ID: 1101119253

View in Genome Browser
Species Human (GRCh38)
Location 12:101562155-101562177
Sequence TCTCTCCTTCCCACAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101119246_1101119253 26 Left 1101119246 12:101562106-101562128 CCTCCACATCCCTCCAGCCTCAC No data
Right 1101119253 12:101562155-101562177 TCTCTCCTTCCCACAGAATGTGG No data
1101119250_1101119253 13 Left 1101119250 12:101562119-101562141 CCAGCCTCACCTGAAAAACTTGC No data
Right 1101119253 12:101562155-101562177 TCTCTCCTTCCCACAGAATGTGG No data
1101119251_1101119253 9 Left 1101119251 12:101562123-101562145 CCTCACCTGAAAAACTTGCTTGA No data
Right 1101119253 12:101562155-101562177 TCTCTCCTTCCCACAGAATGTGG No data
1101119252_1101119253 4 Left 1101119252 12:101562128-101562150 CCTGAAAAACTTGCTTGATCATT No data
Right 1101119253 12:101562155-101562177 TCTCTCCTTCCCACAGAATGTGG No data
1101119247_1101119253 23 Left 1101119247 12:101562109-101562131 CCACATCCCTCCAGCCTCACCTG No data
Right 1101119253 12:101562155-101562177 TCTCTCCTTCCCACAGAATGTGG No data
1101119248_1101119253 17 Left 1101119248 12:101562115-101562137 CCCTCCAGCCTCACCTGAAAAAC No data
Right 1101119253 12:101562155-101562177 TCTCTCCTTCCCACAGAATGTGG No data
1101119249_1101119253 16 Left 1101119249 12:101562116-101562138 CCTCCAGCCTCACCTGAAAAACT No data
Right 1101119253 12:101562155-101562177 TCTCTCCTTCCCACAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101119253 Original CRISPR TCTCTCCTTCCCACAGAATG TGG Intergenic
No off target data available for this crispr