic
928521511 2:32093630-32093652 CTGTTGGAATATAAACTCTATGG + Intronic
928524730 2:32128293-32128315 CTCTAAAAATGTAAGCTATGAGG - Intronic
928726978 2:34185846-34185868 TTGCTGCAATGTAAGCTCTAGGG - Intergenic
929312640 2:40443440-40443462 TTGTTGAATTGTAAGGTCTTAGG + Intronic
931380695 2:61750588-61750610 CAGTGGAAATGTAAGCTCCATGG - Intergenic
931610811 2:64098061-64098083 CAGTTGAAATGTCAGCTCTCTGG - Intronic
933309321 2:80640248-80640270 CTGTTAAAATGTCTGCTCTTGGG + Intronic
933821112 2:86112880-86112902 TTGTTGAAATGTATGTTCTTAGG + Intronic
934087264 2:88520292-88520314 ATGTTGAAATTTAATCTATGTGG - Intergenic
935188439 2:100755874-100755896 TTGTTGAAATGTTACCTCTAAGG - Intergenic
935959710 2:108412975-108412997 CTGGTGCAATGTGAGCTCTTTGG + Intergenic
937151203 2:119687086-119687108 CTGTTGTAATCTAATCACTGAGG - Intergenic
938122215 2:128641935-128641957 CTGCTGAAAGGGAATCTCTGGGG + Intergenic
939215358 2:139230626-139230648 CAGATAAAATGTAAGCTGTGAGG + Intergenic
939418174 2:141928270-141928292 CTATTAAAATGTAATTTCTGAGG - Intronic
939539130 2:143472000-143472022 CAGATGGAATGTCAGCTCTGGGG - Intronic
939633153 2:144549958-144549980 CTGCTGGACTGTAAGCTATGAGG + Intergenic
940409219 2:153340974-153340996 CTACTGAATCGTAAGCTCTGAGG + Intergenic
940914908 2:159243441-159243463 CTGGGGAAATCTAAGATCTGTGG + Intronic
941721242 2:168815435-168815457 CTGTTTAAACATTAGCTCTGAGG - Intronic
943546864 2:189291778-189291800 CTGTGGAAAATTAAGCTCTTTGG + Intergenic
943580030 2:189674158-189674180 CTGTTCAACTGTAAGCTCCTTGG + Intergenic
944362490 2:198874294-198874316 GTGTTGAAATGTAAGCACTATGG - Intergenic
944365827 2:198918512-198918534 CTACTGAATTGAAAGCTCTGGGG - Intergenic
944878725 2:203989420-203989442 ATGTTGAAATGTAAATCCTGAGG - Intergenic
945134751 2:206615244-206615266 CTGTGAAAATGTAAGCTTTATGG + Intronic
945177114 2:207053950-207053972 CTCTTGAATTGTAAACTCTCAGG + Intergenic
947274694 2:228377191-228377213 CTCCTAAAATGTAAGTTCTGTGG - Intergenic
948069842 2:235111761-235111783 CTGTGAAAAGGAAAGCTCTGTGG - Intergenic
948642009 2:239381364-239381386 CTGGGAAAATGTAAGTTCTGGGG + Intronic
1168980468 20:1999143-1999165 CTGGTGGAATGTAAACTCTAGGG + Intergenic
1170136836 20:13083867-13083889 CTGTTTAAATACAAGCCCTGTGG + Intronic
1172686056 20:36755397-36755419 CTGTTGAAATGGCACCTCAGAGG + Intronic
1173529019 20:43754333-43754355 ATGTTGAATTGTAATCCCTGGGG - Intergenic
1173583732 20:44166182-44166204 CTGTGGAAATGACAGCTCCGGGG + Intronic
1174353500 20:49983818-49983840 CTGCTGGAAGGTAAACTCTGAGG - Exonic
1175537393 20:59724296-59724318 CTGTTGAAATGGAGTCCCTGGGG - Intronic
1177929720 21:27266114-27266136 CTGTTGAAATTTATGCTCCTGGG + Intergenic
1178252390 21:31016634-31016656 CAATTAAAATGTAAGCTCTTGGG + Intergenic
1178428165 21:32495997-32496019 CAGGTGAATTGTATGCTCTGTGG - Intronic
1182620846 22:31617802-31617824 CTGTTGCCCTGGAAGCTCTGAGG - Intronic
1183479135 22:38053236-38053258 CTGTTGGATTGGAATCTCTGGGG - Intergenic
949520389 3:4847650-4847672 CTGTTGTTATGACAGCTCTGAGG + Exonic
949644191 3:6074393-6074415 CTGATGAAATATAAACACTGAGG + Intergenic
949907399 3:8870103-8870125 CTACTGGAATGTAAGCCCTGTGG - Intronic
949937717 3:9129678-9129700 CAAATGAAATTTAAGCTCTGAGG + Intronic
950307137 3:11924715-11924737 CAGTTGAAATGGAATCTCTAGGG + Intergenic
950330661 3:12153624-12153646 CTGTTGGAACGAAAGCTCTATGG - Exonic
950864784 3:16180433-16180455 CTGTTGAAAAATGTGCTCTGTGG - Intronic
951444385 3:22761384-22761406 GTGTAGAACTGTAAGCTCTGAGG - Intergenic
953730563 3:45443893-45443915 CTTTGGAAGTGTCAGCTCTGAGG - Intronic
954912123 3:54119577-54119599 GTGTTGAAATATAAGCTTTTGGG + Intergenic
956338237 3:68189421-68189443 CTGCTTAAATGTCAGCTCTGGGG + Intronic
958875928 3:99617234-99617256 CAGTTCAAATAGAAGCTCTGAGG + Intergenic
959225574 3:103579527-103579549 CTGTTGGAATATAAACTGTGAGG + Intergenic
959992767 3:112646950-112646972 CCGTTGTAATGTAAGCTCCCGGG - Intronic
961607121 3:128104516-128104538 ATGTTAAAATGTGAGCTGTGTGG - Intronic
964192654 3:154022581-154022603 CTTTTGACATGTAAACTCTGGGG + Intergenic
964749675 3:160042745-160042767 CTGTAGAAATGTAAAATGTGAGG + Intergenic
964948265 3:162253591-162253613 CTGTAGAAATGTAAGCTCTCAGG - Intergenic
965918943 3:173888818-173888840 CAGTTAAAATGAAAGCTCAGAGG + Intronic
966042282 3:175506711-175506733 CTTTTTAGATGTAAGCTCTTGGG + Intronic
966591436 3:181687801-181687823 CTGTTCAATTCTAAGTTCTGTGG - Intergenic
967925317 3:194641075-194641097 ATGTTGAAATGTAAGCCCCCTGG - Exonic
968723751 4:2228699-2228721 CTATAGAAATGTAAACTCTTAGG - Exonic
969227950 4:5811441-5811463 CTGCAGAAATGTATTCTCTGAGG + Exonic
970495091 4:16617048-16617070 CTGTTAAAATGTTCCCTCTGAGG - Intronic
970981056 4:22097814-22097836 CTGTTGCCATGGAATCTCTGTGG - Intergenic
972809670 4:42569148-42569170 CTGATGAATGGTAAGCTCTATGG - Exonic
973293734 4:48493103-48493125 CAGTTGAAACCTAAGGTCTGGGG - Intronic
973597504 4:52507499-52507521 CTGGTAAAATGAAAGCTCTATGG + Intergenic
973940692 4:55907317-55907339 CAATTGAAATGTAATGTCTGGGG - Intergenic
974773108 4:66441763-66441785 CCTTTGAAATGAAATCTCTGTGG + Intergenic
975444120 4:74443389-74443411 CTGTTTAATGGAAAGCTCTGTGG - Intergenic
975771633 4:77730102-77730124 CTATTGGAATATAAGCTTTGGGG + Intronic
976777097 4:88718977-88718999 CTGTTGAAATACATGCACTGTGG - Intergenic
977552658 4:98458377-98458399 CTGTTAAAATGCAAGCTCCATGG - Intergenic
977840438 4:101696490-101696512 CTGTTTGGATGTCAGCTCTGCGG - Intronic
978145580 4:105367312-105367334 ATGGTGAAATGTAATCTCTTTGG - Intergenic
978607216 4:110493821-110493843 CTATTGAAATGTAACATCAGAGG + Intronic
978778107 4:112522520-112522542 CCTTTTGAATGTAAGCTCTGTGG - Intergenic
980381576 4:132026707-132026729 CTGCTGATCTTTAAGCTCTGAGG - Intergenic
980544971 4:134247614-134247636 TTATTGAAATGTTAGCTCTAAGG - Intergenic
982217479 4:153094941-153094963 CTGTGGAAATGGCTGCTCTGAGG - Intergenic
982558658 4:156901162-156901184 CTGATGAAATGGAATCTCTATGG - Intronic
983266935 4:165517226-165517248 TTGGTGAAATTTAATCTCTGAGG - Intergenic
983566745 4:169161077-169161099 CAAGTGAAATGTAAGCTCTGTGG - Intronic
987760798 5:22160848-22160870 ATGTTGAAAAGTAACCCCTGTGG - Intronic
987975214 5:25006837-25006859 CTTGTGAAATGTAAGCACTCTGG + Intergenic
988780537 5:34517119-34517141 CTGCTGAAATGTAAGCTCCAGGG + Intergenic
988987325 5:36633332-36633354 CTTTTGACATGCAATCTCTGTGG + Intronic
989285044 5:39689690-39689712 CTGATTAAATCCAAGCTCTGTGG - Intergenic
990228301 5:53681924-53681946 CTATTGAAATGTAAGCTTTGTGG + Intronic
990609785 5:57445566-57445588 CTGCTGAAATGACAGCTCTTTGG + Intergenic
990609973 5:57447146-57447168 CTGCTGAAATGACAGCTCTTTGG + Intergenic
992556116 5:77905423-77905445 TTGATAAAATGTAAGCTGTGTGG + Intergenic
992678413 5:79128758-79128780 CCATTGGAATGTAAACTCTGAGG - Intronic
995161152 5:108984046-108984068 TTCTTGAAATGTATACTCTGGGG + Intronic
995406465 5:111802470-111802492 CTGTTGAAATGAAAGATGGGAGG + Intronic
1004598958 6:17129303-17129325 CTGCTGATAGGAAAGCTCTGGGG - Intronic
1005132919 6:22532415-22532437 CTGTTGACATATAACCTATGTGG - Intergenic
1005737459 6:28761750-28761772 CTGTTGAAATGGAAGGCCTAGGG - Intergenic
1005742590 6:28806275-28806297 CTGTTGAAAGGGAAGGTCTAGGG - Intergenic
1007584359 6:42979599-42979621 CTGTGGAACTGTGAGCACTGAGG + Intergenic
1007603560 6:43099611-43099633 CTGTTAAATGGTAAGCTCTCTGG - Intronic
1008382108 6:50847710-50847732 CTGTTGTAATGAAAACGCTGTGG - Intergenic
1011727616 6:90226254-90226276 ATTTTGAAATGTAGGCTGTGTGG - Intronic
1014750688 6:125252712-125252734 CTTTTGAAGTGTAATTTCTGAGG + Intronic
1016315694 6:142783918-142783940 CTGTAGAAATCTCAGCTTTGTGG - Intronic
1016664795 6:146625504-146625526 CTGTTGAAATGTGAGGTGTTTGG + Intronic
1018733928 6:166673339-166673361 CAGTTGGAATGACAGCTCTGGGG - Intronic
1021360262 7:19704332-19704354 CCTTGGAAATGGAAGCTCTGTGG - Intronic
1023595206 7:41822445-41822467 CTGGCTAAATGTGAGCTCTGGGG - Intergenic
1024003876 7:45211267-45211289 CTTTTCAAATGAAAGCTCTTGGG - Intergenic
1024433640 7:49322122-49322144 ATGTTGAAATGCCAGCTTTGGGG + Intergenic
1027512931 7:79106030-79106052 CTGTTGAAAGGAAACCACTGTGG + Intronic
1030333326 7:108296385-108296407 TTGCTGAAATGAAACCTCTGAGG - Intronic
1032023008 7:128420598-128420620 GTCTTGCAATGTATGCTCTGAGG + Intergenic
1032556259 7:132838453-132838475 CTGTAGAACTCTGAGCTCTGTGG + Exonic
1032924365 7:136586191-136586213 ATATATAAATGTAAGCTCTGGGG + Intergenic
1033337975 7:140469551-140469573 CTGTTAAATTGTTTGCTCTGGGG + Intronic
1033441000 7:141378754-141378776 CAGTAGCAATGAAAGCTCTGTGG - Intronic
1033444490 7:141408428-141408450 CTGCTGAAATGAAATATCTGGGG - Intronic
1034353413 7:150432137-150432159 CTGTTGAACTCCAAGATCTGTGG - Intergenic
1034621021 7:152457231-152457253 ATGTTGAAATGTAACCCCTAGGG + Intergenic
1035417083 7:158698701-158698723 CTGTTCAAATATCATCTCTGAGG + Intronic
1035819964 8:2580443-2580465 ATGTTAAAATGTAACCTCTGAGG + Intergenic
1036075476 8:5494487-5494509 GTGTTGAGATGTGGGCTCTGGGG + Intergenic
1036735854 8:11315553-11315575 ATATTGAAAAGTAATCTCTGTGG - Intronic
1040774597 8:51025354-51025376 ATGTTGTAATGTAAGCGTTGAGG + Intergenic
1042074565 8:64977566-64977588 CATTTGAAATGTAAGAGCTGTGG + Intergenic
1043770983 8:84199847-84199869 ATGTTGAAATTTAATCTCAGAGG + Intronic
1045013238 8:97976930-97976952 GTGTTGAAATTTGACCTCTGTGG + Intronic
1046070108 8:109241190-109241212 ATGTTGAATTGAAAGCTCTCAGG - Exonic
1046765780 8:118068149-118068171 CTCTGGCACTGTAAGCTCTGTGG - Intronic
1047195112 8:122713980-122714002 CTCTTGAAACTTTAGCTCTGGGG - Intergenic
1047832817 8:128655160-128655182 GTGTTGAAATTTGAGATCTGAGG + Intergenic
1048059108 8:130899303-130899325 CCTTTGAAATGTAAGCTCCTGGG + Intronic
1049003069 8:139838339-139838361 CTGCTGGACTGCAAGCTCTGGGG + Intronic
1051528031 9:18069109-18069131 CTGCTGACATGTAAGCTATCTGG + Intergenic
1052323026 9:27188796-27188818 CTGTGGGAATGTAAGCTCCATGG - Intronic
1058262847 9:102858193-102858215 CTGTGGTAATGTAAGCCCTATGG + Intergenic
1058276556 9:103049057-103049079 TTTTTGAAATGTAAGGTCTCTGG - Intergenic
1186849575 X:13567514-13567536 CTACTGAAATGTAAGGCCTGAGG - Intergenic
1186862964 X:13691234-13691256 CAGTTGAAATGTAAGCTCTGGGG - Intronic
1187221737 X:17333553-17333575 CTGGTGAAATGACAGATCTGTGG - Intergenic
1187794545 X:22988032-22988054 CTGTTAAAATGTACCTTCTGAGG + Intergenic
1188009044 X:25038827-25038849 CTGTGGAAATGAGAGCTCTTTGG - Intergenic
1188186221 X:27117898-27117920 CAGTTGAAAAGTAAGGTCTAGGG - Intergenic
1188218452 X:27509236-27509258 ATGTTGAAATCTCAGCTCTGGGG - Intergenic
1189396614 X:40628801-40628823 CTTTTGAAAAGTAAGCTCCCAGG - Intronic
1189451676 X:41138849-41138871 ATGGTGAATTGTAAGCTATGTGG + Intronic
1189536822 X:41943819-41943841 GTGATGAAATGGGAGCTCTGCGG + Intergenic
1189796240 X:44648459-44648481 CAGTTAAAATGTGAGCCCTGGGG - Intergenic
1192179578 X:68908081-68908103 CTGCAGAAATGCAAGCTCTCTGG + Intergenic
1195170526 X:102263103-102263125 ATGTTGAAATGATAGCACTGCGG + Intergenic
1195188333 X:102423996-102424018 ATGTTGAAATGATAGCACTGCGG - Intronic
1197813141 X:130467191-130467213 CTGATGAAATGTGATCTCTGAGG - Intergenic
1198004954 X:132483557-132483579 AAGGTGAAATGTAAGCTCTCTGG + Intronic
1199791059 X:151155655-151155677 CTGGAGACATGTAAGCTCAGAGG - Intergenic
1201295512 Y:12459911-12459933 TTTTTTAATTGTAAGCTCTGAGG - Intergenic
1201631704 Y:16077239-16077261 TTGTTGCTATGTAAGCTTTGGGG - Intergenic
1202103912 Y:21341271-21341293 CTGTTGAAATGTTAACCCTGGGG - Intergenic