ID: 1101116563

View in Genome Browser
Species Human (GRCh38)
Location 12:101537669-101537691
Sequence TTGGTTGGATAACTGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101116563_1101116573 22 Left 1101116563 12:101537669-101537691 CCCTTCTCCAGTTATCCAACCAA No data
Right 1101116573 12:101537714-101537736 TTCTGTCTTGACGTTTGGGAGGG No data
1101116563_1101116571 18 Left 1101116563 12:101537669-101537691 CCCTTCTCCAGTTATCCAACCAA No data
Right 1101116571 12:101537710-101537732 GGATTTCTGTCTTGACGTTTGGG No data
1101116563_1101116568 -3 Left 1101116563 12:101537669-101537691 CCCTTCTCCAGTTATCCAACCAA No data
Right 1101116568 12:101537689-101537711 CAATTCTGAGCCTCTGTCTCAGG No data
1101116563_1101116570 17 Left 1101116563 12:101537669-101537691 CCCTTCTCCAGTTATCCAACCAA No data
Right 1101116570 12:101537709-101537731 AGGATTTCTGTCTTGACGTTTGG No data
1101116563_1101116572 21 Left 1101116563 12:101537669-101537691 CCCTTCTCCAGTTATCCAACCAA No data
Right 1101116572 12:101537713-101537735 TTTCTGTCTTGACGTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101116563 Original CRISPR TTGGTTGGATAACTGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr