ID: 1101109080

View in Genome Browser
Species Human (GRCh38)
Location 12:101468191-101468213
Sequence ATGAAGAAACAGGCTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101109080_1101109090 22 Left 1101109080 12:101468191-101468213 CCTCCCTGAGCCTGTTTCTTCAT No data
Right 1101109090 12:101468236-101468258 AAAGCAAAGGCTGGGCGTGGTGG No data
1101109080_1101109085 -9 Left 1101109080 12:101468191-101468213 CCTCCCTGAGCCTGTTTCTTCAT No data
Right 1101109085 12:101468205-101468227 TTTCTTCATCTGTAAAATGAGGG 0: 25
1: 197
2: 924
3: 2493
4: 4983
1101109080_1101109086 9 Left 1101109080 12:101468191-101468213 CCTCCCTGAGCCTGTTTCTTCAT No data
Right 1101109086 12:101468223-101468245 GAGGGTAATTAAGAAAGCAAAGG No data
1101109080_1101109089 19 Left 1101109080 12:101468191-101468213 CCTCCCTGAGCCTGTTTCTTCAT No data
Right 1101109089 12:101468233-101468255 AAGAAAGCAAAGGCTGGGCGTGG No data
1101109080_1101109087 13 Left 1101109080 12:101468191-101468213 CCTCCCTGAGCCTGTTTCTTCAT No data
Right 1101109087 12:101468227-101468249 GTAATTAAGAAAGCAAAGGCTGG No data
1101109080_1101109084 -10 Left 1101109080 12:101468191-101468213 CCTCCCTGAGCCTGTTTCTTCAT No data
Right 1101109084 12:101468204-101468226 GTTTCTTCATCTGTAAAATGAGG 0: 152
1: 1160
2: 4094
3: 8373
4: 13640
1101109080_1101109088 14 Left 1101109080 12:101468191-101468213 CCTCCCTGAGCCTGTTTCTTCAT No data
Right 1101109088 12:101468228-101468250 TAATTAAGAAAGCAAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101109080 Original CRISPR ATGAAGAAACAGGCTCAGGG AGG (reversed) Intergenic
No off target data available for this crispr