ID: 1101101243

View in Genome Browser
Species Human (GRCh38)
Location 12:101395234-101395256
Sequence GGAAAGATAATTCATTTTAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1430
Summary {0: 1, 1: 3, 2: 8, 3: 176, 4: 1242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101101239_1101101243 9 Left 1101101239 12:101395202-101395224 CCTCACCTACTCTCATACTGAGT 0: 1
1: 0
2: 0
3: 38
4: 916
Right 1101101243 12:101395234-101395256 GGAAAGATAATTCATTTTAAGGG 0: 1
1: 3
2: 8
3: 176
4: 1242
1101101240_1101101243 4 Left 1101101240 12:101395207-101395229 CCTACTCTCATACTGAGTCTAAT 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1101101243 12:101395234-101395256 GGAAAGATAATTCATTTTAAGGG 0: 1
1: 3
2: 8
3: 176
4: 1242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101101243 Original CRISPR GGAAAGATAATTCATTTTAA GGG Exonic
900037507 1:429311-429333 GGAAAGATATATCATGTTCATGG - Intergenic
900038764 1:439526-439548 GGAAAGATATTTTATGTTCATGG + Intergenic
900059134 1:665052-665074 GGAAAGATATCTCATGTTCATGG - Intergenic
900060198 1:674505-674527 GGAAAGATATTTTATGTTCATGG + Intergenic
900072797 1:787159-787181 GGAAAGATATTTCATGTTCATGG - Intergenic
901633895 1:10660863-10660885 TGAAAGAGAAGTCATTTTACTGG + Intronic
901949135 1:12727469-12727491 GGAATGAAAATTCTTTTGAAAGG + Exonic
902119844 1:14154128-14154150 GGAAAGATATTTCATGTTCATGG - Intergenic
902232932 1:15039605-15039627 GCAAAAATGATACATTTTAATGG + Intronic
902895147 1:19474579-19474601 GGTTTGATATTTCATTTTAAGGG - Intronic
903958704 1:27042676-27042698 GAAAACATCATGCATTTTAAAGG + Intergenic
905195543 1:36274284-36274306 GGAAAGACATTTCATGTTCATGG + Intronic
905327283 1:37163543-37163565 GGAAAGACATTTCATATTCATGG - Intergenic
906222827 1:44095643-44095665 GGAAAGATATTCCATGTTCATGG - Intergenic
906335105 1:44922665-44922687 GGAAAGATATTCCATGTTCATGG - Intronic
906352331 1:45073047-45073069 GGAAAGATATTCCATGTTCATGG - Intronic
906438590 1:45819710-45819732 GAAAAGATATTTCATGTTCATGG + Intronic
906625606 1:47322684-47322706 AGAAAGAGAATTAAGTTTAATGG + Intergenic
906754834 1:48301377-48301399 GGAAAGATATTCCATGTTCATGG + Intronic
906889250 1:49689695-49689717 GGAAAGATATTCCATGTTCATGG - Intronic
907016264 1:51016340-51016362 AAAAAGATAATTTATGTTAATGG + Intergenic
907100636 1:51831300-51831322 GGAAAAATAACTGATTTTATTGG - Intronic
907589326 1:55651077-55651099 GGAAAGAAATCTCATGTTAATGG + Intergenic
908057193 1:60300771-60300793 GGAAAGATATCTCATGTTCATGG - Intergenic
908074515 1:60500796-60500818 GTAAAGATATTTCATGTTGATGG + Intergenic
908351576 1:63291049-63291071 GGAAAGATATCTCATGTTCATGG + Intergenic
908445835 1:64198836-64198858 AAAAAGATAATGCAGTTTAATGG + Intergenic
908464452 1:64378173-64378195 GGAAAGATATTCCATGTTCATGG - Intergenic
908598756 1:65716523-65716545 GAAAAGATATTTCATTTGTATGG - Intergenic
908651668 1:66339632-66339654 TGATAAATAAATCATTTTAAGGG + Intronic
908830600 1:68174683-68174705 GGAAAGAGCAATGATTTTAAGGG - Intronic
908943447 1:69464934-69464956 GGAAAAATATTTCATGCTAATGG - Intergenic
908992077 1:70103380-70103402 GGAAAGATTCTCCATTTTTAAGG - Intronic
909026909 1:70492617-70492639 GGAAAGATACTCCATGTTCATGG + Intergenic
909037960 1:70616128-70616150 GGAAGGAGAAATCTTTTTAATGG + Intergenic
909098454 1:71319829-71319851 GGAGAGAGAATCTATTTTAATGG - Intergenic
909111076 1:71478460-71478482 GGAAAGAAAAATCCTTTTCAAGG - Intronic
909386444 1:75062934-75062956 GGAAAGATATTTCATGTTTATGG - Intergenic
909892866 1:81029607-81029629 GGCAAGATAATTCCTTGTTATGG - Intergenic
910328204 1:86035891-86035913 GGAAAAATTACTCATTTTGAGGG - Intronic
910372669 1:86533711-86533733 GGGAAGATATTTCATGTTCATGG - Intergenic
910428245 1:87136994-87137016 AGAAAGATAATTGCTTTTAGAGG - Intronic
910470024 1:87542175-87542197 GGAAAGATATTTCATGTTCATGG - Intergenic
910620908 1:89253524-89253546 GGAAAGATATTCCATCTTCATGG + Intergenic
910974254 1:92889622-92889644 GGAAAGATATCTCATGTTAATGG - Intronic
911001157 1:93167389-93167411 GGAAAGATATTCCATGTTCATGG - Intronic
911012259 1:93293139-93293161 GGAAAGATATTCCATGTTAATGG + Intergenic
911240983 1:95466021-95466043 GGAAAGATATTCCATGTTCATGG - Intergenic
911260104 1:95675607-95675629 GGAAAACTAATTCGATTTAAAGG - Intergenic
911589089 1:99725854-99725876 GGAAAACTATTTCATTTAAATGG - Intronic
911665851 1:100550517-100550539 GGAAAGATATCTCATGTTCATGG - Intergenic
911828133 1:102513880-102513902 GGAAAGATATTTTATTTTTGTGG + Intergenic
912110722 1:106338874-106338896 GGAAAGATATTCCATGTTCATGG - Intergenic
912136581 1:106667311-106667333 GGAAAGATATTTTATGTTTATGG + Intergenic
912522054 1:110252262-110252284 AGAAAAAGAAATCATTTTAACGG - Intronic
912632851 1:111262382-111262404 GGAAAGATATTTCATGTTCCTGG - Intergenic
912960894 1:114194983-114195005 GGAAAGATAGTCCATGTTCATGG - Intergenic
913097432 1:115532403-115532425 ATAAAGATAATTCTGTTTAAAGG + Intergenic
913146639 1:115997427-115997449 GGCAAGATATTTCATGTTAATGG - Intronic
913166273 1:116189238-116189260 GGAAAGATATTCCATGTTCATGG - Intergenic
913416375 1:118613299-118613321 GGAAAGATATTCCATGTTCATGG - Intergenic
915078447 1:153332116-153332138 AGAAAGATATTTCATGTAAATGG + Intronic
915178481 1:154037518-154037540 AAAAAGATATTTCATGTTAATGG - Intronic
915680591 1:157578545-157578567 GGAAAGAAAAGACATTTTCAAGG + Intronic
915817367 1:158982766-158982788 GGAAAGACATTTCATTCTCATGG - Intergenic
916187970 1:162151618-162151640 GGAAAGATAACCCATGTTCATGG - Intronic
916341450 1:163740525-163740547 GGAAAGATATTTTATGTTCATGG - Intergenic
916809043 1:168289595-168289617 GGAGAGAAAATTAATTTAAATGG - Intronic
916852181 1:168714701-168714723 GGTATTATAATTCATTTTACTGG + Intronic
917226018 1:172783495-172783517 GGAAAGATATTCCATTTTCGTGG - Intergenic
917246180 1:173003880-173003902 GGTAAGAAAATTTATTTAAAGGG - Intergenic
917364441 1:174214350-174214372 GGAAAGATATTCCATGTTCATGG + Intronic
917395553 1:174590077-174590099 GGAAAGATATTCCATGTTCATGG - Intronic
917773361 1:178305163-178305185 GGAAAGATATTTCATGTTCATGG + Intronic
917986184 1:180321416-180321438 GGAAAGATATTCCATATTCATGG - Intronic
918018073 1:180657912-180657934 GGAAAGATATTCCATGTTCATGG - Intronic
918475844 1:184923695-184923717 GGAAAGATATTCCATGTTCATGG - Intronic
918499723 1:185180286-185180308 GGTCAGATAATTCACTTTAGGGG - Intronic
918578629 1:186097571-186097593 GGAAAGATATTTCATGTTTATGG + Intronic
918668580 1:187183384-187183406 GGAATGATATTTCATGCTAATGG + Intergenic
918726089 1:187925984-187926006 CCAAAGAAAATTCATTATAAGGG - Intergenic
918795783 1:188894711-188894733 GGAAGGATAGTTTATTTTCATGG - Intergenic
918891318 1:190273649-190273671 GGAAAAATACATAATTTTAAGGG - Intronic
919284084 1:195530984-195531006 GGAAAGATATTCCATGTTCATGG + Intergenic
919288976 1:195603791-195603813 GGAAAGGTATTTCATGTTCATGG - Intergenic
919376463 1:196800365-196800387 GGAAAGATATTTTATGTTTATGG - Intergenic
919386159 1:196925278-196925300 GGAAAGATATTTTATGTTTATGG - Intronic
919438881 1:197601337-197601359 AGAAACATAATTCATTTAAAAGG + Intronic
919585886 1:199439472-199439494 GGAAAGATATTTCACTTTCATGG + Intergenic
919959277 1:202450984-202451006 GGAAAGATATTCCATATTCATGG - Intronic
920550062 1:206852607-206852629 GGAAAGATATTCCATGTTCATGG + Intergenic
920594310 1:207253581-207253603 GGAAAGATATTCCATGTTTATGG - Intergenic
920953177 1:210592659-210592681 GGAAAGATATTCCATGTTCATGG - Intronic
921120863 1:212135977-212135999 GGAAAGATATTCCATGTTCATGG + Intergenic
921295745 1:213700681-213700703 GGAAAGATATTTCACATTCATGG - Intergenic
921416356 1:214892247-214892269 GAAAAGATATTTCATGTTCATGG + Intergenic
921428297 1:215031351-215031373 GGAAAGATATTTCATGTTCATGG - Intronic
921623123 1:217348562-217348584 GGAAATATAATTCATTTAAGAGG - Intergenic
921920326 1:220661356-220661378 GGAAAGATAATTCGTTTACCTGG - Intronic
921942557 1:220857441-220857463 GGAAAGATATTCCATGTTCATGG - Intergenic
922014115 1:221625743-221625765 GGAAAGATATTCCATGTTCATGG - Intergenic
922017061 1:221659321-221659343 GGAAAGACATTTCATATTTATGG - Intergenic
922065865 1:222142241-222142263 GAAAAGATATTTCATATTCATGG + Intergenic
922268384 1:224010090-224010112 GGAAAGATATTTCATGTTCATGG - Intergenic
922926816 1:229354723-229354745 GGAAAGACATCTCATATTAATGG - Intergenic
923537173 1:234862321-234862343 GAACAGATAATTCATTTTCTTGG - Intergenic
923590593 1:235315429-235315451 GGACAGATAATTTATTTTTTTGG - Intronic
923963856 1:239114365-239114387 TAAAAGATCATGCATTTTAAAGG + Intergenic
924209716 1:241752121-241752143 AGAAAGATCATTTACTTTAAAGG - Intronic
924329370 1:242926618-242926640 GCAGAGATAATTCATTTTCATGG - Intergenic
924402308 1:243698840-243698862 AGAAAGTTAATTCATATTATAGG - Intronic
924832354 1:247610607-247610629 GGAAAAATATTTCATGTTCATGG + Intergenic
924844480 1:247751383-247751405 GGAAAGATATCTCATGTTCATGG + Intergenic
924861378 1:247926498-247926520 GGAAAGAAAATTCAATCCAAAGG - Intergenic
924907956 1:248476739-248476761 GGGAAGATATCTCATGTTAATGG - Intergenic
924949520 1:248869589-248869611 GGAAAGATATTTCATTTTAATGG + Intergenic
1062926162 10:1317028-1317050 GGAAGGAAAAATCATTTTTATGG + Intronic
1063684336 10:8222160-8222182 GGTAAAATAGTTCATTTTAGGGG + Intergenic
1063775061 10:9253975-9253997 TGAAAGATAATTCATTTCAAAGG - Intergenic
1063823597 10:9867212-9867234 AGAAAGATAATTCATGTTCATGG - Intergenic
1063861929 10:10319600-10319622 GGAGAGATAGTTCATGTTCATGG + Intergenic
1064987348 10:21224629-21224651 GGAAAGATATTCCATATTCATGG - Intergenic
1065330450 10:24591823-24591845 TGCAAGAAAATTCATTTTCACGG - Intronic
1065377690 10:25059842-25059864 GGAAAGAAATTACATTTTAGTGG + Intronic
1065431210 10:25658314-25658336 GGAAAGATATTCCATGTTCATGG - Intergenic
1065467323 10:26038329-26038351 GGAAAGATATTCCATGTTTATGG - Intronic
1065497815 10:26348183-26348205 GGAAATATACTTCATGGTAAAGG + Intergenic
1065500032 10:26371521-26371543 GAAAATATTTTTCATTTTAATGG - Intergenic
1065529029 10:26650166-26650188 TGAAAGAAAATTGATTTTCAAGG + Intergenic
1065907028 10:30264823-30264845 GGAAGGATATTTCATGTTCATGG + Intergenic
1065996980 10:31068696-31068718 GCAAAGAGAATTTATTTCAACGG + Intergenic
1066007259 10:31156908-31156930 GGAAAGATTACTCATTTAACTGG + Intergenic
1066526844 10:36289745-36289767 GGAAAGATATTGCATGTTTATGG - Intergenic
1066548604 10:36530022-36530044 TGAAAGATATTTCATGTTCATGG + Intergenic
1066754989 10:38702359-38702381 GGAGAGATATATCATGTTAATGG + Intergenic
1066815985 10:39413458-39413480 GGAAAGATATTTCCTTTTTCAGG - Intergenic
1067902887 10:50260769-50260791 ACAAAGATAATTTTTTTTAAAGG + Intergenic
1067959311 10:50830128-50830150 GCAGAAATTATTCATTTTAATGG + Intronic
1068269321 10:54699834-54699856 GTAAAGAAAATACATTTTACTGG + Intronic
1068331904 10:55582037-55582059 GGACAGAGAATGCTTTTTAAAGG - Intronic
1068697875 10:59987881-59987903 GGAAAGATATTCCATGTTCATGG - Intergenic
1069273072 10:66555009-66555031 GGGATGATAATTCCATTTAAGGG + Intronic
1069276229 10:66594434-66594456 GGAAGGAGATTTCATTCTAAGGG - Intronic
1069335424 10:67343381-67343403 GGAAAGATATTCCATGTTCATGG - Intronic
1070091694 10:73292456-73292478 GGAAAGACATTTCATGTTCATGG + Intronic
1070341760 10:75504481-75504503 GGAAAAATAAGTCATATCAAAGG + Intronic
1071007924 10:80904273-80904295 GGAAAGATATCTCATGTTCATGG - Intergenic
1071013815 10:80970898-80970920 GATAAGATGATTCATTTTTATGG - Intergenic
1071214627 10:83385703-83385725 GGAAAGATATTTCATGTTCATGG - Intergenic
1071498611 10:86188178-86188200 GGAAAGATAAGTTAATTCAAAGG + Intronic
1071560319 10:86641618-86641640 GGAAAAATAATTATTTTAAATGG - Intergenic
1071862419 10:89687806-89687828 GGAAAGAAAATACAATTTGAGGG - Intergenic
1071935087 10:90520882-90520904 GGAAAGATATTTAATGTTCACGG - Intergenic
1072323807 10:94276620-94276642 GATAAGATAATTCACTTTATGGG - Intronic
1072369492 10:94750163-94750185 GGAAAGATATTCCATGTTGATGG - Intronic
1072377505 10:94832887-94832909 GGAAAAATATTTCATGTTCATGG - Intronic
1072385288 10:94919290-94919312 GGAAAGATATTCCATGTTGATGG - Intergenic
1072398874 10:95075839-95075861 GAAAAGATATTTCATGTTCATGG - Intergenic
1073311701 10:102547457-102547479 GGAAACAGAATCCATTTTGAGGG - Intronic
1073906005 10:108280568-108280590 TGAAAGAAAATTCATCTTCATGG + Intergenic
1074619533 10:115105178-115105200 GGAAAGATATTTCATGCTCATGG - Intronic
1074790597 10:116882905-116882927 GGAAGGAAAATTCATTTGAAAGG + Intronic
1074813636 10:117128331-117128353 GAAAAAGTAATTCATCTTAATGG - Intergenic
1076148612 10:128145090-128145112 GGAAACTTAACTCCTTTTAATGG - Intergenic
1076377057 10:129997501-129997523 AGAAAGATATTTCATATTCATGG + Intergenic
1076964232 11:67234-67256 GGAAAGATATCTCATGTTCATGG - Intergenic
1076964972 11:75437-75459 GGAAAGATATTTTATGTTCATGG + Intergenic
1077270244 11:1674358-1674380 GGAAAGATTAATCAATTTTATGG + Intergenic
1077428681 11:2502550-2502572 GGTAAGATATTTCATGTTCATGG + Intronic
1077872724 11:6276522-6276544 GGAAAGATATTTCATGTTCATGG + Intergenic
1078200243 11:9175366-9175388 GGAAAGATATGCCATGTTAATGG + Intronic
1078304517 11:10170774-10170796 GGAAAGATATTCCATGTTCATGG - Intronic
1079484100 11:20916040-20916062 GGAATGTTAATTTATTTGAATGG - Intronic
1079572228 11:21957924-21957946 GGAAGGATATTTCATGTTCATGG + Intergenic
1079688323 11:23390714-23390736 GAAAAGAAAAGTCATTATAATGG - Intergenic
1080083861 11:28255088-28255110 GGAAAGATATTCCATGTTCATGG - Intronic
1080466813 11:32505132-32505154 GCACAGATATTTCCTTTTAAAGG - Intergenic
1080488771 11:32739320-32739342 GGAAAGATATTCCATGTTCATGG - Intronic
1080700336 11:34639015-34639037 TGAAAGATAAATAATTATAATGG - Intronic
1081212249 11:40350718-40350740 GGAAAGATATTTCATGTTCATGG - Intronic
1081224150 11:40500462-40500484 GGGAAGAAAAATCAGTTTAATGG + Intronic
1081280074 11:41198678-41198700 GGAAAGACACTCCATTTTCACGG + Intronic
1081357281 11:42126559-42126581 GGAGATACCATTCATTTTAAAGG + Intergenic
1081364726 11:42220596-42220618 GGAAAGATACTGCATGTTTATGG + Intergenic
1081407838 11:42718314-42718336 GGAAAGATATTCCATGTTCATGG + Intergenic
1082229274 11:49744155-49744177 GGAAATATTATTCAATTTTAAGG + Intergenic
1083071655 11:59990441-59990463 GGAAAAATATTCCATTTTCATGG - Intergenic
1083352291 11:62038972-62038994 GGAAAGATATTCCATGTTCATGG - Intergenic
1083500595 11:63104353-63104375 GGAAAGGAATTTCATGTTAAAGG - Intronic
1083527882 11:63387778-63387800 GGAAAGATATTCCATGTTCATGG - Intronic
1083538896 11:63497672-63497694 GGAAAGATATTTCATGTTCATGG - Intergenic
1083917090 11:65754378-65754400 GGAAAGATATTTCATGTTCATGG - Intergenic
1083984458 11:66203367-66203389 GGAAAGATATTCCATATTCATGG + Intronic
1084123517 11:67083410-67083432 GGAAGGATAATTCATTTAGGAGG - Intergenic
1084989778 11:72911611-72911633 GGAAAGATATTCCATGTTGATGG - Intronic
1085007740 11:73109349-73109371 GGAAAGATATTCCATGTTCATGG - Intronic
1085178928 11:74516499-74516521 GGAAAGATATTCCATGTTCATGG + Intronic
1085798074 11:79562057-79562079 GGAAAGAGAATTGACTTTTATGG + Intergenic
1085852170 11:80133882-80133904 GGAAAGATACTTCATGTTCATGG - Intergenic
1086071911 11:82808943-82808965 GGACAGAGAATTCAGCTTAAAGG + Intergenic
1086620806 11:88884970-88884992 GGAAATATTATTCAATTTTAAGG - Intronic
1086778054 11:90864690-90864712 GAAAAAAAAAATCATTTTAAAGG + Intergenic
1087166401 11:95008434-95008456 GGAAAGATATTTCATGTTCATGG - Intergenic
1087714330 11:101591117-101591139 GGAAAGATACTTCATGTTCAGGG + Intronic
1087823581 11:102739242-102739264 GGAAAGATATTTCATGTTCATGG - Intergenic
1087845468 11:102967399-102967421 TGAAAGCTAATTCTTTCTAAGGG - Intergenic
1088025273 11:105172829-105172851 GGAGAGATATTTCATGTTAATGG - Intergenic
1088150258 11:106736756-106736778 GGAAAGATATTTAATATTAATGG - Intronic
1088154671 11:106789026-106789048 GGAAATATATTTCATGTTGATGG - Intronic
1088361596 11:108996094-108996116 GGAAAGATATTCCATGTTCATGG - Intergenic
1088406348 11:109483738-109483760 GGAAAGATATTTTATATTCATGG + Intergenic
1088411224 11:109536959-109536981 GGAAAGATATTTCATGTTCATGG - Intergenic
1088468079 11:110163525-110163547 GTAAAAATAATTCTTTTTCATGG - Intronic
1088635451 11:111815897-111815919 ACAAGGATAATTTATTTTAATGG - Intronic
1088985596 11:114904482-114904504 GGAAAGATATTCCATGTTCATGG + Intergenic
1089824324 11:121260428-121260450 GGAAAGATATTTCATGTTCATGG - Intergenic
1090317895 11:125812455-125812477 GGTAAGATATTCCATTTTGATGG - Intergenic
1090321940 11:125853146-125853168 AGAAAGATATTTCATGTTCATGG - Intergenic
1090465987 11:126933831-126933853 GGAGAGACATTCCATTTTAATGG + Intronic
1090515326 11:127419153-127419175 GGAAAGATATTCCATGATAATGG - Intergenic
1091598723 12:1902729-1902751 GGAAAGATATTCCATGTTCATGG + Intronic
1091966690 12:4748841-4748863 GGAAAGATATTCCATGTTCATGG - Intronic
1092624162 12:10307692-10307714 GAAAATCAAATTCATTTTAAAGG - Intergenic
1092642783 12:10535329-10535351 GGAAAGATATTTCATGTGCATGG + Intergenic
1093033432 12:14310917-14310939 GGAAAGATATTCCATGTTCATGG + Intergenic
1093052884 12:14523348-14523370 GGAAAGATATTCCATGTTTACGG + Intronic
1093279849 12:17179805-17179827 GGAAAGAAAAGTCAATATAAGGG - Intergenic
1093331231 12:17843351-17843373 AGAAAGATATTTTATTTAAATGG + Intergenic
1093339624 12:17956514-17956536 GGAAAGGTATTTCATGCTAACGG + Intergenic
1093565792 12:20601842-20601864 GGTCAGATAATTCTTTTAAAAGG + Intronic
1093674571 12:21922192-21922214 GGAAAGATATTCCATATTCATGG - Intronic
1093899502 12:24614428-24614450 GGAAAGATATTTTATGTTCATGG + Intergenic
1093917953 12:24826762-24826784 GGAAAGATATTCCATATTCATGG - Intronic
1094145400 12:27223191-27223213 GGAAAGATATTCCATGTTCATGG + Intergenic
1094341337 12:29414842-29414864 TAAAATATAATTAATTTTAATGG - Intronic
1094420468 12:30265461-30265483 AGAAAGATAGTTCATGTTTATGG + Intergenic
1095422184 12:42036427-42036449 GGAAAGATATTCCATGTTCATGG + Intergenic
1095467993 12:42508095-42508117 GAAAAGATAATTCTTTTATAAGG + Intronic
1095645179 12:44535633-44535655 GGGCAGATATTTTATTTTAATGG + Intronic
1095699988 12:45181097-45181119 GGCAGGATAATTTATTTTCATGG + Intergenic
1095812635 12:46386559-46386581 GGAATGAGTATTCACTTTAAAGG - Intergenic
1095877267 12:47094686-47094708 GGAGGGATAAATCATTTAAAAGG - Intronic
1096134738 12:49189897-49189919 GGAAAGATGATTCATTCCAAAGG - Intronic
1096267756 12:50137638-50137660 GGGAAGATAATACATCGTAATGG + Intronic
1096398916 12:51289066-51289088 GGAAAGAGAACTAATTTTCAAGG + Intronic
1096583640 12:52604683-52604705 GGAAATTTAAGTCAATTTAATGG - Intergenic
1096662490 12:53135740-53135762 GGAAAGACATTTCATGTTAGTGG - Intergenic
1097322391 12:58240830-58240852 TGAAAATTAAGTCATTTTAAAGG + Intergenic
1097562000 12:61219200-61219222 GAAAAGATAACTGATTTTTAAGG + Intergenic
1097714303 12:62949617-62949639 ATAAAGATATTTCATGTTAATGG - Intergenic
1097813887 12:64050017-64050039 GGAAAGATATTCCATGTTCATGG - Intronic
1097915063 12:65012606-65012628 GGAAAGGAAATTCATTTTCCAGG + Intergenic
1098032963 12:66273201-66273223 GGAAGGAAAAGGCATTTTAATGG + Intergenic
1098060767 12:66559687-66559709 GGAAAGATACTCCATGTTCATGG + Intronic
1098207455 12:68127182-68127204 GGAAAGATATTCCATGTTCATGG - Intergenic
1098249493 12:68554271-68554293 GGAAAGATATTCCATGTTCATGG + Intergenic
1098370358 12:69752939-69752961 GAAAAAATAATAAATTTTAATGG + Intronic
1098413760 12:70209539-70209561 GGAAAGATATTCTATTTTCATGG - Intergenic
1098509032 12:71290457-71290479 GAAAAGATATTTCATATTCATGG - Intronic
1098648356 12:72933934-72933956 GGAAAGATATTCCATGTTCATGG - Intergenic
1098702854 12:73651372-73651394 TGAAAGATATTTCATATTCATGG + Intergenic
1098728491 12:74000659-74000681 AAATGGATAATTCATTTTAAGGG + Intergenic
1099416468 12:82393254-82393276 TGAAAGATATTTCATGTTCATGG - Intronic
1099768772 12:87025221-87025243 GGGAAGATATTTCATGTTTATGG + Intergenic
1099861010 12:88226193-88226215 GGAAAGATAACTCACGTTCATGG - Intergenic
1099869703 12:88331449-88331471 GTACAGTTTATTCATTTTAAAGG + Intergenic
1099895329 12:88638995-88639017 GGCTAGATAATTTATTGTAATGG - Intergenic
1099900150 12:88697547-88697569 AGAGAGTTACTTCATTTTAATGG - Intergenic
1099992643 12:89741812-89741834 GGAAAGATATTCCATGTTCATGG + Intergenic
1100147947 12:91700165-91700187 GAAAAAATATTTCATTATAAAGG - Intergenic
1100171503 12:91979773-91979795 GGAGAAGTAATTCCTTTTAATGG - Intergenic
1100187423 12:92152969-92152991 GAAAACTTAGTTCATTTTAAAGG - Intergenic
1100392762 12:94158451-94158473 CGATTGATAATTTATTTTAAAGG - Intronic
1100958238 12:99933387-99933409 GGAAAAATATTTCATGTTCATGG - Intronic
1101101243 12:101395234-101395256 GGAAAGATAATTCATTTTAAGGG + Exonic
1101680854 12:106963799-106963821 AGAAAAATAATTGTTTTTAAGGG + Intronic
1101714048 12:107295027-107295049 GGAAAAAAAATTCATTTTGATGG + Intergenic
1101951905 12:109183408-109183430 GGAAAGATATTCCATGTTCATGG - Intronic
1102176456 12:110879133-110879155 GGAAATATTATTCATTTTGTAGG - Intronic
1102318405 12:111909417-111909439 GGAAAGATATTCCATGTTCATGG + Intergenic
1102515817 12:113445944-113445966 GGCAAGATGTTTCCTTTTAAGGG + Intergenic
1103296437 12:119891102-119891124 GCAAACATAATTCTTTGTAATGG - Intergenic
1103460511 12:121100879-121100901 GGAAAGATATTACATGTTCATGG + Intergenic
1104348713 12:128026273-128026295 TGAAATATAATACATTTTCAGGG - Intergenic
1105249226 13:18682056-18682078 AAAAAGAAAATTCATTTTAATGG - Intergenic
1105938521 13:25125821-25125843 GGAAAGATATCTCATGTTCATGG + Intergenic
1105989557 13:25604562-25604584 AGAAAGAATATTCATTTTATTGG - Intronic
1106349621 13:28916423-28916445 GGAAAGATATTCCATGTTCATGG - Intronic
1106558406 13:30829258-30829280 GGCAAGACAGTTCCTTTTAAAGG + Intergenic
1106573474 13:30952058-30952080 GAAAAGAGAAATCATTTAAATGG - Intronic
1106972878 13:35164906-35164928 GTTAATATAATACATTTTAAAGG + Intronic
1107211237 13:37857284-37857306 GGACAGATATTTCATTTTCATGG + Intronic
1107278074 13:38700142-38700164 TAAAACATAATTCAATTTAAGGG + Intronic
1107346919 13:39471759-39471781 GGAACTAGAATTCATTTTTATGG + Intronic
1107429064 13:40322538-40322560 GAAAAAATAATGCATTTTGAAGG + Intergenic
1107582765 13:41809124-41809146 GGAAAGATATTCCATATTTATGG + Intronic
1107754487 13:43605174-43605196 GGAAAGATATTTCATGTGCATGG + Intronic
1108371241 13:49771276-49771298 GGAAATATATTTCATGTTCATGG - Intronic
1108488917 13:50959373-50959395 AGAAAGATATTTCATTTTACAGG + Intronic
1108540071 13:51433614-51433636 CGAAAGGTAATACTTTTTAAAGG + Intronic
1109043807 13:57379888-57379910 GGAAAGATATTCCATATTCATGG - Intergenic
1109046150 13:57413568-57413590 GGAAAGATATTCCATGTTCATGG + Intergenic
1109069188 13:57741537-57741559 GAAAAGAAAATTGTTTTTAATGG + Intergenic
1109131956 13:58598098-58598120 GGCTAGATAATTCATTTTTATGG - Intergenic
1109342436 13:61078076-61078098 GGAGAAATAATACATTTTAACGG + Intergenic
1109411701 13:61978901-61978923 GGAAAGACATTCCACTTTAATGG + Intergenic
1109450249 13:62504873-62504895 GGAAAGAAAATAAATTTGAATGG + Intergenic
1109824893 13:67705908-67705930 GGTACAATAATACATTTTAATGG + Intergenic
1109950481 13:69496637-69496659 GGAGAGATCATTTATTTAAAAGG + Intergenic
1109957291 13:69584971-69584993 GGAAAGGTAATTGCTTCTAATGG - Intergenic
1110053555 13:70936068-70936090 GGGAAGATAAACTATTTTAAGGG + Intergenic
1110074348 13:71219743-71219765 CGAAAGAAAATGCATTTAAAAGG + Intergenic
1110539886 13:76696318-76696340 GGAAAGAAAATTCCATTTGATGG + Intergenic
1110686866 13:78385710-78385732 GGAAAGAAAATACATTTAAAGGG + Intergenic
1110783852 13:79499732-79499754 GGAAAGATATTCCATGTTCATGG + Intronic
1110914582 13:81006004-81006026 GGAAAGATATTCCACGTTAATGG - Intergenic
1110949722 13:81470543-81470565 TGAAAGATAGTCCATGTTAATGG + Intergenic
1111269227 13:85858792-85858814 GGAAAGATTATTTATTCTATTGG - Intergenic
1111279223 13:85997542-85997564 GAAAAGATAATTCTTTTTTTTGG + Intergenic
1111351788 13:87040988-87041010 GAAAAAATAATTCAATTGAAGGG + Intergenic
1111414980 13:87928503-87928525 GGAAAGATATTCCATGTTAATGG + Intergenic
1111462606 13:88566685-88566707 GTGAATATAATTAATTTTAATGG + Intergenic
1111468513 13:88647085-88647107 TGAAGGATAAGTAATTTTAAAGG + Intergenic
1111486060 13:88901246-88901268 GCAAAAATAATTAATTTCAATGG + Intergenic
1111603188 13:90500773-90500795 GGAAAGTTATTCCACTTTAAAGG + Intergenic
1112053267 13:95665545-95665567 GAAAAGATATTTCATGTTCATGG - Intergenic
1112083933 13:96007802-96007824 GGAAAGATATTCCATGTTCATGG + Intronic
1112658469 13:101478825-101478847 GGAAAGAGATTTCATGTTCATGG + Intronic
1113143177 13:107177229-107177251 GGAAAGATATTCCATGTTCATGG + Intronic
1113207214 13:107930954-107930976 GGAAAGATAATTTTTTTTCTGGG - Intergenic
1113971160 13:114190642-114190664 GGAGAGATATTTTATGTTAATGG + Intergenic
1114345753 14:21792944-21792966 GAAAATAAAATTCATTTTTATGG - Intergenic
1114357907 14:21933921-21933943 GGAAAGAAAACATATTTTAAAGG - Intergenic
1114506986 14:23224104-23224126 GGAAAGATATTTCATGTTCACGG + Intronic
1114593186 14:23888097-23888119 GGAAAGATATTCCATGTTCATGG + Intergenic
1114820637 14:26014799-26014821 GGAAAGATATTTTATGTTCATGG + Intergenic
1114907602 14:27150312-27150334 GGAAAAATATTTCATGTTAATGG - Intergenic
1115076647 14:29400312-29400334 GGAAAGACATTTCATTGAAAAGG - Intergenic
1115086850 14:29526280-29526302 GGAAATATTATTCATTTAGAAGG + Intergenic
1115096678 14:29646098-29646120 GGAAAGATAAACCATATTCATGG + Intronic
1115381164 14:32740989-32741011 GGAAAGACACTCCATTTTCATGG - Intronic
1115401464 14:32966065-32966087 GGAAAGATATCTCATGTTAATGG + Intronic
1115617140 14:35106327-35106349 AGAGAGAGAATTTATTTTAAAGG - Intronic
1115861666 14:37693382-37693404 GGAAAGATATTCCATGTTCATGG + Intronic
1115918801 14:38348331-38348353 GGACAGATAGTTCATGTTCATGG + Intergenic
1115925036 14:38423433-38423455 GGAAAGATATTCCATGTTCATGG - Intergenic
1116062800 14:39945249-39945271 GGAAAAATATTTCATTTTCATGG - Intergenic
1116227904 14:42176167-42176189 GGACAGATAATGCAATTTATTGG + Intergenic
1116244187 14:42387776-42387798 GGAAACATAAATAATTTTAGGGG + Intergenic
1116322726 14:43491627-43491649 TGAAAGACAATTCATTGCAATGG + Intergenic
1116491878 14:45513959-45513981 GGAAAGATATTCCATGTTCATGG + Intergenic
1116497393 14:45578204-45578226 GGAAAGATAGTCCATGTTCATGG - Intergenic
1116506210 14:45685142-45685164 TGAAAGATAATCCATGTTTATGG - Intergenic
1116547840 14:46192664-46192686 GGAAAAATATTCCATGTTAATGG - Intergenic
1116670616 14:47837434-47837456 TGAAATAAAATTTATTTTAATGG - Intergenic
1116681635 14:47978175-47978197 GGAAAGAAAATCAATCTTAAAGG + Intergenic
1116930446 14:50685424-50685446 AGAAAGATATTCCATGTTAATGG - Intergenic
1117125207 14:52615587-52615609 GGAAAGATATTTCATGTTCATGG - Intronic
1117329734 14:54700679-54700701 GGAAAGAAAGCTCATTTTCAGGG - Intronic
1117418635 14:55521759-55521781 GGAAAGATATTCCATGTTCATGG + Intergenic
1117606547 14:57434937-57434959 GGAAAGATATTCCATGTTCATGG - Intergenic
1118033790 14:61844028-61844050 GGAAAGATATTTCATATTCGTGG - Intergenic
1118043714 14:61944248-61944270 GGAAAAATATTCCATGTTAATGG + Intergenic
1118078126 14:62325185-62325207 GGAAAGATATTCCATGTTCATGG - Intergenic
1118263726 14:64272983-64273005 GGAAAGATATTCCATGTTCATGG - Intronic
1118413703 14:65509545-65509567 GGAAAGATATTCCATGTTTATGG - Intronic
1118497845 14:66326459-66326481 GGAAAGATATTTACTTTTTAGGG + Intergenic
1118506213 14:66414844-66414866 GGAAAGAAAACTGATTATAAGGG - Intergenic
1118516573 14:66535588-66535610 GGATAGATAATCCATGTTCATGG - Intronic
1119110257 14:71965995-71966017 GGAAAAAGAATACATTTTAAAGG + Intronic
1119692664 14:76689488-76689510 GCAAAGAAAATTCATTTCAATGG + Intergenic
1119815195 14:77559924-77559946 GAAAAGATAATTAATATAAAGGG + Intronic
1120055677 14:79921268-79921290 GGAAAAATAGTGCACTTTAATGG + Intergenic
1120343143 14:83246906-83246928 AGTAAGAGAATTCTTTTTAAAGG - Intergenic
1120439339 14:84515744-84515766 GGAAAGATATTTCATGTTCATGG - Intergenic
1120456243 14:84733957-84733979 GGAAAGAGAATTTGGTTTAAAGG - Intergenic
1120514825 14:85458126-85458148 GGACAAATATTTCATTTGAAGGG + Intergenic
1120741353 14:88112067-88112089 GGAAAGTTCATTTCTTTTAAAGG + Intergenic
1121034248 14:90686882-90686904 GGAAAGATATCTCATGTTCATGG + Intronic
1121187222 14:91984704-91984726 AGCAAGATAATGCATTTTAATGG + Intronic
1121296937 14:92834923-92834945 GGACTGAGAATTTATTTTAAAGG + Intronic
1121367539 14:93328132-93328154 GGAAAGATATTCCATGTTCATGG + Intronic
1121401551 14:93682581-93682603 GAAAGGATAATTATTTTTAAGGG - Intronic
1121609451 14:95266559-95266581 GGAAAGATATTCCATGTTCATGG + Intronic
1121773510 14:96574143-96574165 GGAAAGATAAAGCAGTTTAGGGG + Intergenic
1122381726 14:101312001-101312023 GGAAAGATATTCCATGTTTATGG + Intergenic
1122435986 14:101699454-101699476 GGAAAGATATTCCATGTTCATGG + Intergenic
1122687132 14:103514469-103514491 TAAAAAATAATACATTTTAAAGG + Intergenic
1122912791 14:104841119-104841141 GGAAAGATACTTCATATTCATGG - Intergenic
1123462945 15:20490784-20490806 GGAAAAATATTTCATCTTCATGG - Intergenic
1123655114 15:22509635-22509657 GGAAAAATATTTCATCTTCATGG + Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1123828748 15:24110912-24110934 GGAAAGTTTCTTTATTTTAAAGG - Intergenic
1123863378 15:24491024-24491046 GGAAAGTTTCTTTATTTTAAAGG - Intergenic
1123958872 15:25372655-25372677 TGAAAGATATTTCATTTCACAGG + Intronic
1123981024 15:25603180-25603202 GGAAAGACATCTCATTTTCATGG - Intergenic
1124034447 15:26041646-26041668 GGAAAGATATTCCATGTTAATGG - Intergenic
1124081015 15:26496577-26496599 GGAAAGATATTCCATGTTCATGG - Intergenic
1124131487 15:26991551-26991573 GGAAAGATATTTTATGTTCATGG - Intronic
1124273784 15:28308179-28308201 GGAAAAATATTTCATCTTCATGG - Intronic
1124309024 15:28604836-28604858 GGAAAAATATTTCATCTTCATGG + Intergenic
1124504128 15:30257782-30257804 GGAAAGATAACCCATATTCATGG - Intergenic
1124739425 15:32280864-32280886 GGAAAGATAACCCATATTCATGG + Intergenic
1125007560 15:34835507-34835529 GGAAAGATATTCCATGTTCATGG + Intergenic
1125044111 15:35226695-35226717 GGAAAGATATTCCATGTTCATGG + Intronic
1125075816 15:35616942-35616964 GAACAGATAAATGATTTTAAAGG + Intergenic
1125138918 15:36379476-36379498 GGAAAGATATTCCATGTTCATGG - Intergenic
1125393170 15:39217674-39217696 GGAAAGATATTCCATGTTCATGG + Intergenic
1125414755 15:39440927-39440949 GGAAATCTTATTCATTCTAATGG - Intergenic
1126052586 15:44700123-44700145 GGAAAGATATTCCATGTTCATGG - Intronic
1126076189 15:44912417-44912439 GGAAAGATAATTAAGATTTAAGG + Intergenic
1126082656 15:44980583-44980605 GGAAAGATAATTAACATTTAAGG - Intergenic
1126395840 15:48216319-48216341 GGAAGGAAAGTTCATTTTAGAGG + Intronic
1126441063 15:48689267-48689289 GGAAAGATATTCCATGTTCATGG + Intergenic
1126510768 15:49471088-49471110 GAAAAGATAAGTACTTTTAAAGG + Intronic
1126521747 15:49603269-49603291 GGAAAGATAGTCCATGTTTATGG - Intronic
1126571764 15:50159130-50159152 GGAAAGATATTTCATGTTCATGG - Intronic
1126984180 15:54283755-54283777 GTAATGATAATTACTTTTAAGGG - Intronic
1127027536 15:54824072-54824094 GGAAAGATAACTCATGTTTGTGG - Intergenic
1127102883 15:55585755-55585777 GGACTGATAATTCAGTTCAAAGG + Intronic
1127196804 15:56595697-56595719 GGAAAGATAATCCATGTTTGTGG + Intergenic
1127442354 15:59022476-59022498 GGAAAGAAAATACAGTTAAATGG - Intronic
1127733938 15:61824554-61824576 GGATGGATAATACTTTTTAAAGG - Intergenic
1128207485 15:65866072-65866094 GGCCAGATAATTCTTTTTGATGG + Intronic
1128401459 15:67286062-67286084 GGAAAGATATTCCATGTTCATGG - Intronic
1129553774 15:76482870-76482892 GGAAAGATATTCCATATTCATGG + Intronic
1129635677 15:77314360-77314382 AAAAAGAAAATTCATTGTAATGG - Intronic
1130173125 15:81537754-81537776 GGAAAGATATTACATGTTATTGG + Intergenic
1130173126 15:81537775-81537797 GGAAAGATATTCCATGTTCATGG + Intergenic
1130400020 15:83542596-83542618 AGAAAGATAGTTCATGTTCATGG - Intronic
1130440716 15:83950629-83950651 GGAAAGATATTCCATGTTCATGG - Intronic
1130799606 15:87248531-87248553 AGAAATAAAATTCATTTTACTGG + Intergenic
1130950522 15:88583334-88583356 GGAAAGATATTCCATGTTCATGG + Intergenic
1131458793 15:92604110-92604132 GGAAAGATGATGAGTTTTAATGG - Intergenic
1131740235 15:95382150-95382172 AGAAAGATATTTCATGTTCATGG + Intergenic
1131780588 15:95853304-95853326 GGATAGATAATACATATTCATGG + Intergenic
1132443151 15:101888079-101888101 GGAAAGATATTTTATGTTCATGG - Intergenic
1132444317 15:101897949-101897971 GGAAAGATATCTCATGTTCATGG + Intergenic
1132520119 16:383227-383249 GGAAAAAGAAGTCACTTTAATGG - Intronic
1133704634 16:8342063-8342085 GTAATGATAATTAATTTTACTGG - Intergenic
1133896594 16:9935165-9935187 GGAAACATAAATCAATTTTAGGG - Intronic
1134392051 16:13829266-13829288 GGAAGGATGATTCATTTTCAGGG - Intergenic
1134396459 16:13869063-13869085 GGAAAGATATTCCATGTTCATGG + Intergenic
1135010134 16:18868855-18868877 TGAAAGATCTTTCATTTTAGGGG + Intronic
1135316977 16:21456008-21456030 TGAAAGATCTTTCATTTTAGGGG + Intergenic
1135369900 16:21888249-21888271 TGAAAGATCTTTCATTTTAGGGG + Intergenic
1135441914 16:22482873-22482895 TGAAAGATCTTTCATTTTAGGGG - Intronic
1135677328 16:24427575-24427597 GGAAAGATATTCCATGTTCATGG - Intergenic
1136313797 16:29436178-29436200 TGAAAGATCTTTCATTTTAGGGG + Intergenic
1136327237 16:29537943-29537965 TGAAAGATCTTTCATTTTAGGGG + Intergenic
1136441925 16:30277929-30277951 TGAAAGATCTTTCATTTTAGGGG + Intergenic
1136537166 16:30906747-30906769 GGAATTATAATCCATTTTACAGG - Intergenic
1136727692 16:32374479-32374501 GGAGAGATATATCATGTTAATGG - Intergenic
1138156295 16:54707477-54707499 GGAAAGTAAAATAATTTTAAAGG + Intergenic
1138256192 16:55564218-55564240 GGAAAGATATTCCATGTTTATGG + Intronic
1138326620 16:56177113-56177135 GGAAAGACATCTCATGTTAATGG - Intergenic
1138472429 16:57248500-57248522 GGAAAATTTATTCTTTTTAATGG - Intronic
1138806445 16:60095106-60095128 GGAAAGATATTCCATGTTTATGG - Intergenic
1139123161 16:64044782-64044804 GGAAAGATATTTTATGTTCATGG + Intergenic
1139304494 16:65972497-65972519 GGAAAGATATCTCATGTTCATGG - Intergenic
1139888729 16:70231658-70231680 TGAAAGATCTTTCATTTTAGGGG + Intergenic
1140243145 16:73222583-73222605 GGAGAGATATTTCATGTTCATGG + Intergenic
1140594969 16:76397827-76397849 GGAAAGAGATTTCATGCTAAAGG + Intronic
1140620339 16:76722546-76722568 GGAAAAATAATTTTTTTAAAGGG + Intergenic
1141038209 16:80647223-80647245 GGAAAGATATTCCATGTTCATGG + Intronic
1141337432 16:83169989-83170011 GGAAGGAAAATTAATTTGAAGGG - Intronic
1141494891 16:84401956-84401978 GGAAAGATATTCCATGTTCATGG - Intronic
1202998742 16_KI270728v1_random:143275-143297 GGAGAGATATATCATGTTAATGG + Intergenic
1203130340 16_KI270728v1_random:1679679-1679701 GGAGAGATATATCATGTTAATGG + Intergenic
1142937952 17:3352873-3352895 GGAAAGATATTGCATGTTTATGG - Intergenic
1143415149 17:6742110-6742132 GGAAAAATATTTCATGTTCATGG + Intergenic
1143430884 17:6883124-6883146 GGAAAGATATTCCATGTTTATGG - Intronic
1143435977 17:6925854-6925876 GGAAAGATATTTCATGTTCATGG + Intronic
1144174347 17:12690431-12690453 GGAAAGAAAATTAAGTTTACAGG + Intronic
1145405961 17:22594263-22594285 GGACAGATAATTCTTTGTTATGG - Intergenic
1146090853 17:29876002-29876024 GGAAAGATATTCCATGTTCATGG + Intronic
1147503940 17:40995181-40995203 TGACAGATACTTTATTTTAAAGG + Intergenic
1148454319 17:47802739-47802761 GGACAGATGCTTCATTTTGAGGG + Intergenic
1148461670 17:47842391-47842413 GGAAAGATATTTCATGCTCACGG - Intergenic
1149004026 17:51785931-51785953 GGAAAGATATTCCATGTTCATGG - Intronic
1149106271 17:52970908-52970930 GGAAAGATATCTCATGTTCATGG + Intergenic
1149318350 17:55459649-55459671 GGGTAGAGAAATCATTTTAAAGG - Intergenic
1150164663 17:62930356-62930378 GGGAAAATAAGTCATTTTACAGG - Intergenic
1150205632 17:63404139-63404161 GGAGTTATACTTCATTTTAAAGG - Intronic
1150996602 17:70325217-70325239 GGAAAGAGTCATCATTTTAATGG - Intergenic
1151167175 17:72214558-72214580 GGAAAGATATTCCATGTTCATGG - Intergenic
1151273826 17:73017907-73017929 GAAAAGAGAATTCTTTCTAAGGG + Intronic
1152775409 17:82198468-82198490 GCAAAGGTAATACATTTTCAAGG + Intronic
1152826370 17:82467917-82467939 GAAAAAATAAATAATTTTAAAGG - Intronic
1153088773 18:1319612-1319634 GGAAAGATATTTCATGTTCATGG + Intergenic
1153267906 18:3289287-3289309 GGAAAGATATTTCATGTTCTCGG - Intergenic
1153327613 18:3837245-3837267 GGAAAGCTAATTCATCATAATGG - Intronic
1153503979 18:5776510-5776532 GGAAAGACAACTCATGTTCATGG - Intergenic
1153843571 18:9029177-9029199 GTAAAGATAACCCATATTAATGG + Intergenic
1155107724 18:22684149-22684171 GAGAACATAATTCATTTTATTGG + Intergenic
1155116266 18:22770994-22771016 GGAAAGATATTCCATGTTCATGG + Intergenic
1155255452 18:23993863-23993885 GCAAAAATAATTGCTTTTAATGG + Intronic
1155282738 18:24256992-24257014 GGAAAGATATTCCATGTTCATGG + Intronic
1155373341 18:25128817-25128839 GGAAACATATTTCATGTTAATGG + Intronic
1155597716 18:27507675-27507697 GGAAAGATATTTTATGTTCATGG + Intergenic
1155712151 18:28895675-28895697 GGAAAGATATCTCATGTTCATGG + Intergenic
1155765577 18:29628106-29628128 AGAAATATTATTCATTTTCAAGG - Intergenic
1155895757 18:31323901-31323923 GAAAATATAATGCATTATAATGG - Intronic
1156043389 18:32850177-32850199 GGAAAGATATCTCATGTTCATGG + Intergenic
1156111282 18:33730238-33730260 GGCCAGATAATTCTTTTTAGTGG - Intronic
1156156237 18:34305940-34305962 GGAAAGATATTCCATGTTCATGG + Intergenic
1156358031 18:36359922-36359944 GGAAAGATGATACATTGAAATGG + Intronic
1156926740 18:42590375-42590397 GGAGAAATAATTTATGTTAATGG - Intergenic
1158024699 18:52881926-52881948 AGAAAGATATTTCATGTTCATGG - Intronic
1158136335 18:54212302-54212324 GGAAAGAAAATTCCTATTACTGG - Intronic
1158154964 18:54415481-54415503 GGAAAAATAATTATTCTTAATGG + Intergenic
1158173581 18:54627253-54627275 GGAAAGATACTCCATGTTCATGG + Intergenic
1158431794 18:57395279-57395301 GGAAAGATATTCCATGTTCATGG + Intergenic
1159091599 18:63855375-63855397 GGAAAGATATTCCATGTTTATGG - Intergenic
1159226265 18:65540493-65540515 GGCAGCATAATTCAATTTAAAGG - Intergenic
1159319469 18:66828704-66828726 GGAAACATATCTCATTTTTATGG - Intergenic
1159478568 18:68957741-68957763 GGAAAGATATTTCATGTTCAAGG - Intronic
1159524731 18:69573479-69573501 GGAAAGGTAATTCACTTTCCCGG + Intronic
1159542216 18:69792369-69792391 GGAAAGATATTCCATGTTCATGG - Intronic
1159545257 18:69832928-69832950 GGAAAGATATTCCATGTTCATGG + Intronic
1159648475 18:70948535-70948557 GGAAAGATATTCCATTTTCATGG + Intergenic
1159729292 18:72004931-72004953 AGTAAGAAAATACATTTTAATGG - Intergenic
1159802211 18:72915308-72915330 GGAAAGATATTTCATGTTCATGG - Intergenic
1159881046 18:73858863-73858885 TCAAAGATAAATCATTTTAAAGG - Intergenic
1160056382 18:75485510-75485532 GGAGAGATATTTCATGTTATTGG + Intergenic
1160191514 18:76718078-76718100 GGAAAGACATCTCATTTTCATGG + Intergenic
1160434623 18:78837727-78837749 TGAAAGATTATAGATTTTAAAGG + Intergenic
1160641035 19:136866-136888 GGAAAGATATCTCATGTTCATGG - Intergenic
1160641777 19:145067-145089 GGAAAGATATTTTATGTTCATGG + Intergenic
1162614757 19:11789503-11789525 GGAAAGATATTCCATGTTCATGG + Intergenic
1162666187 19:12214350-12214372 GGAAAGATATTCCATGTTCATGG - Intergenic
1163850790 19:19662277-19662299 GGATAGATAAGTCTTTTTGAAGG + Intronic
1164374372 19:27672550-27672572 GGCAACATAAGGCATTTTAATGG - Intergenic
1164531820 19:29054604-29054626 GGAAAAATATTTCATTACAAGGG + Intergenic
1164773741 19:30834261-30834283 TGAAACATATTTAATTTTAAGGG - Intergenic
1164962741 19:32449287-32449309 GGAAAGATAATTCACGTTCTTGG + Intronic
1165608658 19:37131272-37131294 GGAAAGATACTTTATTTTGAGGG + Intronic
1166009346 19:39929940-39929962 GGAAAGATATTCCATGTTCATGG + Intronic
1166431488 19:42731749-42731771 GGAAACACATTTCATTTTCATGG - Intronic
1166434608 19:42756962-42756984 GGAAACACATTTCATTTTCATGG - Intronic
1166444482 19:42846988-42847010 GGAAAGACATTTCATTTTCATGG - Intronic
1166447457 19:42870727-42870749 GGAAAGACATTTCATTTTCATGG - Intronic
1166451924 19:42909539-42909561 GGAAACACATTTCATTTTCATGG - Intronic
1166454370 19:42928409-42928431 GGAAACACATTTCATTTTCATGG - Intronic
1166464168 19:43017734-43017756 GGAAAGACACTTCATTTTCATGG - Intronic
1166470321 19:43074321-43074343 GGAAAGACATTTCATTTTCATGG - Intronic
1166481449 19:43177845-43177867 GGAAAGACATTTCATTTTCAAGG - Intronic
1166483920 19:43196961-43196983 GGAAAGACATTTCATTTTCATGG - Intronic
1166491036 19:43260827-43260849 GGAAAGACATTTCATTTTCATGG - Intronic
1167204852 19:48094240-48094262 TGAAAAATAATTCATGGTAAGGG - Intronic
1167518364 19:49937005-49937027 GGAAAGAAACTTTATTTGAAAGG - Intronic
1168186179 19:54701086-54701108 GGAAAGGTATCACATTTTAATGG - Intergenic
1168569853 19:57457593-57457615 GGAAAGATAATTCAATTGGGAGG + Intronic
925750449 2:7085535-7085557 GGAAAAATATTTCATGTTAATGG - Intergenic
926315489 2:11706683-11706705 GGAAAGAGAATTCATACTCAAGG - Intronic
926356258 2:12043419-12043441 GGAAAGATGATGCATCTTGATGG + Intergenic
926805976 2:16711475-16711497 GGAAAGATAATACATTTTGTAGG + Intergenic
927109759 2:19856080-19856102 GGAAACATACTTCATTTAGAAGG + Intergenic
927386323 2:22537964-22537986 TGATAGATAATTCATTCAAATGG - Intergenic
927481881 2:23460500-23460522 GGCAAGATAATTCTTTGTAATGG - Intronic
927614832 2:24582468-24582490 GGAAACATATTTCATGTTCATGG + Intronic
927984020 2:27394780-27394802 GGAATGATATTTCATTTTCCAGG + Intronic
928293951 2:30066025-30066047 GGAAAGATATTCCATGTTCATGG + Intergenic
928473920 2:31604670-31604692 GGAAAGATATTCCATGTTCAGGG + Intergenic
928485408 2:31726204-31726226 GGAATGATACTGAATTTTAAAGG - Intergenic
928491596 2:31789733-31789755 GGAAGGATATTCCATGTTAATGG + Intergenic
928679411 2:33684344-33684366 TGAAAGATAATCCATTCTCATGG - Intergenic
928847435 2:35694227-35694249 GGAAAGATAATCCATGTATATGG - Intergenic
928851647 2:35754615-35754637 GAAAAGATACTTCATGTTCATGG - Intergenic
928863605 2:35890848-35890870 GGAAAGATATTGCATGTTCATGG - Intergenic
928940240 2:36719991-36720013 GGAAAGATATTCCATGTTCATGG + Intronic
929067793 2:37997353-37997375 GGAGAGATAATCCATTCAAAAGG + Intronic
929212417 2:39372302-39372324 GGAAAGATATTCCATGTTCATGG + Intronic
929230364 2:39553809-39553831 GGAAAGATATTCCATGTTTATGG - Intergenic
929363440 2:41123107-41123129 GGAAAGAAATTTCATTAGAAAGG - Intergenic
929421758 2:41797887-41797909 GGAAAGACATTTCATGTTCATGG - Intergenic
929996717 2:46831130-46831152 GGCATTATAATTCAGTTTAATGG - Intronic
930294798 2:49541781-49541803 GGAAAGATATTCCATGTTCATGG + Intergenic
930549826 2:52819468-52819490 GGGAAGAGAAATAATTTTAAAGG + Intergenic
930985049 2:57575495-57575517 AAACAGATAATTCATTTTTAAGG + Intergenic
931054850 2:58457948-58457970 GCAAAGAAGATTCATTTTAGGGG + Intergenic
931494285 2:62785215-62785237 GGATGGTGAATTCATTTTAATGG - Intronic
931533294 2:63242287-63242309 GGAAATATAATGCATTTGGAAGG + Intronic
931561307 2:63564166-63564188 GGAAAGGTGCTTCATTATAAGGG + Intronic
931568495 2:63642437-63642459 GAAAAGATACTTCATGTTCATGG - Intronic
931572718 2:63686455-63686477 GGAAAGATATCTCATGTTCATGG + Intronic
932032217 2:68201255-68201277 GGAAATATAATTTTTTTTAAAGG - Intronic
932065874 2:68559389-68559411 GGCGAGCTAATTCAATTTAATGG + Intronic
932920693 2:75911175-75911197 GGAAAGATATTTCATGTTCGTGG - Intergenic
933022402 2:77210387-77210409 GGAATTTTAATTTATTTTAAAGG - Intronic
933332789 2:80915780-80915802 GGAAAGATATTTTATGTTTATGG - Intergenic
933451014 2:82451928-82451950 GTAAAAAAAATTCATTTTCATGG + Intergenic
933544498 2:83693794-83693816 TGAAAGATAATTCTTTATTATGG - Intergenic
933566371 2:83955372-83955394 GGAAAGACAATTGGTTTTACAGG - Intergenic
933869908 2:86556144-86556166 GACTAGATAATACATTTTAATGG + Intronic
933946364 2:87289209-87289231 GGAAAATTTATTCATTTTTATGG - Intergenic
934125805 2:88888674-88888696 GGAAAGATATTTCATGCTTAAGG - Intergenic
934318281 2:91946594-91946616 GGAGAGATATATCATGTTAATGG + Intergenic
935017096 2:99193692-99193714 GTAAACCTCATTCATTTTAATGG + Intronic
935549383 2:104435800-104435822 GAAAGGATAATTTATTGTAACGG - Intergenic
935673359 2:105573893-105573915 GGAAAGAGAATTTATTTTGATGG + Intergenic
936121954 2:109754348-109754370 GGAAAGATATTCCATGTTCATGG - Intergenic
936222741 2:110617124-110617146 GGAAAGATATTCCATGTTCATGG + Intergenic
936407429 2:112218967-112218989 GGAAAGACATCTCATGTTAACGG + Intronic
936417343 2:112328460-112328482 GGAAAGATATTCCATGTTCATGG - Intronic
936697817 2:114971798-114971820 GGAAAAACAATTATTTTTAAAGG - Intronic
937546999 2:123035395-123035417 GGAAAGAAAATTAGGTTTAATGG + Intergenic
937548531 2:123056660-123056682 AGAAAGATAATCTATTTAAATGG - Intergenic
937623593 2:124018558-124018580 TGAAGGAAAATTTATTTTAAAGG - Intergenic
938222698 2:129584967-129584989 GGAAAGATATTCCATGCTAATGG + Intergenic
938253573 2:129834757-129834779 GGAAAGATATCTCATGTTCATGG + Intergenic
938285970 2:130117756-130117778 GTAAAGATATTTCAGTATAATGG + Intronic
938336615 2:130506320-130506342 GTAAAGATATTTCAGTATAATGG + Intronic
938353203 2:130614342-130614364 GTAAAGATATTTCAGTATAATGG - Intronic
938429637 2:131221143-131221165 GTAAAGATATTTCAGTATAATGG - Intronic
938474452 2:131594333-131594355 GTAAAGATATTTCAGTATAATGG - Intergenic
938599122 2:132819318-132819340 AGAAAGCTAATTTATTTTAGTGG - Intronic
938872668 2:135497110-135497132 GTAAAAATAATTCATATTCATGG + Intronic
938918710 2:135971952-135971974 GGAAAGATATTCCATGTTCATGG + Intronic
939244419 2:139604963-139604985 TGAAAGATATTCCATATTAATGG - Intergenic
939408059 2:141785556-141785578 GGAGTGATACTTCATCTTAAGGG - Intronic
939561142 2:143733314-143733336 GGAGATCTGATTCATTTTAACGG + Intronic
939799336 2:146688846-146688868 TGAAACCTAATTCATTGTAAAGG - Intergenic
940190363 2:151034519-151034541 GGAAATACTATTCATTCTAATGG + Intronic
940785574 2:157977545-157977567 GGAAAGATATTTCATGTTCATGG - Intronic
940990727 2:160093601-160093623 GGAAAGATATTCCATATTCATGG + Intergenic
941170572 2:162131014-162131036 GGAAAGATATTCCATGTTCATGG - Intergenic
941265911 2:163362021-163362043 GGAGAGATATTCCATTTTCATGG - Intergenic
941277370 2:163506699-163506721 GGAAAGATAATCCATGTTCATGG - Intergenic
941500340 2:166266688-166266710 GGAAAGATATTCCATGTTCATGG - Intronic
941590055 2:167408885-167408907 GGAAAGATATTGCATGTTCATGG + Intergenic
941610235 2:167652616-167652638 GCAGAGATAAATCATTTAAAAGG - Intergenic
941679041 2:168376545-168376567 GGAAATATACTTCATATTCATGG + Intergenic
942286741 2:174425762-174425784 GGAAAGATAATGGAATTTGAGGG + Intronic
942302773 2:174578066-174578088 GGACAGATAATTCTTTTTTGTGG + Intronic
942371197 2:175287132-175287154 GGAAAAATGTTTCTTTTTAAAGG + Intergenic
942718294 2:178919778-178919800 GCAAAGGTAATTACTTTTAATGG - Intronic
942778231 2:179610679-179610701 GGAAAGATATTTCATGTTCATGG - Intronic
942838606 2:180332480-180332502 GGAAAGATATTTCATGTTCATGG + Intergenic
943075565 2:183189937-183189959 GGAAAGATGTTTCCTTTAAAAGG - Intergenic
943076240 2:183198908-183198930 GGAAAGATATTCCATGTTCATGG + Intergenic
943205059 2:184884313-184884335 GGAAAAATATTTCATTCTCATGG + Intronic
943260754 2:185659168-185659190 AGAAAAGTATTTCATTTTAATGG + Intergenic
943301635 2:186210063-186210085 GGAGAGATATTACATGTTAACGG - Intergenic
943858045 2:192824028-192824050 GGAAAGATATTTCATGTTTATGG + Intergenic
943913584 2:193599430-193599452 GGAAAAATATTTCATGTTCATGG + Intergenic
943945731 2:194060734-194060756 TGAAACTTAATACATTTTAAGGG - Intergenic
943950299 2:194125866-194125888 GGAAAGATATCTCATGTTCATGG + Intergenic
943967560 2:194356487-194356509 AGAAATATAATTCATTTTCATGG + Intergenic
944079025 2:195764749-195764771 GGAAAGATATTCCATGTCAATGG + Intronic
944356752 2:198798955-198798977 GGAAGGATATTACATTTTCATGG + Intergenic
944362766 2:198877703-198877725 GGAAAAATAATGCTTTGTAAAGG - Intergenic
944604229 2:201335799-201335821 GGAAAGATATTCCATGTTCATGG - Intronic
944615755 2:201458311-201458333 GAAAAAATAATTGTTTTTAAAGG - Intronic
944749365 2:202692567-202692589 GAAAAGGGAATTCTTTTTAAAGG + Intronic
945378059 2:209102892-209102914 GAAAAGGTAATTTATTTTTATGG - Intergenic
945397815 2:209342027-209342049 GGAAAAATATTTCATGTTCATGG + Intergenic
945632733 2:212302823-212302845 GGAAAGATAATTCATTTAAATGG - Intronic
945771366 2:214047049-214047071 GGAAAGATATTCCATGTTCATGG + Intronic
945806226 2:214492989-214493011 GGAAATAGAATTGATTTTCAGGG + Intronic
946513791 2:220389126-220389148 GGAAAGATATTCCATGTCAATGG - Intergenic
947039606 2:225901778-225901800 GGAAAGATACTCCATGTTCATGG + Intergenic
948775060 2:240282552-240282574 GGAGAGATATTCCATGTTAATGG + Intergenic
1168991458 20:2099738-2099760 GGAAAGATATTTCATGTTCATGG + Intergenic
1169335482 20:4752362-4752384 TTAAATATCATTCATTTTAATGG + Intergenic
1169944736 20:10976656-10976678 AGAAAGATAATACATTTCAGTGG + Intergenic
1170063109 20:12281107-12281129 TGAAAAATATTTCATGTTAATGG + Intergenic
1170142416 20:13138140-13138162 AGAAAGAAAATTCATATTCAAGG - Intronic
1170256636 20:14351372-14351394 GGAAAGATATTCCATGTTCATGG - Intronic
1170337559 20:15287139-15287161 GGAAACATAATTCACTTTCAAGG + Intronic
1170522495 20:17201840-17201862 GGAAAGACAAGTAATTTTGAGGG - Intergenic
1171008621 20:21493200-21493222 CGAAATATAATGCATTGTAAAGG + Intergenic
1171321736 20:24250786-24250808 GGAAAAATATTTCATATTCATGG + Intergenic
1171938318 20:31298179-31298201 GGAAAGATATTCCATGTTCATGG + Intergenic
1171944386 20:31363668-31363690 GGAAAGAAATATCATTTTTATGG + Intergenic
1172203390 20:33143427-33143449 TGAAAGATATTTCATGTTCATGG - Intergenic
1173203774 20:40974757-40974779 GGAAAGATATTTCATATTCATGG - Intergenic
1173276351 20:41587444-41587466 GGAAAGCTGATTCATCTGAAAGG - Intronic
1173599824 20:44286101-44286123 GGAAAGATACTCCATGTTCATGG - Intergenic
1174711514 20:52711180-52711202 GGAAAGAGAATCCAAATTAAAGG - Intergenic
1176049433 20:63109569-63109591 GGAAAGATATCTCATGTTCATGG - Intergenic
1176456078 21:6912566-6912588 AAAAAAAAAATTCATTTTAATGG - Intergenic
1176834251 21:13777614-13777636 AAAAAAAAAATTCATTTTAATGG - Intergenic
1177024139 21:15901002-15901024 GGAAAGATACTTCATGTTGATGG + Intergenic
1177137694 21:17323905-17323927 GGAAAGATATTTTATATTCATGG + Intergenic
1177358128 21:20034529-20034551 AGATAGATAATTCTATTTAAAGG - Intergenic
1177466365 21:21486389-21486411 GGAAATATAATCCATTTATAGGG + Intronic
1177494292 21:21869283-21869305 TAAAAGATATTTCATTTTCATGG - Intergenic
1177536091 21:22430016-22430038 TAAAAGATAAATTATTTTAATGG - Intergenic
1177652155 21:23971017-23971039 GGAAAGATATTCCATGTTCATGG - Intergenic
1177712198 21:24792241-24792263 GTAAAACTAATTCTTTTTAATGG - Intergenic
1177802819 21:25844843-25844865 GGCCAGATATTGCATTTTAATGG + Intergenic
1177850339 21:26339395-26339417 GGAAAGATATTCCATGTTCATGG + Intergenic
1178235711 21:30838645-30838667 GAAAAGATAATTTCTTTAAAAGG - Intergenic
1178455960 21:32751570-32751592 GGAAAAATATTACATTTTTAAGG + Intronic
1178458458 21:32778286-32778308 GGAAAGATGACTTTTTTTAAAGG - Intergenic
1178553228 21:33560298-33560320 GGAAAAATAATTAAAATTAAAGG - Intronic
1179419801 21:41226439-41226461 AGAAAGCTGTTTCATTTTAAGGG + Intronic
1180306461 22:11130275-11130297 GGAGAGATATATCATGTTAATGG + Intergenic
1180544980 22:16492458-16492480 GGAGAGATATATCATGTTAATGG + Intergenic
1181332137 22:22101083-22101105 GGAAATATGATTAAATTTAATGG - Intergenic
1181739277 22:24907407-24907429 GGAAAGATATCTCATATTCATGG + Intronic
1183671769 22:39277200-39277222 GGAAAGAACATTCCTTTTCATGG - Intergenic
1183770113 22:39917089-39917111 GGAAAGATCAGACATTTTTATGG + Intronic
1184326897 22:43795146-43795168 GGAAAGTGAATATATTTTAATGG + Intronic
1185129427 22:49030070-49030092 GAAAGGATAATTTATTTTATTGG - Intergenic
949228101 3:1717866-1717888 AGAAAGAGAATTCATTTAAATGG - Intergenic
949598442 3:5572945-5572967 GGAAAGATAATTCACATAACTGG - Intergenic
949861968 3:8513829-8513851 TGAAAGCAAGTTCATTTTAATGG - Intronic
949909447 3:8889199-8889221 GGAAAGATAGTAGAGTTTAATGG + Intronic
950060571 3:10068508-10068530 GGAAAGATACTTCATGTTCATGG + Intronic
950301982 3:11888090-11888112 GGAAAGATACTTCATGTTTATGG + Intergenic
950810722 3:15647610-15647632 GGGAAAATAAATCATTTTCAGGG + Intergenic
950827491 3:15840402-15840424 GGAAAGATACTCCATGTTCATGG + Intronic
950884698 3:16353211-16353233 GGAAAGATTTTTCCTTTTTAAGG - Intronic
950913948 3:16624266-16624288 GGAAAGATATTACATGTTCATGG + Intronic
950927378 3:16755141-16755163 GAAAAGATATTTCATGTTCATGG - Intergenic
950955549 3:17049696-17049718 GGAAAGATATTTCATGTTCATGG + Intronic
950992520 3:17454957-17454979 GGAAAGATATTCCATGTTCATGG + Intronic
951116180 3:18864736-18864758 GGCAAAAGAATTCATTTTTATGG + Intergenic
951392630 3:22125554-22125576 GGAAAGATAATCTATGTTTATGG - Intronic
951483788 3:23190092-23190114 GGAAAGACATTTCATATTCATGG + Intergenic
951672242 3:25197793-25197815 GGAAAGATATTCCATGTTCATGG + Intronic
952676780 3:36041441-36041463 GGAAATATATTTCATGTTGATGG - Intergenic
953178367 3:40573112-40573134 GGAAAGAGAATTAATGTTTATGG + Intronic
953297207 3:41731494-41731516 GGAAAGATACTCCATGTTCATGG + Intronic
953332366 3:42064382-42064404 TGTAAGAGAATTCTTTTTAAAGG - Intronic
953965400 3:47301021-47301043 GAAAAGATATTTCATTAAAAAGG - Intronic
954502817 3:51036437-51036459 TGAGAGATGATTCATTTAAATGG + Intronic
954503903 3:51050066-51050088 GGAAAGACATTTCATGTTCATGG + Intronic
954585001 3:51725943-51725965 GGAAAGATAATCCATGTTCATGG - Intergenic
955094554 3:55784284-55784306 ACAAAGGTAATTCATTTTATAGG + Intronic
955162834 3:56481704-56481726 GGAAATATAGTTTCTTTTAAGGG + Intergenic
955365073 3:58303903-58303925 GGGAAGACACTTCATTTTCAGGG + Intergenic
955460392 3:59175818-59175840 GGAAAGATAGTCCATGTTCATGG - Intergenic
955576987 3:60376726-60376748 GAAAAGGTAATACGTTTTAAAGG - Intronic
955584875 3:60466012-60466034 GGAAAGATATTCCATGTTCATGG - Intronic
956070958 3:65450546-65450568 GGAAAGATCATCAGTTTTAATGG + Intronic
956546712 3:70411340-70411362 GGACAGAAATTTCATTTTACAGG + Intergenic
956711667 3:72043563-72043585 GGAAAGATCATGCATTTAAAAGG + Intergenic
956964363 3:74441826-74441848 CAAAAGATAATTTATTTTATAGG - Intronic
957018759 3:75100322-75100344 GGAAAGATAATCCATGTTTATGG - Intergenic
957152241 3:76500409-76500431 GGCAAAATAGTTAATTTTAAAGG + Intronic
957650363 3:82994629-82994651 GGAAAGATATTCCATGTTCATGG + Intergenic
957749473 3:84394280-84394302 GAAAATATAATTCACTTTAGAGG + Intergenic
957854169 3:85852064-85852086 GGAAAGAACAGTTATTTTAAAGG - Intronic
957880050 3:86200423-86200445 TGAGAGATAATACATTTAAATGG + Intergenic
958270349 3:91491741-91491763 GGAAAGATAATTCAAGGCAAGGG - Intergenic
958461570 3:94404295-94404317 GGAAAGATATTCCATGTTCATGG - Intergenic
958645550 3:96868054-96868076 CGAATGTTTATTCATTTTAATGG - Intronic
958658940 3:97041286-97041308 GGAAAGATATCTGATTTCAAGGG - Intronic
958770443 3:98419803-98419825 GGAAAGACAATCCATGTTCATGG + Intergenic
958842346 3:99222676-99222698 GGAAAGATATTCCATGTTCATGG + Intergenic
959004305 3:101002527-101002549 GGAAAGATATTTCATATTCATGG - Intergenic
959113991 3:102154282-102154304 GGAAAGATATTCCATGTTCATGG + Intronic
959124553 3:102274722-102274744 GGAATGATATTCCATTTTCATGG - Intronic
959127881 3:102312835-102312857 GGAAAGATATTTCAAGTTCATGG + Intronic
959218657 3:103485573-103485595 GGAAAGAGAACTCATATTCATGG + Intergenic
959279562 3:104321471-104321493 GGAAAGATATTCCATGTTCATGG + Intergenic
959416704 3:106084702-106084724 GAAAAGATAACTGATTTTAAAGG - Intergenic
959471353 3:106755273-106755295 GAAAAGATATTCCATTTTCATGG + Intergenic
959595418 3:108124033-108124055 GGAAAAACAATTAATTTTCAAGG + Intergenic
959645890 3:108700195-108700217 GGAAAGATATTCCATGTTCATGG - Intergenic
959842067 3:110988802-110988824 GGAAAGATATTTCATGTTTATGG + Intergenic
959868178 3:111295306-111295328 GGAAAGATATTCCATGTTCATGG - Intronic
960462165 3:117949543-117949565 GGAAAAATCATTCATGTTCATGG + Intergenic
960493416 3:118346439-118346461 GGAGAAATAGTTCATGTTAATGG - Intergenic
960505137 3:118483988-118484010 GGAAATATAATTCTTTTCACAGG + Intergenic
960566412 3:119137088-119137110 GGAAAGATATTCCATGTTCATGG + Intronic
961702418 3:128756523-128756545 GGAAAGGTAACTCATGTTCATGG + Intronic
961985621 3:131130058-131130080 GGAAAAATAATCCATGTTCATGG - Intronic
962211720 3:133485209-133485231 GGAAAGATATTCCATGCTAATGG - Intergenic
962434953 3:135357644-135357666 GGCAAGATAATTCATCTTAAGGG - Intergenic
962468423 3:135682696-135682718 GAAAAGATAATCCATGTTCATGG + Intergenic
962584123 3:136824347-136824369 GGAAAAATATTTCATGTTCATGG - Intronic
962717977 3:138144066-138144088 GGAAAGATATTCCATGTTCATGG + Intergenic
962840944 3:139231886-139231908 GGAAAGTCAATTAATTGTAATGG - Intronic
963014947 3:140814318-140814340 GGAAATATATTTCATGTTCATGG + Intergenic
963020241 3:140866386-140866408 GGAAAGATATTCCATGTTTATGG - Intergenic
963135965 3:141904606-141904628 GGAAAAAAAATTCATTATACAGG + Intronic
963284584 3:143421148-143421170 GGAAAAATATTTCATGCTAATGG + Intronic
963403643 3:144835009-144835031 GGAAAGATATCTTATTCTAATGG - Intergenic
963678072 3:148339396-148339418 TTATAGATAATTCATTATAATGG - Intergenic
963720091 3:148852176-148852198 AGAAAGACAACTGATTTTAAAGG - Intronic
963753708 3:149211028-149211050 GGAATTACCATTCATTTTAAAGG - Intronic
964180004 3:153872322-153872344 GGAAAGATATTCCATGTTCATGG + Intergenic
964582107 3:158251443-158251465 GGAAAGATATTTCATGTTTATGG - Intronic
964687217 3:159409649-159409671 GGAAAGATATTCCATGTTCACGG + Intronic
964996596 3:162890080-162890102 GAAGAGATATTTAATTTTAATGG + Intergenic
965053311 3:163680347-163680369 GGAAGTATAATTTATTTGAAAGG + Intergenic
965114694 3:164473547-164473569 GGAGAGATATTCCATTTTTATGG - Intergenic
965250243 3:166333258-166333280 GCAAAGATAACTCATTTTTATGG - Intergenic
965348964 3:167589563-167589585 GGAAAGATATTCCATGTTCATGG - Intronic
965355887 3:167672501-167672523 TGAAATATAGTTCATTTTAAGGG - Intergenic
965359066 3:167714801-167714823 GGAAAGATATTCTATGTTAATGG + Intronic
965579769 3:170254949-170254971 GGAAAGATATTCCATGTTCATGG - Intronic
965793949 3:172418571-172418593 GGAAAGATAGTCCATGTTCATGG - Intergenic
965924668 3:173963101-173963123 GATGAGATAATGCATTTTAAAGG - Intronic
966275836 3:178167467-178167489 GGAAAGAAATTTCATATTCATGG + Intergenic
966360385 3:179122661-179122683 GGAAAGATATTCCATGTTCATGG + Intergenic
966464010 3:180209339-180209361 GGAAAGATATTCCATGTTCATGG + Intergenic
966464967 3:180221076-180221098 GGAAAGATAACTCATTTTTATGG - Intergenic
966477198 3:180363257-180363279 GGATAGGTATTTCATTTTCATGG - Intergenic
966549258 3:181185681-181185703 GGACAAATACTTAATTTTAAGGG + Intergenic
966579862 3:181548636-181548658 GGAAAGACATTTCATGTTCATGG - Intergenic
966664605 3:182457221-182457243 GGAAAGATATTTCATGTTTATGG - Intergenic
966992937 3:185252897-185252919 GGATAGGTAATTCTTTTTCAAGG + Intronic
967210677 3:187165587-187165609 GCTAGGAAAATTCATTTTAATGG + Intronic
967309453 3:188092290-188092312 ATAAACATTATTCATTTTAAAGG - Intergenic
967375583 3:188796950-188796972 GGAAAGATAGGTCATTTTAGGGG - Intronic
967748905 3:193091305-193091327 GGAAAGATACTTTATGTTTATGG + Intergenic
967761734 3:193233531-193233553 GGAATGATAAGTCATATAAATGG + Intergenic
968004489 3:195231005-195231027 GGAAAGATAAGCCATATTCATGG - Intronic
968109364 3:196031210-196031232 GGAAAGATATTCCATATTCATGG + Intronic
968262882 3:197339327-197339349 GGAAAGATATGCCAGTTTAAAGG - Intergenic
968334659 3:197902697-197902719 GGAAAGATATTCCATGTTCATGG + Intronic
968415179 4:425981-426003 GGAAAGATATTCCTCTTTAATGG - Intronic
969382958 4:6818584-6818606 GGAAAAATATTTCATGTTCATGG + Intronic
970282647 4:14475010-14475032 GGAAAGATTATCCACTTTTAAGG - Intergenic
970856604 4:20656349-20656371 GGAAATATATTTCATGTTTATGG + Intergenic
970973735 4:22018199-22018221 GGAAAAATAATAAATTTCAATGG - Intergenic
971095298 4:23394252-23394274 GGAAAGATATTTCATTCTCTTGG - Intergenic
971202322 4:24522017-24522039 GGAAAGAAACTTCAAGTTAATGG - Intronic
971543712 4:27856951-27856973 GGAAGAATATTTCATTTTCATGG - Intergenic
971601306 4:28595578-28595600 GAAAAGAAAATTCATTTTCTGGG + Intergenic
971901397 4:32664234-32664256 GGCAAGATAAGACATTTTGATGG + Intergenic
971936506 4:33156065-33156087 GGAAAAATATTTCATGTTTATGG + Intergenic
971957050 4:33434304-33434326 GGAGAGAGAATTCATTTTAATGG - Intergenic
971975954 4:33687294-33687316 TGAAAGATAATTCAGTAAAAAGG - Intergenic
972002071 4:34050022-34050044 GGAAAGACAAATCCTCTTAATGG + Intergenic
972089240 4:35258811-35258833 GAAAACATAATTCAGTCTAAGGG - Intergenic
972270539 4:37507119-37507141 AAAAAGATATTTCATGTTAATGG - Intronic
972867233 4:43247789-43247811 GGAAAGACATTTCATGTTCATGG - Intergenic
972915893 4:43879456-43879478 GGAGAGATATTTCATATTCATGG + Intergenic
972928772 4:44045445-44045467 GGAAAGATATTCCATGTTCATGG + Intergenic
973047463 4:45552474-45552496 CAAAAGATAATTTATTCTAAAGG - Intergenic
973074560 4:45906646-45906668 GGAAAGATAGTCCATGTTCATGG + Intergenic
973214807 4:47657146-47657168 GGAAAGATAATCCATGTTCATGG + Intronic
973625484 4:52767802-52767824 GAAAAGATATTTCATTTTCATGG - Intergenic
973688183 4:53396252-53396274 GTATAGATAATTCCTTTAAAAGG - Intronic
973853234 4:54982845-54982867 GGAAAGATATTCCATGTTTATGG + Intergenic
973967520 4:56179203-56179225 GGAAAAGAGATTCATTTTAAAGG + Intronic
974374705 4:61061444-61061466 GGAGAGATATTTCATATTTAGGG + Intergenic
974470017 4:62307269-62307291 GAAAAGATATTTCATGTTCATGG + Intergenic
974632470 4:64511235-64511257 GGAAAGATATTCCATGTTCATGG - Intergenic
974846555 4:67357909-67357931 GGAAAGATATTTCATGTTCTTGG - Intergenic
974884396 4:67799762-67799784 TGAAAAAAAATTAATTTTAAAGG + Intergenic
975068593 4:70102210-70102232 GGAAAGATATTCCATGCTAATGG + Intergenic
975081187 4:70282498-70282520 GTAAAGATATTTCATGTTCATGG + Intergenic
975123890 4:70759970-70759992 AGCTAGATAATTCATTTTTATGG - Intronic
975312919 4:72923787-72923809 GGATAGAAAGTTCATTTAAAGGG - Intergenic
975708128 4:77131090-77131112 GGAAAGATATTCCATTTTCATGG - Intergenic
975883984 4:78942772-78942794 GGAAAGTTAAGTCATGTAAATGG - Intergenic
976128833 4:81862292-81862314 GGAAAGATATTCCATGTTCATGG + Intronic
976453676 4:85220585-85220607 GGAAAGCTATTTCATGTTCATGG - Intergenic
976495467 4:85724770-85724792 AGAGAGATAATTCATTTCATAGG - Intronic
976574157 4:86649925-86649947 GGAAAGATATTCCATGTTCATGG - Intronic
976728089 4:88234931-88234953 GGAAAGATATTCCATGTTCATGG - Intergenic
976746302 4:88406626-88406648 CGAAAGAGAATATATTTTAAGGG + Intronic
976908558 4:90271005-90271027 GGAAAGATATTCCATGTTCATGG + Intronic
976997886 4:91458638-91458660 GGAAAGATATTCCATGTTCATGG - Intronic
977236472 4:94513357-94513379 GGAAAGATATTCCATGTTCATGG - Intronic
977268112 4:94880623-94880645 AAAAAAAAAATTCATTTTAATGG - Intronic
977341884 4:95769458-95769480 GGAAAGATATTTCATGTAAATGG + Intergenic
977349606 4:95864840-95864862 GGAAAGATAACACACATTAATGG - Intergenic
977406123 4:96601469-96601491 GGAAAGTTAGATCATTTTTATGG - Intergenic
977641798 4:99365850-99365872 GGAAAGATATTCCATGTTCACGG - Intergenic
977950769 4:102967880-102967902 GGAGAGATATATCATGTTAATGG + Intronic
978010095 4:103670457-103670479 GGGAAGATATTTCATGTTCATGG - Intronic
978054906 4:104251710-104251732 GGAAAAATATTTCATATTCATGG + Intergenic
978057420 4:104289210-104289232 GGAAAGATATTCCATGTTTATGG + Intergenic
978221497 4:106281050-106281072 GGAAATATATTTCATGTTTATGG - Intronic
978237284 4:106474346-106474368 GAGAATATATTTCATTTTAATGG + Intergenic
978272712 4:106909762-106909784 TGAAAGATAATTCTAATTAAAGG + Intergenic
978496549 4:109365669-109365691 GAAAAGAAAACTTATTTTAAAGG + Intergenic
978651461 4:111010581-111010603 AGAAAATTATTTCATTTTAATGG + Intergenic
978655108 4:111056403-111056425 GGCAAGATATTTCATGTTTATGG + Intergenic
978672151 4:111262455-111262477 GCCAAAATAGTTCATTTTAAAGG + Intergenic
978743035 4:112160420-112160442 GGAAAGATATTGCATGTTCATGG + Intronic
978874923 4:113628544-113628566 GGAAAGATAAGTCCTTTGAGAGG - Intronic
979280505 4:118861967-118861989 GGAAAGATATTCCATGTTCATGG - Intronic
979369993 4:119873711-119873733 GAAAACATAATTTATTTTATAGG + Intergenic
979422405 4:120521486-120521508 GGAAAGATATTCCATGTTCATGG + Intergenic
979892417 4:126115454-126115476 GGAAAGATATTTCATGTTTATGG - Intergenic
980205001 4:129706530-129706552 GCAAAGATAATTCCTTTAGAAGG + Intergenic
980258113 4:130408355-130408377 GGAAAGATATCCCATGTTAATGG - Intergenic
980442139 4:132862993-132863015 GGAGAGATATTTCATATTTATGG + Intergenic
980555734 4:134401560-134401582 GGAAAAATATTTCATACTAAAGG - Intergenic
980674586 4:136059513-136059535 GTATATATATTTCATTTTAAAGG - Intergenic
980695874 4:136354742-136354764 AAAAAGAAAATTCATTTTAATGG + Intergenic
980850646 4:138376980-138377002 GGAAAGCTATTTCATGTTCATGG + Intergenic
981453405 4:144925713-144925735 GGAAAGATATTCCATATTTATGG - Intergenic
981684080 4:147433730-147433752 GGAAAGATATTTTATGTTCATGG - Intergenic
981728962 4:147877456-147877478 GGAAAAATAACTCATGTAAAAGG - Intronic
981983325 4:150824057-150824079 TGAAAGATATTTCATATTCATGG - Intronic
981996489 4:150980989-150981011 GGAAAGATATTCCATGTTCACGG + Intronic
982055767 4:151547567-151547589 GGAAAGATAGCTCATAGTAATGG + Intronic
982146639 4:152402024-152402046 GTAGAAATAATTCATGTTAATGG + Intronic
982279740 4:153670963-153670985 GGAAAGATATTTCATGCTCAAGG - Intergenic
982282313 4:153696306-153696328 GGAAAGATATTCCATGTTCATGG - Intergenic
982308951 4:153963893-153963915 GGAAAGTTAATTCTTTAAAATGG - Intergenic
982527240 4:156493828-156493850 GGAAAGATAATTCTTTTTACAGG - Intergenic
982685152 4:158480046-158480068 GGAAAGTTTATTCAGTTTATTGG - Intronic
982899041 4:160974872-160974894 GGAAAGATAATCCATGTTCATGG + Intergenic
983001574 4:162420738-162420760 GCAAAGAAAATACATATTAATGG + Intergenic
983272648 4:165581310-165581332 GGAAAGATCAGTTATTTTAATGG - Intergenic
983618749 4:169736963-169736985 TGAAAGCTAAATCATTTTATAGG + Intronic
983665723 4:170180207-170180229 AGAAAGATAATTGCTTTTGAGGG + Intergenic
984044957 4:174785334-174785356 TGAAAGAAAATTTATTTTGAAGG - Intronic
984104143 4:175523304-175523326 GGAAAGATACTCCATGTTCATGG + Intergenic
984180335 4:176474969-176474991 GGAAAGAAATTTCATGTTCATGG + Intergenic
984859391 4:184223309-184223331 GGAAAGATATTCCATGTTCATGG + Intergenic
984932025 4:184856553-184856575 AGAGTGATAATGCATTTTAAAGG + Intergenic
985288476 4:188362154-188362176 GGATAAAAAATTCATTTTTATGG + Intergenic
986664413 5:10087868-10087890 GGCAAGAAAATTGATATTAAAGG + Intergenic
986725890 5:10596125-10596147 GCAAGCATAATTAATTTTAAAGG - Intronic
986754792 5:10825162-10825184 GGAAAGATATTCCATGTTCATGG + Intergenic
986884871 5:12221300-12221322 GGAAAGATATTCCATATTTATGG - Intergenic
986888704 5:12273440-12273462 AGGAAGACCATTCATTTTAATGG - Intergenic
987143728 5:14970870-14970892 GCAAAGATAATTACTTTGAAGGG + Intergenic
987437089 5:17907568-17907590 GCAAAGAAAATTTGTTTTAAAGG + Intergenic
987504653 5:18751949-18751971 GAAAAGATAAATCATATCAAGGG - Intergenic
987505617 5:18767123-18767145 GATAAAATAATTCATTTTTAAGG + Intergenic
987662262 5:20892442-20892464 GGAAAGATAATTTTTTGAAATGG + Intergenic
987895356 5:23938921-23938943 GGAAAGATATTCCATGTTCATGG - Intergenic
988236555 5:28552519-28552541 GGAAAGATAATTTGTGTTCACGG - Intergenic
988493275 5:31723253-31723275 GGAGAAATGATTCTTTTTAAAGG - Intronic
988607924 5:32696628-32696650 GGAAAGATATTCCATGTTCATGG - Intronic
989088934 5:37708746-37708768 AGAAAGGTAATTCAAATTAATGG + Intronic
989220922 5:38962458-38962480 GAAAAGATACTTCATGGTAATGG - Intronic
989476683 5:41882354-41882376 GGAAAGAAAAATTATTTTAAAGG - Intergenic
989629563 5:43467390-43467412 GAAAAGATATTCCATGTTAATGG + Intronic
989671320 5:43919942-43919964 GGAAAGATATTCCATGTTTATGG - Intergenic
990066604 5:51723576-51723598 GGAGAGATATTTCATCTTCATGG - Intergenic
990125654 5:52514654-52514676 GGAAAGATATTCCATGTTCATGG + Intergenic
990217556 5:53550932-53550954 GCAAAACTAAGTCATTTTAATGG + Intergenic
990410628 5:55537555-55537577 GAAATGACAATGCATTTTAATGG - Intergenic
990443865 5:55874498-55874520 GGAAAGATATTCCATGTTCATGG - Intronic
990577821 5:57140303-57140325 GGAAAGATATTCCATGTTCATGG - Intergenic
990784576 5:59405206-59405228 GGAAAGATATTTCATGTTCATGG - Intronic
990847959 5:60165633-60165655 AGAAAGATATTTCATGTTCATGG - Intronic
991240026 5:64447492-64447514 GAATAATTAATTCATTTTAATGG - Intergenic
991257140 5:64627562-64627584 GGAAAGATATTCCATGTTTATGG + Intergenic
991336920 5:65559195-65559217 GGAAAGATACTTCATATTCATGG + Intronic
991447943 5:66720166-66720188 GGAATGATAATTTTTTTAAATGG + Intronic
991651644 5:68861744-68861766 GGAAGGATAATTAATTTTATTGG + Intergenic
991681171 5:69141255-69141277 GGAAAAATATTTCATGTTCATGG - Intergenic
991692999 5:69243758-69243780 GGAAAGATAATTCATATTCATGG - Intronic
992337439 5:75786964-75786986 GGAAAGATATTCCATGTTCATGG + Intergenic
992344025 5:75857732-75857754 GGAAAGATATTTCATGCTAATGG - Intergenic
992668794 5:79037938-79037960 GGAAAGACATTTCATGTTCATGG + Intronic
992799802 5:80285638-80285660 GGAAAGCTATTTCATCTTAATGG + Intergenic
992905111 5:81338183-81338205 TGAAAGGTAATTCATTTTCTTGG - Intronic
993076299 5:83236083-83236105 GGAAAGATAATCCATGTTCATGG + Intronic
993102923 5:83563411-83563433 GGATAAAAAAGTCATTTTAAAGG + Intronic
993264481 5:85706642-85706664 GTAAATATAATTCACCTTAATGG + Intergenic
993271319 5:85800810-85800832 GTAAAGAAAATTCAGTTCAATGG - Intergenic
993410162 5:87563982-87564004 GGAAAAATATTTCATGCTAATGG - Intergenic
993473887 5:88340773-88340795 GGAAAGATATTCCATGTTCATGG + Intergenic
993475483 5:88358919-88358941 GAAAAGAAAAATCATTTTATAGG - Intergenic
993793283 5:92233797-92233819 GGAAAAATATTTCATTCTCATGG - Intergenic
994345133 5:98675816-98675838 AGAAAGATATTTCATGTTCATGG + Intergenic
994652883 5:102551396-102551418 AGAAAAATCACTCATTTTAATGG - Intergenic
994686222 5:102956376-102956398 GGTAAGATAATTCACTTTTGAGG + Intronic
994779435 5:104070490-104070512 GGAAATAAGATTCATTTTAGAGG - Intergenic
994891499 5:105641236-105641258 GGAAAGATTCTCCATGTTAATGG + Intergenic
995019415 5:107350546-107350568 GGAAAGATATTCCATGTTCATGG - Intergenic
995042722 5:107607487-107607509 AAAAATATAATTCGTTTTAAAGG - Intronic
995091219 5:108179909-108179931 GGAAGGATAATTCAGTTTGGTGG + Intronic
995268225 5:110189892-110189914 GGAAAGATATTTTATGTTTATGG - Intergenic
995289670 5:110437076-110437098 GAAAAGATATTTCATGTTCATGG - Intronic
995515012 5:112945577-112945599 GAAAAGATATTTCATGTTCACGG + Intergenic
995557995 5:113350057-113350079 GGAAAGATAATCCATGTTCATGG + Intronic
995572759 5:113498077-113498099 GGAAAGATATTTCATGTTCATGG - Intergenic
995609797 5:113897417-113897439 GGAAAGATAATTCATTGATTTGG + Intergenic
995754212 5:115485544-115485566 GGAAAGATATTCCATGTTCATGG - Intergenic
995777599 5:115741165-115741187 GGAAAGATATTTCATCATCATGG - Intergenic
996116038 5:119619901-119619923 GGAAAGTTATTCCATGTTAACGG - Intronic
996258726 5:121439147-121439169 GGAAAGATATTTTATGTTCATGG - Intergenic
996259716 5:121451264-121451286 GGAAAGATATTTTATGTTGATGG + Intergenic
996409351 5:123140515-123140537 GGCAAAATTATTCACTTTAAAGG + Intronic
996426899 5:123322574-123322596 GGAAAGACATCTCATGTTAATGG - Intergenic
996669749 5:126103242-126103264 GGAAAGATATTCCATGTTCATGG + Intergenic
997025662 5:130058073-130058095 GGAAAGAAGAGTGATTTTAAAGG - Intronic
997048234 5:130346054-130346076 GGAAAGATAAATGAATATAAAGG - Intergenic
997060358 5:130493923-130493945 GGAATGATATTTCATGTTCATGG + Intergenic
997188712 5:131908940-131908962 GGAAAGATATTCCATGTTCATGG + Intronic
997591322 5:135074344-135074366 ATAAAGATAATTGATTTTGAGGG - Intronic
998262853 5:140644337-140644359 GGATAAATAATCCAGTTTAAGGG - Intronic
998289687 5:140901826-140901848 GGAAAGATATTGCATGTTTATGG - Intronic
999357866 5:150953880-150953902 AGAAAGATACTTCATATTACTGG - Intergenic
999402403 5:151275694-151275716 CTAAAGAAAATTCATTTTAAGGG - Intergenic
999684172 5:154087697-154087719 GCAAAGAAAACTCATTCTAAGGG + Intronic
999744669 5:154583089-154583111 GGAAAGATCATAAATTTTGAAGG - Intergenic
999821169 5:155230337-155230359 GTTAAGATTATTTATTTTAAGGG + Intergenic
1000498900 5:162022559-162022581 GGAAATATATTTCATGTTCATGG + Intergenic
1001320129 5:170674038-170674060 GGACAGATATTTCATTGTGATGG + Intronic
1001378512 5:171285785-171285807 TGATAAATAATTCATTTCAATGG - Intronic
1001457711 5:171877832-171877854 GGAAAGCTAATTTTTGTTAAGGG - Intronic
1001903312 5:175449543-175449565 GGACAGATTTTTCATTTTAATGG + Intergenic
1002067997 5:176661959-176661981 GCAAAGACCTTTCATTTTAACGG + Intergenic
1002658046 5:180768909-180768931 GGAAAAATATTTCATGTTCATGG - Intergenic
1002695092 5:181082178-181082200 GGAAAGATATTCCATGTTCATGG + Intergenic
1002735083 5:181379417-181379439 GGAAAGATATTTTATGTTCATGG - Intergenic
1002736314 5:181389555-181389577 GGAAAGATATATCATGTTCATGG + Intergenic
1002748382 6:85269-85291 GGAAAGATATCTCATGTTCATGG - Intergenic
1002749443 6:94705-94727 GGAAAGATATTTTATGTTCATGG + Intergenic
1002766425 6:243353-243375 GGAAAGATATTCCATGTTCATGG + Intergenic
1003712726 6:8611196-8611218 GGAAATTTTAATCATTTTAATGG - Intergenic
1004587635 6:17017443-17017465 GGAAAGATTTCTCATTTTCATGG + Intergenic
1004774589 6:18829361-18829383 GAAAAGATGGTTTATTTTAAAGG + Intergenic
1005689779 6:28292549-28292571 GGAAAGATATTCCATTCTAATGG + Intronic
1006306415 6:33223180-33223202 GGAAAGATATTCCATGTTAATGG + Intergenic
1006462129 6:34166478-34166500 GGAAAGATATTCCATGTTCATGG - Intergenic
1006553575 6:34846026-34846048 GGAAAGATATTCCATGTTCATGG - Intronic
1007022477 6:38535370-38535392 GGAAAGATATTTCATGTTCATGG + Intronic
1007190280 6:40009920-40009942 AGAAAGATATTTCATGTTCATGG - Intergenic
1007495939 6:42260406-42260428 GGAGAGTTAGTTTATTTTAATGG + Intronic
1008277005 6:49553424-49553446 GGAAAAGAGATTCATTTTAAGGG - Intronic
1008422660 6:51320429-51320451 GGAAAGCTACTTTATTTTAAGGG - Intergenic
1008433669 6:51450077-51450099 GGAAAGATAGTTTACCTTAAAGG - Intergenic
1008667968 6:53735602-53735624 GGAAAGGTAATGCCTTTTGAGGG + Intergenic
1008727175 6:54436157-54436179 GGAAACATATTTCATGTTCATGG - Intergenic
1008822071 6:55645023-55645045 GGAAAGATATTCCATGTTCATGG - Intergenic
1008951315 6:57162884-57162906 GGAAAAATAATTATTTTTATAGG + Intronic
1008970753 6:57365221-57365243 GGAAAGATGATTTTTATTAAAGG + Intronic
1008984798 6:57529614-57529636 GGAAAGATAATTCAAGGCAAGGG + Intronic
1009159716 6:60267028-60267050 GGAAAGATGATTTTTATTAAAGG + Intergenic
1009172848 6:60422547-60422569 GGAAAGATAATTCAAGGCAAGGG + Intergenic
1009296145 6:61950524-61950546 GTAAATATACTTCATTTTGAGGG + Intronic
1009311480 6:62158512-62158534 GGAAAGATAATGTAATATAATGG - Intronic
1009375052 6:62957450-62957472 GGAAAGATATTCCATGTTCATGG - Intergenic
1009696230 6:67107380-67107402 GGAAAGCTATTTCATGTTCATGG + Intergenic
1009712213 6:67338885-67338907 GGAAAGATATTCCATGTTCATGG + Intergenic
1009824024 6:68843536-68843558 GGAAAGATATTCCATGTTCATGG + Intronic
1010018789 6:71136076-71136098 GGAAAGATATTTCATGTTCATGG + Intergenic
1010182327 6:73101763-73101785 GGAAAGATATTTCATGTTCATGG + Intronic
1010381243 6:75227468-75227490 GGAAAGATAGCTCATGTTCATGG + Intergenic
1010639424 6:78305343-78305365 GGAAAAATATTTCATGTTCATGG - Intergenic
1011033587 6:82949382-82949404 GGAAAGATATTTCATGTTCATGG + Intronic
1011169142 6:84485545-84485567 GGAAAGACATTTCATGTTCATGG + Intergenic
1011306157 6:85929452-85929474 GGAAAGATATTCCATGTTCATGG - Intergenic
1011339818 6:86301678-86301700 GGAAAGATATTTCATGTTCAAGG - Intergenic
1011343579 6:86345244-86345266 GGAAAGATATTCCATGTTCATGG + Intergenic
1011520862 6:88204287-88204309 GGAAAGATATTTCATGTTCATGG + Intergenic
1011620583 6:89238713-89238735 GGAGAGATATTCCATTTTCATGG - Intergenic
1011873151 6:91922390-91922412 GGAAAGCTATTTCATGTTCATGG + Intergenic
1011914233 6:92483102-92483124 GGAAAGATATTCCATGTTCATGG - Intergenic
1011915574 6:92502098-92502120 GGAAAAATAATGCATTTAAAAGG - Intergenic
1012029932 6:94046016-94046038 GGAAAGATAAATCATTTCTGAGG + Intergenic
1012117814 6:95326248-95326270 TGAAAAATGATTCATTATAATGG + Intergenic
1012312877 6:97749735-97749757 GGAAAGATTGTTCATATAAAAGG + Intergenic
1012332204 6:98006545-98006567 GGAAATATATTCCATTTTCATGG - Intergenic
1012353561 6:98284392-98284414 GGAAAAATAAATAATTCTAAAGG + Intergenic
1012459035 6:99440034-99440056 GCAAAGATTATTCATTTACATGG + Intronic
1012525095 6:100168113-100168135 GCAAGGAAAACTCATTTTAATGG + Intergenic
1012622116 6:101358172-101358194 GGACAGAAAATTCATTTTCTGGG - Intergenic
1012670557 6:102040900-102040922 GAAAATAGAATGCATTTTAATGG - Intronic
1012677928 6:102140321-102140343 TCAGAGATAATTAATTTTAAAGG - Intergenic
1012714554 6:102651602-102651624 AAAAAAAAAATTCATTTTAATGG + Intergenic
1012897624 6:104968804-104968826 ATAAAGACAATTCATTTGAATGG - Intronic
1013233812 6:108179118-108179140 GGAAACATACTTCATATAAAGGG - Intronic
1013336114 6:109164298-109164320 AGAACTATAATTCATTCTAATGG + Intergenic
1013631486 6:111990232-111990254 GAATACATATTTCATTTTAAAGG + Intergenic
1013700005 6:112755398-112755420 TGTAAAATAATTCATTATAAAGG + Intergenic
1014030465 6:116696149-116696171 TGAAAGATAGTACAGTTTAACGG - Intronic
1014235493 6:118949605-118949627 GGAAAGATATTCCGTTTTCATGG + Intergenic
1014235733 6:118952335-118952357 GGAAAGATACTCCATTTTCATGG - Intergenic
1014275476 6:119383155-119383177 GGAAACATATTTCATGTTTATGG - Intergenic
1014355303 6:120401117-120401139 GGAAAGATAATCCATGTTAATGG - Intergenic
1014521011 6:122441895-122441917 GGAGAGATATTTCATATTCATGG + Intergenic
1014855208 6:126392099-126392121 GGAAAGATATTTCATGTTCAGGG - Intergenic
1014932902 6:127354881-127354903 GGAAACATATTTCACTTTCATGG + Intergenic
1015011057 6:128348667-128348689 GGAAATATAATCCAATATAATGG + Intronic
1015097664 6:129435154-129435176 AGAAAGATCATTAATTTGAAGGG - Intronic
1015193850 6:130503824-130503846 AGAAAGATATTTCATGTTTATGG + Intergenic
1015345948 6:132159757-132159779 GGAAAGATATTCCATGTTCATGG - Intergenic
1015350526 6:132212735-132212757 GGAAAGATAAATGAATTTATTGG - Intergenic
1016246667 6:141989988-141990010 AGAAACTTAATGCATTTTAAAGG - Intergenic
1016294645 6:142561928-142561950 GGAAAAAGAATTTTTTTTAATGG + Intergenic
1016524161 6:144981535-144981557 AGGAAGATATTTCATGTTAATGG - Intergenic
1016660722 6:146576087-146576109 GGAAAGATACTTCATATTCATGG - Intergenic
1017207112 6:151815122-151815144 AGAAACATAGTTGATTTTAAAGG + Intronic
1017549466 6:155489914-155489936 GGTAAGCTCATTCTTTTTAATGG + Intergenic
1017574300 6:155784945-155784967 TGAAGGTTAATTCATTTTAGTGG + Intergenic
1017872240 6:158496334-158496356 GTAAGAATAATTTATTTTAAAGG - Intronic
1018086871 6:160309043-160309065 GGAAAGATATCTCATGTTTATGG - Intergenic
1018780688 6:167062383-167062405 GGAAATATATTTCATATTCATGG + Intergenic
1018866303 6:167748995-167749017 GGAAAGATGAATCATTCTCAGGG + Intergenic
1019066682 6:169307061-169307083 GGAAAGATATTCCATGTTCATGG + Intergenic
1019239342 6:170651734-170651756 GGAAAGATATTTTATGTTCATGG - Intergenic
1019241412 6:170665084-170665106 GGAAAGATATCTCATGTTCATGG + Intergenic
1019806849 7:3133547-3133569 GGAGAGATATTCCATGTTAATGG - Intergenic
1019879917 7:3849645-3849667 GGCCAGAGAATTCATTTTGATGG + Intronic
1020543266 7:9489679-9489701 GGAAACACAATCCGTTTTAAGGG - Intergenic
1020552911 7:9629685-9629707 CAAAAGAAAATTCATTTAAATGG - Intergenic
1020570949 7:9860316-9860338 GGAAAGATATTCCATGTTTATGG + Intergenic
1020864995 7:13548902-13548924 GGAAAGATATTCCATGTTCATGG + Intergenic
1020900377 7:13996262-13996284 GGAAATATTATTCCTCTTAATGG - Intergenic
1020942521 7:14559225-14559247 GGAAAAATAATTGATTTTATAGG - Intronic
1021026449 7:15673071-15673093 GGAGAAATCATTCATTATAAGGG + Intronic
1021161693 7:17281194-17281216 GGGAAGATAATTCAGGTAAAGGG - Intergenic
1021492140 7:21230723-21230745 GGAAATATATTTTTTTTTAAAGG + Intergenic
1021547884 7:21836115-21836137 GGAAAGATATTTCCTGTTCATGG + Intronic
1021699701 7:23305801-23305823 GGAAAGATACTTCATATTCATGG - Intronic
1022090839 7:27107196-27107218 AGAAATATAATTCCTTTAAACGG - Exonic
1022210126 7:28200576-28200598 GGAAAGATGAATCAATTTACAGG + Intergenic
1022987839 7:35676553-35676575 GGATCCATGATTCATTTTAATGG + Intronic
1023120119 7:36900730-36900752 GTGAAGATAAATCAATTTAATGG - Intronic
1023349867 7:39309555-39309577 GGAAAAAAAATTTTTTTTAAAGG - Intronic
1024020985 7:45369242-45369264 GGAAAGATATGTCATGTTTATGG - Intergenic
1024614058 7:51092902-51092924 GGAAAGATGTTTCATGTTCATGG - Intronic
1024775346 7:52778618-52778640 GGAGAAAAGATTCATTTTAAAGG - Intergenic
1025197745 7:56945636-56945658 GAAAAGAAAAATCATTTTAGGGG - Intergenic
1025485792 7:61046418-61046440 GGAATCATATTTCATTCTAATGG + Intergenic
1025674203 7:63631302-63631324 GAAAAGAAAAATCATTTTAGGGG + Intergenic
1025861348 7:65332885-65332907 GGAAAGATATTCTATTTTTATGG - Intergenic
1025920809 7:65910884-65910906 TGAAAGATACTACATTTTAAAGG - Intronic
1027294939 7:76760495-76760517 GGAAAAATCATGCAATTTAAAGG + Intergenic
1027334739 7:77137611-77137633 GGAGAGATATTTCATGTTCATGG + Intronic
1027339933 7:77196105-77196127 TGAAAAACAATGCATTTTAAAGG - Exonic
1027411860 7:77928133-77928155 ATAAATATAATGCATTTTAAAGG + Intronic
1027513579 7:79113153-79113175 TGACAAATACTTCATTTTAAAGG - Intronic
1027524522 7:79250618-79250640 GGAAAGACATTTCATGTTCACGG + Intronic
1027635236 7:80663626-80663648 GGTAATAGACTTCATTTTAATGG + Intronic
1027742316 7:82025269-82025291 GGAAAGACATCTCATGTTAATGG - Intronic
1027809089 7:82869953-82869975 GGAAAGATATTTCATGTTCATGG + Intronic
1027826485 7:83122997-83123019 GGAAAGATAGTTCATGTTTATGG + Intronic
1027921514 7:84401370-84401392 GGAAAAATATTCCATTTTCATGG + Intronic
1028004318 7:85542934-85542956 GGAAAGATATTCCATGTTCATGG - Intergenic
1028036835 7:85994593-85994615 GGAAAGATATTCCATGTTCATGG - Intergenic
1028390417 7:90310375-90310397 GGACATATAATTTATTTTTATGG + Exonic
1028398560 7:90399638-90399660 GGAAAGATATTCCATGTTCATGG + Intronic
1028478149 7:91274135-91274157 GATAAGATAATTCATTGTCATGG - Intergenic
1029003886 7:97186390-97186412 GGAAAGATATTCCATGTTCATGG - Intergenic
1029063576 7:97825059-97825081 GGAGAAATAATTTATTTTAATGG + Intergenic
1029781062 7:102733491-102733513 GGAGAGATATTTCATGTTCATGG - Intergenic
1030573241 7:111253179-111253201 GGAGAAATATTTAATTTTAATGG - Intronic
1030706055 7:112694361-112694383 GGAAAAATATTTCATGTTAATGG - Intergenic
1030724192 7:112906004-112906026 AGAAAGAAAATTCATTAAAATGG + Intronic
1030812796 7:113995923-113995945 GGAAAGATATCTCATGTTCATGG + Intronic
1030875444 7:114807749-114807771 GGTAAGATACTTCATTTCTAGGG + Intergenic
1030996467 7:116365068-116365090 GGCAAGATAATCCAGTTTAAAGG + Intronic
1031078535 7:117236218-117236240 GGAAAGATATTCCATGTTCATGG - Intergenic
1031098872 7:117453780-117453802 GGAAAGATATTCCATGTTTACGG + Intergenic
1031553141 7:123139539-123139561 GGAAAGATATTTCATGTTCATGG - Intronic
1031781333 7:125969950-125969972 GGAAAGAATACTCATTTTTATGG + Intergenic
1031812416 7:126388462-126388484 GGAAAGACATTTCATGTTCATGG + Intergenic
1032582941 7:133120078-133120100 GAAAATATAATGCATTTTTATGG - Intergenic
1032606628 7:133361958-133361980 AGAAAAATAATTCATTGAAAAGG - Intronic
1032890168 7:136185913-136185935 GGAAAGATAAGTTGTTTTATGGG - Intergenic
1032941126 7:136793640-136793662 GGAAAGATAATCCATGTTTATGG + Intergenic
1032972143 7:137177060-137177082 GGAAAGATATTTCATGTTCATGG + Intergenic
1033427994 7:141262938-141262960 GGAAAGAAAATGCATTTTGGTGG - Intronic
1033446476 7:141427076-141427098 GGAAAGATATTCCATGTTCATGG + Intronic
1033488772 7:141819574-141819596 GGAAAGATATTCCATGTTCATGG - Intergenic
1033812029 7:145026257-145026279 GGAAAGATATTCCATGTTCATGG + Intergenic
1033819633 7:145118821-145118843 GGAAAGATAATCCATGTTCATGG - Intergenic
1034607288 7:152329090-152329112 AGAAAGCTCATTCATTCTAATGG - Intronic
1034853475 7:154518059-154518081 TGAAGGAGCATTCATTTTAATGG - Intronic
1034915002 7:155030849-155030871 GGAAAGATATTCCATATTCATGG - Intergenic
1035084140 7:156242038-156242060 GGAAAGATATTTCATCTTCATGG - Intergenic
1035506705 8:143012-143034 GGAAAGATATATCATGTTCATGG - Intergenic
1035508428 8:154874-154896 GGAAAGATAGTTTATGTTCATGG + Intergenic
1035551159 8:527280-527302 GAAAAGATATTTCATGTTCATGG + Intronic
1035835490 8:2747173-2747195 GGAAAGATAGTCCATGTTTATGG + Intergenic
1035897393 8:3418806-3418828 GGAAGAATGAGTCATTTTAAAGG + Intronic
1036099914 8:5768416-5768438 GGAAAGATATTTCATATTTATGG - Intergenic
1036422281 8:8608837-8608859 GGAAAGATACTCCATGTTCATGG - Intergenic
1036500801 8:9312153-9312175 GAAAAGATAATTCATTATCTGGG + Intergenic
1037074793 8:14701378-14701400 GGGAAGAGAGTTGATTTTAATGG - Intronic
1037353795 8:17995691-17995713 GGAAAGATATTCCATGTTCATGG - Intronic
1037416602 8:18657707-18657729 AGTAATATAATTCATTTAAAAGG - Intronic
1038173573 8:25160922-25160944 GGAAGGAATATTCATTTTTAGGG + Intergenic
1038764018 8:30410904-30410926 TTAAAGAAAATTTATTTTAAGGG + Intronic
1038769534 8:30464315-30464337 GGAAAGAACTTTCAATTTAAAGG + Intronic
1038810411 8:30835570-30835592 TGCAAGATAATTCTTTTTTAAGG - Intronic
1038860643 8:31385619-31385641 GAAAAGATATTCCATGTTAATGG + Intergenic
1039031608 8:33315890-33315912 GGAAACATACATTATTTTAAAGG - Intergenic
1039265604 8:35820497-35820519 GGAAAAATATTTCATTCTCATGG + Intergenic
1039801632 8:40962117-40962139 GGAAAGATAGCTCATGTTCATGG + Intergenic
1040350458 8:46561624-46561646 GGAGAAATCATTTATTTTAATGG + Intergenic
1040366535 8:46723105-46723127 GGATAAATCATTTATTTTAATGG - Intergenic
1040416460 8:47200272-47200294 AGAAAGATAATTAAACTTAATGG + Intergenic
1040750540 8:50700695-50700717 GGAACGATAAATCATCTTGAGGG - Intronic
1041138982 8:54794076-54794098 GGAAAGATATTCCATGTTCATGG + Intergenic
1041387068 8:57315597-57315619 GGAAAGATATTCCATATTCAGGG + Intergenic
1041579538 8:59442152-59442174 AGAAAGATATTACATGTTAATGG - Intergenic
1041582725 8:59481083-59481105 GGAAAGATATTCCATGTTCATGG - Intergenic
1041616407 8:59912385-59912407 GGAAAGATATTCCATGTTCATGG + Intergenic
1041866114 8:62575479-62575501 GGAAAGATATTCCATGTTTATGG + Intronic
1041879145 8:62727707-62727729 GGAGAGATATTTCATGTTCATGG + Intronic
1041906795 8:63041579-63041601 GGAAAGATATCTCATGTTCATGG - Intergenic
1042026102 8:64425607-64425629 GTAAAGAAACTTCATTGTAATGG + Intergenic
1042163083 8:65917956-65917978 GGAAAGCTATTTCATCTTTATGG + Intergenic
1042469757 8:69172542-69172564 AGAAAGATAATCCATATGAATGG - Intergenic
1042518535 8:69684876-69684898 GGCCAGATAATTCCTTATAATGG - Intronic
1042627320 8:70772117-70772139 GCAAAGATAATACATTCTCAAGG - Intronic
1042726446 8:71883276-71883298 GGAAAAATATTTCATTCTCATGG - Intronic
1042739596 8:72028343-72028365 GGAAGGATCATTCATGTTAGTGG - Intronic
1042755276 8:72203716-72203738 GGAAGGATCATTCATGTTAGTGG - Intergenic
1043157763 8:76806507-76806529 GTAATGATAATTTATTTTATCGG + Intronic
1043215283 8:77578472-77578494 GGAAAGATATTTCATGTTCATGG + Intergenic
1043311636 8:78867172-78867194 GAAAAGATATTCCATGTTAATGG - Intergenic
1043413249 8:80021770-80021792 AGAAAGTTAATTTTTTTTAAAGG - Intronic
1043417044 8:80061937-80061959 GGAAAGACATTTCATGTTCATGG + Intronic
1043567719 8:81567167-81567189 GGAAAGATATTCCATGTTCATGG + Intergenic
1043600620 8:81933336-81933358 GGAAAGATATTCCATGTTCACGG + Intergenic
1043602503 8:81957753-81957775 GAAAAATAAATTCATTTTAAGGG + Intergenic
1043659297 8:82715933-82715955 AGAAATAGAAATCATTTTAAAGG - Intergenic
1043747599 8:83895528-83895550 GGTAAGATAAATAATTTTTAAGG + Intergenic
1043923275 8:86008378-86008400 TGAAAGATAAATTATTTTAAGGG - Intronic
1044359021 8:91259695-91259717 GGGAATATTATTCATTTTAGAGG - Intronic
1044450202 8:92326939-92326961 GGAAAGATATTTTATATTCATGG - Intergenic
1044957372 8:97495287-97495309 GGAAAGATATTCCACATTAATGG + Intergenic
1045553378 8:103192644-103192666 GGGAAGATAATACATTTAGATGG + Intronic
1045590414 8:103588265-103588287 GGAAAGATATTCCATGTTCATGG + Intronic
1045598353 8:103683744-103683766 GGAAAGATGATTCTTTTAAATGG + Intronic
1045632303 8:104139389-104139411 GGAAAGATATTCCATGTTCATGG - Intronic
1045732013 8:105253212-105253234 GGAAAGATATTCCATGTTCATGG - Intronic
1045847982 8:106659366-106659388 GTAAGGAAAATTTATTTTAAAGG - Intronic
1045881703 8:107048188-107048210 GGAAAGATAATCAATTATAAGGG + Intergenic
1045940941 8:107737403-107737425 GGAATGTTATTTCATTTTTATGG - Intergenic
1046119155 8:109823114-109823136 GGAAAGAAATTTCATGTTCATGG - Intergenic
1046134228 8:110005444-110005466 GGAAAGATATCTCATGTTCATGG - Intergenic
1046150350 8:110216162-110216184 GGAAAGATATTTCATGTTCATGG + Intergenic
1046763853 8:118048512-118048534 GGAAAAAAAATTGATTTGAAAGG - Intronic
1047086362 8:121520890-121520912 GGAGAGATAATTAATGTTCATGG + Intergenic
1047154845 8:122305282-122305304 GGAAAAATAATACATTCTCACGG + Intergenic
1047217701 8:122890583-122890605 GGAAAGAGATTTCATATTCATGG - Intronic
1047621716 8:126614411-126614433 GGATAGATAATAAATTGTAAGGG - Intergenic
1048079820 8:131113762-131113784 GGAAAGATAATCCATTTTAATGG - Intergenic
1048134423 8:131734312-131734334 GGAGAGTTATTTCATGTTAATGG + Intergenic
1048464094 8:134649723-134649745 GGAAAGATATTCCATGTTCATGG + Intronic
1049136012 8:140900771-140900793 TGAAAAATATTTCATGTTAAAGG + Intronic
1049650329 8:143763948-143763970 GATATGATAATTCATTTCAACGG + Intergenic
1050316468 9:4406813-4406835 GGAAAGATACTCCATGTTCATGG + Intergenic
1050510679 9:6391753-6391775 GGAAAGATATTCCATGTTCATGG + Intergenic
1050525751 9:6544800-6544822 GGCAAGTTGATACATTTTAAAGG - Intronic
1050556197 9:6791720-6791742 GGTTAGAAAATTCATTTTTACGG + Intronic
1050609388 9:7335873-7335895 GGAATGTTAATTTATTTGAATGG + Intergenic
1050629462 9:7543227-7543249 GGAAAGATAATTCAGAATACAGG - Intergenic
1050643896 9:7698032-7698054 GGAAAGATATTCCATATTCATGG - Intergenic
1050845425 9:10211292-10211314 GGAAAAATAATGCATCTTCAAGG + Intronic
1050864832 9:10485486-10485508 GGAAAGATACTCCATGTTCATGG - Intronic
1050869901 9:10554193-10554215 GGAAACATATTTCCATTTAAGGG - Intronic
1051110129 9:13626429-13626451 GGAAAGATATTTCATGTTCATGG - Intergenic
1051313337 9:15801238-15801260 GGAAAGATATTCCATGTTCATGG - Intronic
1051324720 9:15952808-15952830 GGAAACATATCTCATGTTAATGG - Intronic
1051542767 9:18238605-18238627 GGAAAGAAAACTCATTTTTTTGG - Intergenic
1051566239 9:18501739-18501761 ATAAACATAATTCATTTCAATGG - Intronic
1051883265 9:21862239-21862261 GAAAAAATATTACATTTTAAGGG + Exonic
1051980583 9:23010566-23010588 GGAAAGATATTTCATGCTCATGG + Intergenic
1052053765 9:23881022-23881044 GGAAAGATATTTCATTCTCATGG - Intergenic
1052071876 9:24091654-24091676 GGAAAGAAATCCCATTTTAAGGG + Intergenic
1052076904 9:24154149-24154171 TGAAATATATTTCATTTTAAAGG - Intergenic
1052305385 9:27002911-27002933 GGAAATATAATCCATGTTCATGG - Intronic
1052399208 9:27979355-27979377 GGGAAGAAAATTCAGTTAAAAGG + Intronic
1052479210 9:29000703-29000725 GTAGAGATAATTTTTTTTAATGG - Intergenic
1052565876 9:30150533-30150555 GGAAAGATATTCCATGTTCATGG - Intergenic
1052570904 9:30222165-30222187 GAAAGTATACTTCATTTTAATGG - Intergenic
1052977008 9:34418710-34418732 GGAAAGATCATCTAATTTAATGG + Intronic
1053520651 9:38774690-38774712 GGAAAGATATTTTATGTTTATGG - Intergenic
1053555078 9:39129010-39129032 GGAAAGATATCTCATGTTCATGG + Intronic
1053586822 9:39467184-39467206 GGAGAGATATTCCATGTTAATGG - Intergenic
1053819197 9:41949260-41949282 GGAAAGATATCTCATGTTCATGG + Intronic
1054109463 9:61092920-61092942 GGAAAGATATCTCATGTTCATGG + Intergenic
1054192807 9:61998685-61998707 GGAAAGATATTTTATGTTTATGG - Intergenic
1054579486 9:66898046-66898068 GGAGAGATATTCCATGTTAATGG + Intronic
1054611394 9:67238205-67238227 GGAAAGATATCTCATGTTCATGG - Intergenic
1054645599 9:67590006-67590028 GGAAAGATATTTTATGTTTATGG + Intergenic
1054831679 9:69632122-69632144 GGAAAGAAAAATAATATTAAAGG + Intronic
1054983011 9:71228832-71228854 GGAAAGATATTCCATGTTCATGG + Intronic
1055340406 9:75275635-75275657 GGAAAGATATTCCATGTTCATGG - Intergenic
1055431584 9:76249380-76249402 GGAAAGAAAATTCAATATTAGGG + Intronic
1055541733 9:77314278-77314300 TGATAGATAACTCATTTAAAAGG - Intronic
1055550836 9:77430949-77430971 GGAAATATGATTCATCTTTAAGG + Intronic
1055579653 9:77694386-77694408 GAAAAGATATTTCATATTCATGG - Intergenic
1055602503 9:77934463-77934485 TGAAAGATAATTATTTTTAGAGG - Intronic
1055820896 9:80262375-80262397 GGAAACATATTTCATGTTCATGG + Intergenic
1055827428 9:80344343-80344365 GGAAAGATATTCCATGTTCATGG + Intergenic
1055907792 9:81314295-81314317 GGAAGGACACTTCATTGTAATGG - Intergenic
1056003775 9:82245077-82245099 GGAAAGATATTCCATGTTGATGG - Intergenic
1056033369 9:82578262-82578284 AGAAATATATTTCATTTTAATGG + Intergenic
1056078598 9:83065948-83065970 GGCCAGATAATTCTTTGTAATGG - Intergenic
1056148663 9:83762417-83762439 GGAAAGATATTCCATGTTCATGG + Intronic
1056174211 9:84018392-84018414 GGAAACATATTCCATTTTCATGG - Intergenic
1056228898 9:84525211-84525233 GGAAAGATATTTTATATTCATGG - Intergenic
1057754237 9:97818891-97818913 GGAAAGATATTCCATGTTCATGG - Intergenic
1057931267 9:99195616-99195638 TGTAAGATAATTCATGTGAAAGG - Intergenic
1057999702 9:99852452-99852474 GGAAAGTTAAATGATTTTCAGGG + Intronic
1058302031 9:103387341-103387363 GGAAAGCTAATTTGTTTAAATGG - Intergenic
1058406363 9:104679742-104679764 GGAAAGATATTCCATGTTCATGG + Intergenic
1058522407 9:105823926-105823948 GGAAAGATATTCCATGTTCATGG - Intergenic
1058821616 9:108736412-108736434 GGAAAGATATTCCATGTTCATGG + Intergenic
1059030177 9:110684604-110684626 GGAAAAATATTCCATATTAATGG - Intronic
1059666985 9:116456369-116456391 GGAAAGATAATCCATGTTCATGG + Intronic
1059913353 9:119071219-119071241 GGAAATACAATTGATTTTCATGG - Intergenic
1060168222 9:121438377-121438399 TGAAAGATATTCCATATTAATGG - Intergenic
1060422287 9:123477804-123477826 GGAAAGCAATTTCATTTAAAAGG - Intronic
1060721119 9:125978973-125978995 GGAGAGATAGTTCATGTTCATGG - Intergenic
1062759550 9:138332025-138332047 GGAAAGATATTTTATGTTCATGG - Intergenic
1203599997 Un_KI270748v1:2797-2819 GGAAAGATATTTTATGTTCATGG - Intergenic
1203601604 Un_KI270748v1:14318-14340 GGAAAGATATCTCATGTTCATGG + Intergenic
1185528386 X:797295-797317 GGAAAAAAAATTACTTTTAAAGG - Intergenic
1185764083 X:2710357-2710379 GGAAGGATGAGTCACTTTAAGGG + Intronic
1186371637 X:8952872-8952894 GGTCAGATAATTCTTTTTTACGG - Intergenic
1186535424 X:10342135-10342157 GGAAAAATATTTCATTTTTCTGG - Intergenic
1186911255 X:14169081-14169103 GGAAAGATATTTTATGTTCATGG - Intergenic
1187075827 X:15933505-15933527 GGAAAGAGGATTTTTTTTAAAGG - Intergenic
1187090894 X:16095607-16095629 TGAAAGATATTTCATGTTCATGG - Intergenic
1187608862 X:20918132-20918154 GGAAAGATAGTTCATGCTGAGGG - Intergenic
1187610296 X:20935857-20935879 GGAAAGATATTTCATATTCATGG - Intergenic
1187651637 X:21415179-21415201 GGAAAGATATTTCATGTTCATGG - Intronic
1188077818 X:25800626-25800648 GGAAAGATATTCCATGTTCATGG - Intergenic
1188292934 X:28410948-28410970 GAAAAGGAAATGCATTTTAATGG + Intergenic
1188348920 X:29102988-29103010 GGAAAGATATTCCATGTTCATGG + Intronic
1188429071 X:30084578-30084600 GGAAAGATATTTCATGTTCATGG - Intergenic
1188444791 X:30244985-30245007 GGAAAAAAAATTCCTTTTAATGG - Intronic
1188459778 X:30411089-30411111 GGAAGGACAATTCATTGTAAGGG + Intergenic
1188745364 X:33834536-33834558 GGAAAGATATTTCATGTTCATGG - Intergenic
1188931605 X:36118366-36118388 GGAAAGATATTCCATGTTCATGG - Intronic
1189080215 X:37963018-37963040 GGAAAGACATGTCATGTTAATGG - Intronic
1189540815 X:41986425-41986447 GGAAAGATACCTCATGTTCATGG + Intergenic
1189712804 X:43831675-43831697 GGAAATATACTTCAATTTGATGG + Intronic
1190912228 X:54783701-54783723 GGAAAGATATTCCATGTTCATGG + Intronic
1190919026 X:54832839-54832861 GGAAAGATATTCCATGTTCATGG - Intergenic
1190961055 X:55248194-55248216 GGAAAGGTATTTCATGTTCATGG + Intronic
1191081523 X:56515746-56515768 GGAAAGATACTCCATGTTCATGG + Intergenic
1191083192 X:56535984-56536006 GGAAAGATATCTCATGTTCATGG + Intergenic
1191817995 X:65269899-65269921 GGAAAGATATCTCATGTTCATGG + Intergenic
1192009637 X:67254695-67254717 GGAAAAATATTTCATGTTCATGG + Intergenic
1192010365 X:67263851-67263873 GGAAAGATATTTCATGTTCATGG - Intergenic
1192029766 X:67496969-67496991 GGAAAGATATTTCATGTTCATGG + Intergenic
1192070328 X:67932901-67932923 GGAAAGATATTCCATGTTCATGG + Intergenic
1192512560 X:71732107-71732129 GAAATCATAATTCATTTTAATGG + Intergenic
1192514137 X:71749402-71749424 GAAATCATAATTCATTTTAATGG - Intergenic
1192526845 X:71853907-71853929 TAAATCATAATTCATTTTAATGG - Intergenic
1192530545 X:71879568-71879590 GGAAAAATATTTCATGTTGATGG + Intergenic
1192570253 X:72197770-72197792 GGAAAGAGAATACAGGTTAAAGG - Exonic
1192683319 X:73277203-73277225 AAAAAGATAATAGATTTTAAAGG - Intergenic
1192688453 X:73332976-73332998 GGAAAGATATTTCATTCAAATGG - Intergenic
1192838695 X:74830678-74830700 GGAAAGATATTCCATGTTCATGG - Intronic
1192854137 X:74990136-74990158 GGAAAGATATTCCATATTCATGG + Intergenic
1192884911 X:75326398-75326420 AAAAAAAAAATTCATTTTAATGG + Intergenic
1193003111 X:76584518-76584540 GGAAAGATATTTCAAGTTCATGG - Intergenic
1193111283 X:77733167-77733189 GTAAAGATATTTCATGTTCATGG + Intronic
1193252928 X:79314089-79314111 GAAAAGATATTTCATCTTCATGG + Intergenic
1193293238 X:79803346-79803368 AGAAAGATATTTCATGCTAATGG - Intergenic
1193296358 X:79836559-79836581 GGAAAGGTAATTTATGTTCATGG - Intergenic
1193435048 X:81463194-81463216 GGAATGATATTTCATATTCAGGG - Intergenic
1193449552 X:81649064-81649086 GGAAAGATATTTTATATCAATGG + Intergenic
1193528969 X:82630731-82630753 GGAAAAATAGTTCATGTTTATGG + Intergenic
1193596635 X:83453837-83453859 GGAAGGATAATGCATTTTTGAGG + Intergenic
1193620566 X:83748440-83748462 AAAAAGAAAATTCATTTTAATGG + Intergenic
1193623323 X:83784680-83784702 GGAAAAATATTTCATGTTTATGG + Intergenic
1193660419 X:84250154-84250176 GGAAAGTTACTTCTTTTTAATGG - Intergenic
1193846628 X:86479544-86479566 GGAAAGAAAATTTATTTAAAGGG - Intronic
1193982018 X:88193045-88193067 GGAAAGATATTCCATGTTCAAGG + Intergenic
1193989838 X:88293011-88293033 GGAAATATATTTCATGTTCATGG + Intergenic
1194219366 X:91171934-91171956 GGAAAGATATTCCATGTTCATGG - Intergenic
1194230040 X:91310414-91310436 ATATATATAATTCATTTTAATGG + Intergenic
1194276133 X:91884555-91884577 GAAAAGTGAATTCATTTTAAAGG - Intronic
1194329559 X:92564132-92564154 GGAAAGATATTTCGTGTTCATGG + Intronic
1194350003 X:92814990-92815012 GGAAAGACATTTCATGTTTATGG + Intergenic
1194478114 X:94385292-94385314 GGAATAAGGATTCATTTTAAAGG + Intergenic
1194623319 X:96199378-96199400 GGAAAGATATCTCATGTTTATGG + Intergenic
1194743203 X:97600289-97600311 GGAAAAAGAATTCTTTTTACAGG + Exonic
1194763499 X:97821938-97821960 GGAGTCATAATTCCTTTTAATGG + Intergenic
1194787268 X:98101640-98101662 GGAAAGATATTCCATGTTCATGG - Intergenic
1195133804 X:101882605-101882627 TGGGAGATAATTTATTTTAAAGG - Exonic
1195370667 X:104169041-104169063 AGAAGGATAATACATTTAAAAGG - Intronic
1195452089 X:105026704-105026726 GGAAAGATATTCCATGTTCATGG + Intronic
1195582505 X:106523368-106523390 GGAAAGATAATTTGTGTTCATGG - Intergenic
1195601893 X:106758292-106758314 GGAAAGATATTCCATGTTCATGG + Intronic
1195650931 X:107283772-107283794 GGAAAGATATTCCATGTTTATGG + Intergenic
1195657193 X:107343248-107343270 GGAAAGGAACTCCATTTTAAAGG - Intergenic
1195714047 X:107800952-107800974 GGAAAGATATTCCATATTCATGG + Intergenic
1196071334 X:111526197-111526219 GGAAAGATATTCCATGTTCATGG + Intergenic
1196216098 X:113053458-113053480 GGAAAGATATTCCATGTTCATGG + Intergenic
1196232102 X:113235775-113235797 GGAAAAATATTCCATGTTAATGG - Intergenic
1196264361 X:113624755-113624777 GGAAAGATATTCCATGTTCATGG - Intergenic
1196305058 X:114092219-114092241 GGAAAGATATTTCATGTTCGTGG + Intergenic
1196383071 X:115115073-115115095 GGAAAGATGTCTCATGTTAATGG + Intronic
1196474186 X:116063630-116063652 GGATAGACAGTTCATGTTAATGG - Intergenic
1196552810 X:117049904-117049926 GGAAAGATAATTCATGTTCATGG + Intergenic
1196578759 X:117354230-117354252 GGAGAAATATTTCATTTTCATGG - Intergenic
1196588835 X:117461836-117461858 GGGAAGATAATCCATGTTCACGG + Intergenic
1196601032 X:117602263-117602285 GGAAAGATATTTCATGTTCTTGG + Intergenic
1196639681 X:118044245-118044267 GGAAAGATATTTCATCTTCATGG + Intronic
1196751688 X:119123788-119123810 GGAAGGATAATTCTCTGTAATGG - Intronic
1196967333 X:121071701-121071723 GAAAAGATATTCCATGTTAATGG - Intergenic
1196986520 X:121279420-121279442 GGAAAGATATTTCATGTTCATGG + Intergenic
1196995871 X:121383096-121383118 GGAAAAATAATCCATGTTTATGG + Intergenic
1197011798 X:121573111-121573133 GAAAATATATTTCATGTTAATGG + Intergenic
1197080816 X:122413245-122413267 GGAAGACTAATTCATATTAATGG + Intergenic
1197117784 X:122853294-122853316 GGAAAGATATTTCATGCTCATGG + Intergenic
1197165467 X:123372499-123372521 GGAAAGATATTCCATGTTCATGG - Intronic
1197277815 X:124500296-124500318 GGAAAAATAGATCATTTTGAAGG + Intronic
1197360741 X:125499960-125499982 GGAAAGATATTTCTTGTTCATGG - Intergenic
1197402929 X:126014460-126014482 GGAAATATATTTCATGTTCATGG - Intergenic
1197429831 X:126347918-126347940 GGAAACATATTCCATGTTAATGG + Intergenic
1197553028 X:127918229-127918251 GGAAAGATATGTCATGTTCATGG - Intergenic
1197590213 X:128400261-128400283 GGAAAGATATTCCATGTTCATGG + Intergenic
1197623175 X:128774260-128774282 GGAAAGATATTGCATGTTTATGG - Intergenic
1197682221 X:129398046-129398068 GGAAAGATATTCCATGTTCATGG + Intergenic
1197875960 X:131106766-131106788 GGAAAGATATCTCATGTTCATGG - Intergenic
1198315896 X:135465750-135465772 AGAAAGATATTTCATGTTCATGG + Intergenic
1198430404 X:136560400-136560422 GGAAAGATATTCCATGTTTATGG - Intergenic
1198454406 X:136801689-136801711 GGAAAGGAAAGTCATTTCAATGG - Intergenic
1198614338 X:138438815-138438837 GGAAAGATATTTCACATTTATGG - Intergenic
1198652924 X:138883468-138883490 GGGAAGATCAATCACTTTAAGGG + Intronic
1198723837 X:139655265-139655287 GGAAAGATATTTCATGATCATGG - Intronic
1198789723 X:140331200-140331222 GGAAAGACATCTCATTTTCATGG - Intergenic
1199048703 X:143209354-143209376 GGAAAGATATTTTATTTTCATGG + Intergenic
1199075870 X:143525018-143525040 GGAAATATATTCCATTTTAATGG - Intergenic
1199155759 X:144547104-144547126 GAAAATATAATTTATTTTTAAGG + Intergenic
1199189870 X:144958293-144958315 GGAAAGATATTCCATGTTTATGG + Intergenic
1199341590 X:146684115-146684137 GGAAAGATAGTCCATGTTCATGG - Intergenic
1199905448 X:152224558-152224580 AGAAAGAAAATTCTTGTTAAAGG + Intronic
1199992743 X:152997146-152997168 TGAGAGATAATTTATTTGAAAGG - Intergenic
1200300813 X:154973464-154973486 GGAAAGATATTTCATGTTCATGG - Intronic
1200555878 Y:4635697-4635719 GGAAAGATATTCCATGTTCATGG - Intergenic
1200593380 Y:5106008-5106030 GAAAAGTGAATTCATTTTAAAGG - Intronic
1200638260 Y:5683330-5683352 GGAAATATATTTCATGTTCATGG + Intronic
1200658322 Y:5931609-5931631 GGAAAGACATTTCATGTTTATGG + Intergenic
1201226733 Y:11825737-11825759 GCAGAGATAATTCATTTTCATGG - Intergenic
1202023792 Y:20497244-20497266 GGAAAAATATTTCATGTTCATGG - Intergenic
1202346147 Y:23930177-23930199 GAAAAGATCAATCATATTAATGG - Intergenic
1202524624 Y:25739913-25739935 GAAAAGATCAATCATATTAATGG + Intergenic