ID: 1101111578

View in Genome Browser
Species Human (GRCh38)
Location 12:101491665-101491687
Sequence GCATGTGCACCCACCTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101111573_1101111578 11 Left 1101111573 12:101491631-101491653 CCTATTACAAACAGGGTCATTCT 0: 1
1: 0
2: 1
3: 6
4: 534
Right 1101111578 12:101491665-101491687 GCATGTGCACCCACCTGCTAAGG 0: 1
1: 0
2: 0
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101111578 Original CRISPR GCATGTGCACCCACCTGCTA AGG Intergenic