ID: 1101111578

View in Genome Browser
Species Human (GRCh38)
Location 12:101491665-101491687
Sequence GCATGTGCACCCACCTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101111573_1101111578 11 Left 1101111573 12:101491631-101491653 CCTATTACAAACAGGGTCATTCT 0: 1
1: 0
2: 1
3: 6
4: 534
Right 1101111578 12:101491665-101491687 GCATGTGCACCCACCTGCTAAGG 0: 1
1: 0
2: 0
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101111578 Original CRISPR GCATGTGCACCCACCTGCTA AGG Intergenic
901412931 1:9097550-9097572 GCCTGTACTCCCAGCTGCTAGGG + Intergenic
901603354 1:10439827-10439849 GCATATGCAGGCACCTCCTAAGG - Intronic
902860259 1:19240089-19240111 GCATTTGGAGCCACCTGCCATGG - Intronic
902931096 1:19732056-19732078 GCCTGTGCACCCAGCTGCATGGG + Intronic
906072329 1:43026113-43026135 CCATGTGCACCCCACTGCTGAGG - Intergenic
911135867 1:94439515-94439537 GCATGTGGTCCCACCTGCTCAGG + Intronic
911911688 1:103645349-103645371 GCCTGTGCTCCCAGCTGCTTGGG + Intergenic
911916766 1:103706599-103706621 GCCTGTGCTCCCAGCTGCTTGGG - Intronic
911919103 1:103739487-103739509 GCCTGTGCTCCCAGCTGCTTGGG + Intronic
919232318 1:194790068-194790090 GCATGTGCACCCACTCATTATGG + Intergenic
920437754 1:205959117-205959139 GGGTGTACACCCAACTGCTAAGG - Intergenic
922439952 1:225646662-225646684 GCCTGTGGTCCCACCTGCTCAGG + Intronic
923469486 1:234278066-234278088 GCCTGTGGTCCCACCTGCTCAGG + Intronic
924344960 1:243065057-243065079 GCATGTACACTCAGCTACTAGGG + Intergenic
1065587458 10:27233591-27233613 GCATGTGGTCCCAGCTACTAGGG + Intronic
1066138505 10:32477325-32477347 GCCTGTGGTCCCAGCTGCTAGGG - Intronic
1066458642 10:35594308-35594330 GCATGTGCACCCACCAGGGTTGG + Intergenic
1066535989 10:36392724-36392746 GCCTGTACTCCCACCTGCTCAGG + Intergenic
1069476441 10:68737375-68737397 GCATGTGGTCCCAGCTGCTTGGG + Intronic
1070590861 10:77800064-77800086 GATTGTGCACCCACCTGCAATGG - Intronic
1071299641 10:84246908-84246930 GCATGTGCAAAGACATGCTATGG - Intronic
1073747816 10:106490131-106490153 GCATGTGGTCCCAGCTGCTTGGG - Intergenic
1074192788 10:111152141-111152163 GCATGTGCACCCACCGTTTCAGG + Intergenic
1074346488 10:112691134-112691156 GCCTGTGCTCCCAGCTGCTTGGG + Intronic
1075582541 10:123633272-123633294 GGATGTGCAGCCACATGCCAGGG - Intergenic
1075749137 10:124750864-124750886 GCCTGTGGTCCCACCTACTATGG + Intronic
1077155975 11:1091017-1091039 GCATGTGCACCCATGTGGAACGG - Intergenic
1077906379 11:6538047-6538069 AGATATGCACCCTCCTGCTAAGG - Intronic
1079122852 11:17697387-17697409 GCCTGTCCAGGCACCTGCTATGG - Intergenic
1079141963 11:17817085-17817107 GCATGTTTACACAGCTGCTAGGG + Intronic
1079212907 11:18479132-18479154 GCATGTGGTCCCACCTACTCTGG - Exonic
1082809354 11:57469504-57469526 GCAAGAGCACCCATCTCCTAGGG + Intronic
1084125054 11:67093955-67093977 GGGTGTGCTCCCACCTACTAGGG + Intergenic
1085059450 11:73431215-73431237 GCCTGTGGTCCCAGCTGCTATGG + Intronic
1086203185 11:84227787-84227809 GCCTGTACACCCAGCTGCTCAGG + Intronic
1086772239 11:90780833-90780855 GCATGTGCACACATGTGATACGG - Intergenic
1088460063 11:110073588-110073610 TCATTTGCAACCTCCTGCTAAGG + Intergenic
1088914409 11:114216537-114216559 GAATGTACACCCAGCTGCTTTGG + Intronic
1089030328 11:115320185-115320207 GCATGTACTCCCAGCTGCTCGGG - Intronic
1091449572 12:564057-564079 ATATGTGCATCCACCTGCAATGG + Intergenic
1091787589 12:3252395-3252417 GCCTGTGCACACACCTGCCACGG - Intronic
1094461036 12:30696686-30696708 GCCTGTGTACCTGCCTGCTAGGG - Intergenic
1095931655 12:47632288-47632310 TCATGAGCACTCACTTGCTATGG + Intergenic
1096689487 12:53310811-53310833 GAATCTGAACCCACCTGCAAAGG - Intronic
1100698360 12:97119817-97119839 GCCTGTGGTCCCATCTGCTAGGG + Intergenic
1100845245 12:98651782-98651804 GCGTGTGCACCCAGCTCCTCAGG - Intronic
1101111578 12:101491665-101491687 GCATGTGCACCCACCTGCTAAGG + Intergenic
1102354437 12:112221074-112221096 GCCTGTGGTCCCACCTGCTTGGG - Intronic
1103346260 12:120252375-120252397 GCCTGTTGACCCTCCTGCTAAGG - Intronic
1103553053 12:121750327-121750349 TGATTCGCACCCACCTGCTAAGG + Intronic
1106841335 13:33687855-33687877 GCCTGTCCACCCTCCTCCTATGG + Intergenic
1107172110 13:37354944-37354966 GCCTGTAATCCCACCTGCTAGGG + Intergenic
1110071275 13:71182245-71182267 GCATGTTCCCCCTCCTGCAAGGG - Intergenic
1110979140 13:81873353-81873375 GCATGTGCAGTGGCCTGCTAGGG - Intergenic
1111309907 13:86471504-86471526 TCATGTGCTCCCTCCTGCAAGGG - Intergenic
1120423324 14:84315774-84315796 TCATGTCCACCCCTCTGCTAGGG - Intergenic
1120823591 14:88935275-88935297 CCATGTGCCTCCACGTGCTATGG + Intergenic
1123188490 14:106543857-106543879 GCCTGTATACCCAGCTGCTAGGG - Intergenic
1124378051 15:29141064-29141086 CCACGTGCACCCACCTGAGAAGG - Intronic
1124839648 15:33229755-33229777 CCATGTAATCCCACCTGCTAAGG + Intergenic
1131609246 15:93943870-93943892 GCCTGTGCACTAATCTGCTATGG - Intergenic
1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG + Intergenic
1135860977 16:26055710-26055732 CCATATGCACCCACATGCAATGG - Intronic
1138179643 16:54932895-54932917 CCATGTCCACCAACCTGCTTCGG - Exonic
1140038892 16:71392268-71392290 GCATGTGCTCCCAGCTACTCAGG + Intergenic
1140816524 16:78626253-78626275 GCCTGTGGTCCCACCTGCTCAGG - Intronic
1140828247 16:78727272-78727294 GCATGTAATCCCAGCTGCTAGGG + Intronic
1140944893 16:79758661-79758683 GGATGAGCACCCACCTGAGAAGG + Intergenic
1141303558 16:82839667-82839689 CCATGTGCACCTCTCTGCTAGGG + Intronic
1141934421 16:87227799-87227821 GAATGTGCACCCGAGTGCTAAGG + Intronic
1142159434 16:88549173-88549195 GCACCTGCACCCACCAGCCAGGG + Intergenic
1144085588 17:11805677-11805699 GCTTGTAATCCCACCTGCTAGGG - Intronic
1147260712 17:39208546-39208568 GCAGGTGCCCCCACCTGCCCAGG + Intergenic
1149496911 17:57124643-57124665 GCCTGTGCTCCCAGCTGCTCAGG - Intergenic
1149644161 17:58227698-58227720 TCATGTGCTCCCTCCTGCAAGGG - Intronic
1149803440 17:59591991-59592013 GCATGTGGTCCCAGCTACTAAGG - Intronic
1149843051 17:59983495-59983517 GCATGTGGTCCCAGCTACTAAGG + Intergenic
1151735910 17:75940375-75940397 GCCTGTGGTCCCAGCTGCTAGGG - Intronic
1153713034 18:7819308-7819330 GCTTGTGTATCTACCTGCTAGGG - Intronic
1153854708 18:9135259-9135281 GCCTGTGCTCCCAGCTGCTCAGG - Intergenic
1154206816 18:12344547-12344569 GCCTGTACTCCCAGCTGCTAGGG + Intronic
1154343230 18:13521917-13521939 GCATGTTCAGCCACTTGCCATGG - Intronic
1155743014 18:29313724-29313746 CCATGTGCAACCACCTACAAAGG - Intergenic
1156860344 18:41828798-41828820 GCATGTGGTCCCAGCTACTAGGG - Intergenic
1157607251 18:48933578-48933600 ACATGTGAACCCACCTGAGAGGG + Intronic
1158016208 18:52787301-52787323 GCATTTGCAATCACCTGTTAAGG + Intronic
1159123606 18:64197820-64197842 GCATGTGAACCCAGCTACTTGGG + Intergenic
1160734504 19:656223-656245 GCCTGTGGTCCCAGCTGCTAGGG + Intronic
1161835008 19:6639957-6639979 GCCTGTGGACCCAGCTACTAGGG + Intergenic
1162143260 19:8597155-8597177 GCATGGGCACCCACCACCCAGGG + Intronic
1166515239 19:43441619-43441641 GCATGTAATCCCAGCTGCTAGGG + Intergenic
925922828 2:8648555-8648577 GGATGTGGACCCCCCTGCGACGG - Intergenic
926972378 2:18479863-18479885 GTATGTGCACCCAACACCTACGG + Intergenic
927731077 2:25472369-25472391 GCATATGCAGCCACCTGCCTGGG + Intronic
931222034 2:60296770-60296792 GCATGTTCACCCCCGTGCCAGGG + Intergenic
933730436 2:85452184-85452206 GCATGTACACCCAGCTACTAGGG + Intergenic
936695328 2:114940097-114940119 GAATGTTTACCCAACTGCTAGGG - Intronic
939018224 2:136926567-136926589 GCATGTGGTCCCAGCTGCTCAGG + Intronic
941169494 2:162119385-162119407 TCAGGTGAACCCACCTGCTAAGG + Intergenic
943405113 2:187472885-187472907 GCATGTGGTCCCAGCTACTAGGG + Intronic
946451934 2:219787432-219787454 GCAGGATCACCCACCTGCCAAGG + Intergenic
947096816 2:226575913-226575935 GGATGTGCCCCCATCTGCTCAGG - Intergenic
1171984817 20:31652474-31652496 GCCTGTGATCCCAGCTGCTAAGG - Intergenic
1172626413 20:36350026-36350048 GCTGGTGCACTCACCTGCTTGGG - Intronic
1172840228 20:37898404-37898426 GCTTGTTCACCCACCTCCTAGGG + Intergenic
1173101294 20:40091331-40091353 GCATGTGCACTCTCATGCAAAGG + Intergenic
1173526751 20:43738644-43738666 GCCTGTGGTCCCACCTACTATGG + Intergenic
1173845980 20:46189089-46189111 GCAGGTGCAGCCACCTCCTGGGG + Intronic
1175171079 20:57082006-57082028 GGATGTCCACCCGCCTGCCAAGG + Intergenic
1178103770 21:29297793-29297815 GCATTTGCACCCACAGGCTGTGG - Intronic
1178163470 21:29945699-29945721 GCAGGTGCATGCATCTGCTAAGG + Intergenic
1179126963 21:38599237-38599259 GCAAGTCCAGCCACCTGCCATGG - Intronic
1180848561 22:18998090-18998112 GCATGCGCACCCACTCGCTCAGG - Intergenic
1181154388 22:20909525-20909547 GCCTGTGCTCCCAGCTGCTTGGG + Intergenic
1181160387 22:20956753-20956775 GCCTGTGCTCCCAGCTGCTTGGG + Intergenic
1181317169 22:21978288-21978310 GCATGGGCTCACACCTGCCATGG + Intronic
1182659747 22:31916973-31916995 GTGTGTCCACCAACCTGCTAGGG + Intergenic
1182916314 22:34035752-34035774 GCATGTGCACCCACCTTTGAAGG + Intergenic
949943204 3:9170738-9170760 GCATGTGCCCTCACCTCCTTGGG - Intronic
951779469 3:26346746-26346768 GCATGTGCACGCAGCTTCCAGGG + Intergenic
954365338 3:50143085-50143107 GCCTGTGGTCCCACCTGCTCGGG - Intergenic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
956537575 3:70294990-70295012 ACATGAGAACCCATCTGCTAGGG - Intergenic
958970885 3:100609164-100609186 GCATGATAACCCACCTGCTATGG - Intergenic
959658427 3:108837308-108837330 GCATATGCACTAAGCTGCTATGG - Intronic
965367463 3:167818148-167818170 GCCTGTGATCCCAGCTGCTAGGG - Intronic
969054916 4:4395633-4395655 GCTTGTGTACCCCCCTGCCAGGG + Intronic
971016798 4:22497202-22497224 GCATTTCCCCCCACCTTCTATGG - Intronic
971610247 4:28714823-28714845 GCATGTGCACCTACCTTCGAAGG + Intergenic
977284664 4:95087604-95087626 GCCTGTGGTCCCAGCTGCTAAGG + Intronic
978534684 4:109748625-109748647 GCATTTGCCCCCTCCTGCAAAGG - Intronic
979090411 4:116476954-116476976 GCCTGTGGTCCCACCTACTAAGG - Intergenic
979883436 4:125992112-125992134 GCATGTTCACCAACCTGCTCAGG + Intergenic
980566240 4:134546384-134546406 TCATGTGCTCCCTCCTGCAAGGG - Intergenic
985400415 4:189587959-189587981 GCCTGTGGTCCCACCTGCTTGGG - Intergenic
985484949 5:143248-143270 GCATGTGCTCTCACCTGGGAGGG - Exonic
985854903 5:2417113-2417135 CCATGTGCACCCTCCCCCTAGGG + Intergenic
989319816 5:40121395-40121417 TCATGTGCTCCCTCCTGCAAGGG + Intergenic
990311906 5:54548251-54548273 CCATGTGAAGCCACCTGCCAAGG + Intergenic
992475870 5:77101092-77101114 GCCTGTGGTCCCACCTGCTAGGG - Intergenic
995105666 5:108375230-108375252 GCCTGTGCACCCAGCTACTCAGG + Intronic
995652655 5:114387597-114387619 GCATGTGTTCCCAGTTGCTAAGG + Intronic
996247307 5:121280541-121280563 GCCTGTGGTCCCAGCTGCTAGGG + Intergenic
997674227 5:135700868-135700890 GCCTCTGCTCCCAGCTGCTAAGG + Intergenic
997705024 5:135942366-135942388 GCATTTGCTGCCTCCTGCTATGG + Intronic
1001784760 5:174402669-174402691 GAATGTGGACACACCTGCTTGGG + Intergenic
1002546341 5:179948105-179948127 CCAAGTTCACTCACCTGCTAAGG - Intronic
1003890027 6:10555930-10555952 GCAAGTCCAGCCGCCTGCTAGGG + Intronic
1005708588 6:28481725-28481747 GCATGAGCACCTGCCTGCCATGG + Intergenic
1006580899 6:35077363-35077385 GCATGTGGGCCCACCTCCTTTGG - Intronic
1007568119 6:42869006-42869028 GCCTGTGGTCCCAGCTGCTAGGG - Intergenic
1009871824 6:69462189-69462211 ACATGTAGTCCCACCTGCTAAGG + Intergenic
1012321673 6:97855206-97855228 GCATCTGAACCCACATGCTCTGG - Intergenic
1018563001 6:165121555-165121577 GCCTGTGGTCCCAGCTGCTAGGG + Intergenic
1022747788 7:33190242-33190264 GCCTGTGGACCCAGCTGCTCAGG - Intronic
1026794908 7:73359840-73359862 GCCTGTGCCCCCACCTACCAGGG + Intergenic
1032526417 7:132581347-132581369 TGATTTGCACCCACATGCTAGGG - Intronic
1037502761 8:19501123-19501145 GCCTGTAGTCCCACCTGCTAAGG + Intronic
1044943284 8:97365391-97365413 GCATGCACAACCACCTGCCATGG - Intergenic
1049018759 8:139939685-139939707 GCAAGTGCTCCCACCTTCTGTGG + Intronic
1052134921 9:24897863-24897885 GCCTGTGTACCTGCCTGCTAGGG - Intergenic
1056593354 9:87983614-87983636 GCCTGTACTCCCACCTACTAGGG + Intergenic
1056667315 9:88590967-88590989 TCATGTGCTCCCTCCTGCGAGGG + Intergenic
1057301082 9:93882928-93882950 GCCTGTGGACCCAGCTACTAAGG + Intergenic
1061647152 9:132013150-132013172 GCCTTTGCACTCACCTACTAGGG + Intronic
1062730927 9:138108210-138108232 GCCTGTGCTCCCAGCTGCTTGGG + Intronic
1188807160 X:34605415-34605437 GCATGTTCACCCTCCTGTAAGGG + Intergenic
1188893957 X:35643655-35643677 TCATGTGCTCCCTCCTGCAAGGG + Intergenic
1189435818 X:40991630-40991652 GCCTGTGAACCCAGCTGCTCTGG + Intergenic
1189676634 X:43467700-43467722 TCATGTGCTCCCTCCTGCAAGGG - Intergenic
1190528919 X:51355250-51355272 GCATGTGCAACCAGATGCCAAGG + Intergenic
1192164991 X:68822639-68822661 GCCTGAGCACCCACCTCCTCTGG - Intergenic
1192523961 X:71825418-71825440 GCCTATGCACACACCTGCTTGGG + Intergenic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1196375981 X:115032989-115033011 TCATGGGCACTCACCTGCTCAGG - Intergenic
1198167933 X:134075629-134075651 GCCTGTACTCCCACCTACTAGGG + Intergenic
1199399138 X:147376594-147376616 GCAAGTGCAGGTACCTGCTAAGG + Intergenic
1200404633 Y:2797335-2797357 GCCTGTGAACCCAGCTGCTTGGG - Intergenic
1201381458 Y:13384536-13384558 GCCTGTGCTCCCACCTACTCTGG + Intronic