ID: 1101119248

View in Genome Browser
Species Human (GRCh38)
Location 12:101562115-101562137
Sequence GTTTTTCAGGTGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101119248_1101119253 17 Left 1101119248 12:101562115-101562137 CCCTCCAGCCTCACCTGAAAAAC No data
Right 1101119253 12:101562155-101562177 TCTCTCCTTCCCACAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101119248 Original CRISPR GTTTTTCAGGTGAGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr