ID: 1101122496

View in Genome Browser
Species Human (GRCh38)
Location 12:101597545-101597567
Sequence TCTTCTAAGGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 488}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101122488_1101122496 26 Left 1101122488 12:101597496-101597518 CCGTGGCCTAATTCTGGGAGTTT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 43
4: 488
1101122487_1101122496 30 Left 1101122487 12:101597492-101597514 CCTACCGTGGCCTAATTCTGGGA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 43
4: 488
1101122489_1101122496 20 Left 1101122489 12:101597502-101597524 CCTAATTCTGGGAGTTTTCTTCT 0: 1
1: 0
2: 5
3: 36
4: 409
Right 1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG 0: 1
1: 0
2: 4
3: 43
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101122496 Original CRISPR TCTTCTAAGGAGAAGGAGGA AGG Intronic
901352682 1:8611675-8611697 TCTTCTAGTGAGGAAGAGGATGG + Intronic
902776218 1:18676554-18676576 TCCTCTTAGGAGAAGGGGGTGGG - Intronic
902990559 1:20184774-20184796 TCTTCTAAGAGGGAGGAGGGAGG + Intergenic
903004497 1:20289746-20289768 TCTTGTGTGGAGAAGGAGGTAGG + Intergenic
904310017 1:29622815-29622837 ACTTCTTTGGAGGAGGAGGAGGG + Intergenic
904483435 1:30808069-30808091 TCTTCTCAGGAGGTGGGGGAGGG + Intergenic
904552259 1:31328824-31328846 ACTTCTAGGAAGAAAGAGGAGGG - Intronic
904942951 1:34177576-34177598 TCTTCTAAGGGAGAGGGGGAGGG + Intronic
906456712 1:46003578-46003600 TCTACTTAGGAGAATGAGGTGGG - Intronic
906837572 1:49100444-49100466 TCTTCAAAGGAGAATCTGGATGG + Intronic
907157409 1:52347108-52347130 TTTTTTATGGAGAAGGAGAAAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907588944 1:55647316-55647338 GCTTATAGTGAGAAGGAGGAAGG - Intergenic
908074191 1:60496179-60496201 CCTTCTAAGGAGAAACAGGAAGG - Intergenic
908447018 1:64208752-64208774 GCTTCTAAACAGAACGAGGAAGG + Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
908774521 1:67627308-67627330 TCTCAGCAGGAGAAGGAGGATGG + Intergenic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
908994883 1:70139658-70139680 TGCTCTAAGGAGATGTAGGAAGG - Intronic
909286369 1:73824935-73824957 TATTCTAAGGAGAGGAAGTATGG - Intergenic
909976416 1:82050822-82050844 GCTTCTAAGGATGAGGAGGAAGG + Intergenic
910874959 1:91869753-91869775 TCCTCAAAGGAAAAGGAGGCAGG + Intronic
911257380 1:95647725-95647747 CCTTCTAAGGTGAAGGATAAGGG - Intergenic
911639362 1:100270538-100270560 ACTCCTAAGGAGAAGGCAGAAGG - Exonic
912272363 1:108224166-108224188 TCTTCTAGGGAGGAGCGGGAGGG + Intronic
912295858 1:108470155-108470177 TCTTCTAGGGAGGAGCGGGAGGG - Intronic
912455833 1:109796507-109796529 TCTTTTAAGTATAAGGATGATGG - Intergenic
913004567 1:114616278-114616300 GCTTCTCAGGAGAAAGAGGCAGG + Intronic
913575944 1:120175174-120175196 ACTGCTAAGGAGAAGGAAGAGGG - Intronic
914143555 1:144973416-144973438 TCTTCTAAAGAAGAGAAGGAGGG + Intronic
914558258 1:148790745-148790767 ACTGCTAAGGAGAAGGAAGAGGG - Intergenic
914614577 1:149339485-149339507 ACTGCTAAGGAGAAGGAAGAGGG + Intergenic
914938748 1:152003640-152003662 TGATCAAAGGAGAAGGAGGCTGG - Intergenic
915326323 1:155082817-155082839 ACTGCTAGGGAGAAGGAGGGAGG + Intronic
915552180 1:156641758-156641780 TGTTCAAAGAAGAAGGAGGAGGG - Intronic
916652337 1:166843840-166843862 TCTTCTGAGGAAAGGGAGGAGGG + Intronic
917206591 1:172580213-172580235 TCTTCTATGGAGGGGGAAGAAGG - Intronic
917289119 1:173454086-173454108 TCTTCCAAGGAGAAGGAATGTGG - Intergenic
918412340 1:184272857-184272879 TCTTCTGAAGAGAAGAAGTAAGG - Intergenic
919604137 1:199659884-199659906 TCATCTAGGGAGAAGGAGACTGG + Intergenic
920481334 1:206325030-206325052 TCTTCTAAAGAAGAGAAGGAGGG - Intronic
921544573 1:216459297-216459319 TTTTCCAAAGAAAAGGAGGAAGG - Intergenic
922054049 1:222023336-222023358 TCTTCCAAGCAGAAGGGCGATGG + Intergenic
922350823 1:224733527-224733549 TCTCTGAAGGGGAAGGAGGAGGG + Intronic
922866063 1:228862653-228862675 TCTTCTTAGAAAAAGGAGGAGGG - Intergenic
923997557 1:239512464-239512486 TCATCAAAGGAGAAGGAGATGGG - Intronic
924947610 1:248856792-248856814 ACTTTTAAGAAGGAGGAGGAGGG + Intronic
1063267323 10:4467969-4467991 TGTGCTATGGAGAAGGAGGTAGG - Intergenic
1064540617 10:16401878-16401900 GCTTCTCAGGAGATGGAGGCAGG - Intergenic
1064602214 10:17005522-17005544 TTTTCTAAGTAGAAGCAGCAAGG - Intronic
1064924442 10:20554739-20554761 TCTGAGAAGGAGAAGGATGAAGG - Intergenic
1065245053 10:23748240-23748262 TCTACTAAAGAGGAGGATGAAGG - Intronic
1065863207 10:29889221-29889243 TCTTCTAAGGAAAAGAACAATGG + Intergenic
1067732246 10:48820682-48820704 TGTTCTCAGGAGAAGCAGGGAGG + Intronic
1070226518 10:74513869-74513891 TGTACAAAGGAGAAGGAGAAAGG - Intronic
1070613408 10:77950128-77950150 TCTGCTAAGGGGAAGGGAGAGGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1071827890 10:89343387-89343409 TCTTCAAATGAGAAGGGAGAAGG + Intronic
1071954168 10:90739383-90739405 TGTTTTAATGAGAAGGAGGGAGG - Intergenic
1072303020 10:94080092-94080114 TCATCAAAGGTGAAGGACGATGG - Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1074947625 10:118296565-118296587 TCCTCTGAGGAGAAGGAGGCAGG - Intergenic
1075069631 10:119312366-119312388 TCTCCCAAGGAGCAGGAGGAGGG + Intronic
1075660769 10:124194022-124194044 TCTTTTGAGCAGAAGGAAGAAGG + Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076724683 10:132407841-132407863 TCTTCTGAGGGGTAGGAGGAGGG + Intronic
1077823059 11:5770264-5770286 TATTCTAAGGAACAAGAGGAGGG - Intronic
1078727559 11:13945219-13945241 TGTGCTAAGGAGGAGGGGGAGGG + Intergenic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1079056296 11:17208867-17208889 TCTTTTAAGCAGTAGGAGAAGGG + Intronic
1079963030 11:26947357-26947379 TCTTGGTAGGAGAAGGAGGTGGG + Intergenic
1080908035 11:36566505-36566527 GATTTTAAGGAGCAGGAGGATGG + Intronic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1083209007 11:61171029-61171051 GATTCTATGGAGTAGGAGGAAGG - Intergenic
1084072432 11:66745012-66745034 TCGCCTAAGGTGAAGGAGGAAGG + Intronic
1084404287 11:68962038-68962060 CCTTATAAGGGGAAGCAGGAGGG + Intergenic
1085024046 11:73226313-73226335 TTTTCTAAGGAGGAGGAGACAGG + Intronic
1086260182 11:84930552-84930574 TCTACTAAGTGGAATGAGGATGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086513237 11:87583565-87583587 TGTGCAAGGGAGAAGGAGGAAGG - Intergenic
1086604040 11:88673308-88673330 TATTCTATGGAGTATGAGGAAGG + Intronic
1086989853 11:93291053-93291075 TTCTCTAATGAGACGGAGGATGG - Intergenic
1087323812 11:96697022-96697044 TGTTCTAAGAAAAAGGAGGTGGG + Intergenic
1087370647 11:97279642-97279664 TCTCCTAAGCATAAGGAAGAAGG - Intergenic
1088117118 11:106325094-106325116 TCTGCTCAGTAAAAGGAGGATGG - Intergenic
1088547397 11:110973695-110973717 TCTTCTTAGCAGCAGCAGGAAGG - Intergenic
1088764304 11:112961711-112961733 TCCTCCTAGGAGTAGGAGGAAGG - Intronic
1089100093 11:115955720-115955742 TTTCTTAGGGAGAAGGAGGAGGG - Intergenic
1089275060 11:117329206-117329228 TCTACTAAGGAGACTGAGGTGGG - Intronic
1090901403 11:131035223-131035245 TCTTTGAATGAGAAGAAGGATGG + Intergenic
1091225180 11:133952896-133952918 TCTTCTAGGAAGCAGGTGGAAGG + Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1091523379 12:1270864-1270886 AATTCTAAGGAGAAGTAGAATGG + Intronic
1091885276 12:4012669-4012691 CCTTCTAAGGTTAAGGAGGAAGG - Intergenic
1095976929 12:47946424-47946446 TCTCCCAAGGTGAAGGTGGAGGG + Intergenic
1095985308 12:47995403-47995425 TCTTCTATGAAGAAGAAAGATGG + Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096606651 12:52771308-52771330 ATTTCTAAGGAAAGGGAGGAAGG - Intronic
1097131774 12:56816529-56816551 TCTTCCTAGGAGGAGGAAGAAGG + Intergenic
1097419988 12:59364927-59364949 TCTTCTAGGGAGAATGAAGGGGG + Intergenic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1098269748 12:68758306-68758328 GCTACTCAGGAGAATGAGGAAGG + Intronic
1098362718 12:69670577-69670599 TCCTGAAAGTAGAAGGAGGAGGG + Intronic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1099954994 12:89344905-89344927 TTCTCTGCGGAGAAGGAGGATGG + Intergenic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101123643 12:101609058-101609080 TCTGAAAAGGAGAAGGAGAAGGG + Intronic
1101228990 12:102720590-102720612 ACCTCTAAAGAGAAGGAGGGCGG - Intergenic
1101637406 12:106556133-106556155 TCTTCTAAAGAAAAAAAGGAAGG - Intronic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1102419797 12:112794562-112794584 TCTTCTCAGGAGTAGCAGCAAGG + Intronic
1103132279 12:118479658-118479680 TGTTCTTAGGAGAAGAAGGAGGG + Intergenic
1103133873 12:118491073-118491095 TCTTGGAAGGAGCTGGAGGAGGG + Intergenic
1103326786 12:120126832-120126854 CCTTCTAAGAATCAGGAGGAAGG + Intergenic
1104228427 12:126859858-126859880 TCTTCTAAGACGAGGGAGGCAGG - Intergenic
1104508195 12:129352372-129352394 TCTTGAAAGTAAAAGGAGGAAGG - Intronic
1105561433 13:21495832-21495854 TCTCCTAAAAAGAAGGAAGAAGG - Intronic
1105705289 13:22964512-22964534 CCTTCTCAGGAGAAGGCTGAAGG - Intergenic
1107055048 13:36093998-36094020 TCTACTAAGGAGGATGAGGCAGG - Intronic
1107670440 13:42741037-42741059 TCTTCTTAATAGAAGGAGCAAGG - Intergenic
1108325543 13:49327238-49327260 TCATCTCAGGAGAAGAAGTAGGG - Intronic
1108454528 13:50599575-50599597 TCTGCAAGAGAGAAGGAGGAAGG - Intronic
1108912389 13:55571946-55571968 TCTTCTAATGAAAAGATGGATGG + Intergenic
1110459121 13:75724671-75724693 TCTTCTAAGGAGAAAAACAATGG - Intronic
1110802929 13:79721304-79721326 TCTTATAAGGGGAAGGCAGAAGG + Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG + Intergenic
1112036736 13:95503817-95503839 GCTGCTAGGGAGAAGGGGGAGGG + Intronic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1112988569 13:105482370-105482392 ACTTCTAAGTAGCATGAGGAAGG + Intronic
1113680834 13:112243753-112243775 ACTTCTGTGGAGAAGGAGCAGGG + Intergenic
1114177230 14:20333352-20333374 CCTTTTAAGGTAAAGGAGGAGGG - Intergenic
1115506999 14:34102255-34102277 TCTTCTAAGAAGAAAGAAAATGG + Intronic
1115959366 14:38818016-38818038 TCTTCTAAGGAGATTGAAGGAGG - Intergenic
1116478318 14:45367030-45367052 TCTTCAAGGGAGAAGGGAGAAGG - Intergenic
1118076933 14:62309544-62309566 TTTGCTAAGGGGAAGGAGGGGGG + Intergenic
1118331948 14:64822048-64822070 TCTTCTTAGGAGGTGGAAGACGG + Intronic
1118509283 14:66452990-66453012 TCTTCTGAGAAGTGGGAGGAGGG - Intergenic
1118662715 14:68031928-68031950 CCTTCTAAGGTGAATGTGGATGG - Intronic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119171077 14:72536875-72536897 AGTTCTAAGGAGGAGGAGGAAGG - Intronic
1119540498 14:75435118-75435140 TCCTCTAAGGAGAACAGGGAAGG - Intronic
1120108348 14:80522543-80522565 TCTTTCAAGGGGAAGAAGGATGG + Intronic
1120242663 14:81967208-81967230 TCTTCAAGGGAGAAGGATGAGGG - Intergenic
1120301232 14:82710052-82710074 TCTTCTGCGGTGAAGGTGGAGGG - Intergenic
1120370942 14:83634730-83634752 TCTTCTGAGGAGGATGAAGAAGG + Intergenic
1120403191 14:84059263-84059285 TCATCTGATGAGAAGGAGGAAGG - Intergenic
1123474697 15:20581652-20581674 TCTTCAAAGGAGGAGCAGGGCGG - Intergenic
1123576780 15:21677517-21677539 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1123613402 15:22119985-22120007 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1123643314 15:22418705-22418727 TCTTCAAAGGAGGAGCAGGGCGG + Intergenic
1124373606 15:29116929-29116951 TCTCCTAGAGTGAAGGAGGAAGG - Intronic
1124469459 15:29969708-29969730 GCTTCTCAGGAGAATGAGGGGGG + Intergenic
1124609425 15:31198161-31198183 TCTACGAGGGAGGAGGAGGAGGG - Intergenic
1125069294 15:35532745-35532767 TTTTTTAAAGAGGAGGAGGAAGG + Intronic
1125105443 15:35965524-35965546 TGTTCTAAGGAAATGGAGAAAGG - Intergenic
1125233197 15:37481981-37482003 TCTTCTAAGAATATGGTGGAGGG + Intergenic
1125286263 15:38095852-38095874 GATTCAAGGGAGAAGGAGGAAGG - Intergenic
1125334405 15:38613443-38613465 TCTTGAGAGGAGAGGGAGGAGGG + Intergenic
1125646703 15:41278664-41278686 GCATCAAAGGAAAAGGAGGATGG + Intronic
1126112943 15:45186415-45186437 TCTGCTGAGGAGAAGGGGGCAGG + Intronic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1127907138 15:63384251-63384273 TCTTTAAAGGAGAAGGGAGAGGG - Intergenic
1128004154 15:64222386-64222408 TCTTCTAAGGAGAAAAAAAACGG - Intronic
1128095838 15:64954778-64954800 ACAACTAAGGAGAAGGAAGAAGG - Intronic
1128184664 15:65634444-65634466 TGTTGTAAGGAGAAGAAGGTGGG + Intronic
1128573859 15:68756146-68756168 TATGCTAAGGTGAAGGAGGAAGG + Intergenic
1128704827 15:69831376-69831398 TCTTCCAGGGAGAAGGCAGAGGG - Intergenic
1129897487 15:79119182-79119204 GCTTCAAAGGAGAAGCACGAGGG - Intergenic
1131092468 15:89632993-89633015 TCTTCTAAGGAAAAGTAGGGAGG + Exonic
1131387072 15:92016772-92016794 TCATAAAAGGAGGAGGAGGAGGG + Intronic
1132102450 15:99034216-99034238 GCTTCTCAGGAGACTGAGGAAGG - Intergenic
1202985648 15_KI270727v1_random:411762-411784 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1132906898 16:2287091-2287113 TCTCCTTAGGAGAAGGGTGATGG - Intronic
1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG + Exonic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1134331086 16:13251702-13251724 TATCCTAAAGAAAAGGAGGAGGG - Intergenic
1135092368 16:19528787-19528809 TCTTCAAAGGCTAAGGCGGAAGG + Intronic
1135155119 16:20046186-20046208 TCTTCATAGGAGAATGAGGCAGG - Intronic
1135191978 16:20361864-20361886 TCTTCTAAGGAGCAGGAACCTGG + Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137468101 16:48729591-48729613 TCTTTTAGGAAGAAGAAGGAGGG + Intergenic
1137715114 16:50593903-50593925 TGTTCCCAGAAGAAGGAGGAAGG + Intronic
1137833307 16:51565612-51565634 TCTTCTAAGGAGATAGAGCTAGG - Intergenic
1139197783 16:64940993-64941015 TCTTCAAAGGAGAAGCCGAAAGG + Intergenic
1139337468 16:66243089-66243111 TCCTCTAAGAAGCTGGAGGATGG + Intergenic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1140692307 16:77496338-77496360 TCTACTCAGGAGCAGGAAGAAGG + Intergenic
1140825084 16:78698727-78698749 TCTACTAAGGAGACTGAGGCAGG + Intronic
1142106895 16:88309183-88309205 ACCTCTCAGGGGAAGGAGGAAGG + Intergenic
1142667866 17:1472788-1472810 GCTTTAAAGGATAAGGAGGAGGG + Intronic
1143353076 17:6303564-6303586 TCTTCTATGGATATGGAGGTGGG + Intergenic
1143659887 17:8318368-8318390 TATTCTGGGGACAAGGAGGAAGG - Exonic
1143749733 17:9020092-9020114 TCTTCCAAGGAGACGGAGCTGGG + Intergenic
1144161364 17:12563002-12563024 TCCTAGAAGGAGAAGGAGTATGG - Intergenic
1144315525 17:14057281-14057303 TCATCTAGGGAGAAAGAAGAAGG - Intergenic
1147369010 17:39978894-39978916 GCTACTCAGGAGAAGGAGGCAGG + Intergenic
1147758728 17:42784188-42784210 TCTTCTGAGGTGGGGGAGGAAGG - Intronic
1150118919 17:62582794-62582816 GGTTCCAAGGACAAGGAGGAGGG - Intronic
1150808473 17:68337502-68337524 TCCTGGAAGGCGAAGGAGGAAGG + Intronic
1150884029 17:69064407-69064429 TCCTATAAGGAGCAGGAAGATGG - Intergenic
1151042734 17:70882640-70882662 TCTTCCAAGAGGGAGGAGGAGGG + Intergenic
1151458697 17:74241979-74242001 TGTTCTCTGGAGAAGCAGGAGGG + Intronic
1152449945 17:80372335-80372357 TATTTTAAGGACAAGAAGGAGGG - Intronic
1152509784 17:80778685-80778707 GCTTCTCGGGAGAAGGAGGCAGG + Intronic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1153153888 18:2127363-2127385 TCTGCTAAAAGGAAGGAGGAAGG - Intergenic
1153322620 18:3788130-3788152 TCTTCTTAGGGAAAAGAGGATGG - Intronic
1153333315 18:3896853-3896875 TCTTCAAGGGAGAAGGGGGAAGG - Intronic
1153810951 18:8751003-8751025 TGCTCCAAGGAGGAGGAGGATGG + Intronic
1153960503 18:10136099-10136121 GCTTCAAAGGGAAAGGAGGATGG + Intergenic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1156409238 18:36811892-36811914 TCTGCCAAGGAGAAAAAGGAAGG - Intronic
1156574482 18:38298778-38298800 TCATCTTAGGAGATGGAGCAAGG - Intergenic
1156864628 18:41874998-41875020 TCTTTTAAGGAAAAATAGGAAGG - Intergenic
1157015955 18:43713052-43713074 TCTTCAAGGAAGAAGGAAGAAGG + Intergenic
1157600096 18:48888441-48888463 GCTTCTCAGGAGAAGGGGGGCGG - Intergenic
1157871619 18:51234839-51234861 TCTTTCAGGGAGAAGGAGGGAGG - Intergenic
1159400271 18:67923325-67923347 TCTTCTAATGACAAGGGGGGAGG + Intergenic
1159492746 18:69159567-69159589 TGTTTTTAGGGGAAGGAGGAGGG - Intergenic
1159623579 18:70667453-70667475 TCTTTTAACAATAAGGAGGAAGG - Intergenic
1160841499 19:1148697-1148719 TTTTCTGGGGTGAAGGAGGATGG - Intronic
1161889003 19:7020086-7020108 TCCTCTGAGGAGGATGAGGAGGG - Intergenic
1161890363 19:7031930-7031952 TCCTCTGAGGAGGATGAGGAGGG + Intronic
1161891085 19:7038803-7038825 TCCTCTGAGGAGGATGAGGAGGG - Intronic
1161892451 19:7050663-7050685 TCCTCTGAGGAGGATGAGGAGGG + Intronic
1161893170 19:7057264-7057286 TCCTCTGAGGAGGATGAGGAGGG - Intronic
1163481884 19:17561433-17561455 ACTTCCAAGAAGCAGGAGGAAGG + Intronic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164801332 19:31079281-31079303 TCTTAGCAGGAGAAAGAGGAAGG + Intergenic
1165069709 19:33248319-33248341 TCTTCCTAGGAGCAGGAGCAAGG - Intergenic
1165320801 19:35084059-35084081 TGTTCTAGGGAGAAGGAACAAGG + Intergenic
1166920413 19:46225411-46225433 TGTTCTGAGGAGAAGGAAGGAGG - Intergenic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
1202682532 1_KI270712v1_random:20548-20570 ACCTGCAAGGAGAAGGAGGACGG - Intergenic
925120154 2:1411985-1412007 TCTTCTTGGGAGAATGTGGATGG - Intronic
925751856 2:7096330-7096352 TCCTCCAAGGAGAAGGAGGGAGG + Intergenic
926434144 2:12821509-12821531 TGATGTAAGAAGAAGGAGGAAGG - Intergenic
927393845 2:22626913-22626935 TCCTCTAAGTAGAAAGATGAGGG + Intergenic
927432838 2:23041591-23041613 GCTCCTAAGGACAAGGAGCAGGG + Intergenic
927518782 2:23687166-23687188 TCTTGTAAGGGGAGGGAGTAGGG + Intronic
927745338 2:25614740-25614762 TCCTCTAAGGAGATGGAGGCGGG + Intronic
929527172 2:42715514-42715536 GCTACTCAGGAGGAGGAGGAGGG - Intronic
930495079 2:52131202-52131224 TCCTATGAAGAGAAGGAGGAAGG - Intergenic
930855613 2:56014119-56014141 ACTTCTAAGGAGAAGAACTAGGG - Intergenic
931321910 2:61180328-61180350 TGTTCTGAGGCGAAGGGGGAAGG - Intronic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
932953223 2:76318072-76318094 TCATCTAAGGTGAGGGTGGAAGG + Intergenic
933587999 2:84200802-84200824 TGTTCTAAGGAGAAAGAGATAGG + Intergenic
934576916 2:95408140-95408162 TCTTCTAAGAATAAGGACAATGG + Intronic
934655569 2:96115374-96115396 TCCACTGGGGAGAAGGAGGAGGG - Exonic
935109612 2:100080549-100080571 TCTTCTAAAGGGAGGGAGGGAGG + Intronic
935497875 2:103804058-103804080 TCTTCAAACCAGAAGGTGGATGG - Intergenic
935559840 2:104548611-104548633 TCACCTAAGGAGAAGGAGGAAGG - Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
937122484 2:119450586-119450608 TGCTCAAAGAAGAAGGAGGAAGG + Intronic
937393404 2:121513439-121513461 TTTTTTAAAGAGAAGAAGGAGGG + Intronic
937446420 2:121962564-121962586 TCATCCAGGAAGAAGGAGGAAGG + Intergenic
937821223 2:126313288-126313310 ACTTCCAAGGAGAAAGATGACGG - Intergenic
938942135 2:136178630-136178652 TCTTCAAGGGAGAAGGGAGAGGG + Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940642579 2:156361884-156361906 TCGGCTAAGGTGAAGGAGGGTGG - Intergenic
940725024 2:157327280-157327302 TCTTCCAAGGACAAGGGAGAGGG - Intronic
940843172 2:158608580-158608602 TCCTTTGAGGGGAAGGAGGAAGG + Intronic
940972327 2:159907157-159907179 TGTTTTGAGGAGGAGGAGGAAGG + Intergenic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
942523136 2:176825656-176825678 TCTTGCATGGGGAAGGAGGAAGG - Intergenic
942548077 2:177085373-177085395 TATTCTAAGTACAAGGAGTAGGG + Intergenic
944128332 2:196318845-196318867 TCTTCTCAGGAGGAGGAAGACGG - Exonic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944353410 2:198757076-198757098 TCTTCTAAAGAAAAGAAGAAAGG - Intergenic
945689603 2:213016955-213016977 TGTTATCAAGAGAAGGAGGAAGG + Intronic
945699607 2:213152900-213152922 TCTTCAAAGGAGTAAGAGTACGG - Intergenic
945805290 2:214482986-214483008 TGGTCAAAGGAGAGGGAGGAAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946525750 2:220518153-220518175 TGTTCTAAGGGGAAGGAAGATGG - Intergenic
947585515 2:231353896-231353918 TCTTTTCAGGAGAGGGAGGTAGG + Intronic
948056527 2:235012813-235012835 TGGTCCAAGGAGCAGGAGGAAGG + Intronic
948263095 2:236618703-236618725 TGTCCTATGGAGACGGAGGAAGG - Intergenic
948888591 2:240896275-240896297 TCTTCTGAAGGGAGGGAGGAGGG - Intronic
1168776541 20:452811-452833 TAGTCTGAGGAAAAGGAGGAAGG + Intronic
1169552827 20:6718766-6718788 TCTTCGGAGGAGAACCAGGAAGG - Intergenic
1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG + Intergenic
1170364049 20:15580796-15580818 TCTTCTTAGGGGAAAGGGGAGGG + Intronic
1170586370 20:17737324-17737346 TTTTCTAGGGAGTAGGAGTAGGG - Intergenic
1170975988 20:21165276-21165298 GCTTTGAAGGAGAAAGAGGAGGG + Intronic
1171970517 20:31562158-31562180 TCTACTAGGGAGTAGGGGGAGGG - Intronic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172354670 20:34271236-34271258 TCTGAAAAGGAGAAGGAGGTGGG - Intergenic
1172941081 20:38655185-38655207 TCTTCTGAGAGGAAGGAGGATGG + Intergenic
1173407963 20:42783693-42783715 TGTTCTGAGGAGAGGGAGAATGG + Intronic
1174036054 20:47668915-47668937 TGTTCTGAGGAGGAGGAAGATGG - Intronic
1175010970 20:55735632-55735654 TGATCTCAGGAGAAAGAGGAAGG - Intergenic
1175095236 20:56535755-56535777 TCTTTCAAGTAGAAGGAGAAAGG + Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176053423 20:63132760-63132782 TCTGCTGAGGAAAAGGTGGACGG + Intergenic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176728532 21:10465763-10465785 TTTTCTAGGGAGGAGGTGGAGGG + Intergenic
1178423059 21:32457403-32457425 TCTTTTCAGGAGAAAGAGCAGGG + Intronic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178792960 21:35717134-35717156 TTTGCAAAGGAGAAGGATGATGG - Intronic
1179110253 21:38439957-38439979 TATTCTAGGCAGAAGGAGGTGGG + Intronic
1179460314 21:41530170-41530192 ATTTCTCAGGAGAAGGAGGTGGG - Intronic
1179718366 21:43301710-43301732 TCCTCCCAGGAGAAGGATGAAGG - Intergenic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1182554253 22:31120450-31120472 TCTTGTCAGGAGAAGGGGGTAGG - Intergenic
1183998012 22:41650606-41650628 TCTTCTAAGGAGCAGGAAGATGG - Intronic
1184166447 22:42731689-42731711 TCTACTCAGGAGAATGAGGCAGG - Intergenic
1184678699 22:46057839-46057861 TCTTCCAAGGAGAAGGAGTGTGG + Intronic
1185339811 22:50286250-50286272 TCGTCTAAGGAGGAGCTGGATGG + Exonic
949099466 3:126663-126685 TCATCAAAGGAGACTGAGGAAGG + Intergenic
949245689 3:1923509-1923531 TCTTCTTAGGAAAAGGCTGAAGG - Intergenic
949257379 3:2064748-2064770 TCTTCTAAGGAAAATCAGGCTGG + Intergenic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
950167627 3:10813820-10813842 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950167643 3:10813909-10813931 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950320426 3:12047380-12047402 TCATCTACTGAGAAGAAGGAAGG + Intronic
950439908 3:13004533-13004555 TAATCCAAGGAGAGGGAGGAGGG - Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
953450984 3:43005976-43005998 TCTTCCAAGGATAAGGGGTAGGG + Intronic
953551036 3:43903237-43903259 TCTTTTTAAGAGAAGGAAGAAGG + Intergenic
954646477 3:52134833-52134855 TGTCCTATGGATAAGGAGGATGG - Intronic
954657365 3:52203427-52203449 TCTTCTCAGGAGGTTGAGGAGGG + Intronic
954800996 3:53186779-53186801 TTTTCTAGGGAGAGGGAAGAAGG - Intronic
955882744 3:63565200-63565222 TGTCCTATGGAGAGGGAGGAGGG + Intronic
956041459 3:65149483-65149505 TCATCTGAGGACATGGAGGAAGG - Intergenic
956302736 3:67790247-67790269 AATTCTCAGGAGAAGGAGCAGGG - Intergenic
956690720 3:71875616-71875638 CCTGCTAAGGGGAGGGAGGAGGG + Intergenic
957287076 3:78230761-78230783 GCTTCAGAGGAGAAGGAGGATGG + Intergenic
958427853 3:94000034-94000056 GCTCCTAAAGAAAAGGAGGATGG - Intronic
959473041 3:106776112-106776134 TGTTCTAAGGAAAGGGAGGTGGG + Intergenic
959837148 3:110932769-110932791 TCTTCTCAGGAGAAGGGACATGG - Intergenic
960650778 3:119946666-119946688 TCTTCTGAAGAGAAAGAGGTTGG + Intronic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
961473763 3:127134576-127134598 TCTTCTCAGGGGAAGGCGGCCGG + Intergenic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
962092162 3:132255775-132255797 TCTTATAAGGAGAGGAAAGATGG + Intronic
962301739 3:134250127-134250149 TCTTCTAGGGAGAAGGGCTAAGG + Intronic
962681115 3:137801426-137801448 TCTGCCAAGGAGACAGAGGAGGG + Intergenic
962797343 3:138860894-138860916 TCTTCAAAGAACAAAGAGGAAGG + Intergenic
963130004 3:141849214-141849236 GCTGATAAGGAGAAGCAGGACGG + Intergenic
963260456 3:143186817-143186839 TCATCAACAGAGAAGGAGGATGG + Intergenic
965033337 3:163402362-163402384 TCTTCTCAGGAGACTGAGGCAGG + Intergenic
965186295 3:165468627-165468649 TCTGCAAAGGAGAAAAAGGAAGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG + Exonic
968641021 4:1714877-1714899 ACTTCAGAGGAGGAGGAGGAGGG - Intergenic
969241939 4:5904712-5904734 TTTCCTAGGGAGAAGGAGCATGG - Intronic
970007760 4:11427624-11427646 TCTGCAAAGGAGGAGGAAGAGGG + Intronic
970166231 4:13241270-13241292 CATTCTAAGGAGAAGAAGCAAGG - Intergenic
970219676 4:13797836-13797858 TCTTCTATGGACATGGGGGATGG + Intergenic
971446476 4:26755639-26755661 TCTTCTAAGCAAGAGAAGGAAGG - Intergenic
972509498 4:39754229-39754251 TCCTTTAATGAGAAGGTGGATGG + Intronic
973340653 4:48999994-49000016 CCTTTTAAGGGAAAGGAGGAGGG - Intronic
973942346 4:55923801-55923823 TCCTCTAAGTAGAAGGGCGATGG + Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974228119 4:59075241-59075263 TATGCTAAGGAGAAGAAGGAAGG + Intergenic
975436411 4:74357601-74357623 TTCTCAAAGGAGAAGGAGGTGGG - Intergenic
976273402 4:83252213-83252235 TCTTCTAGGGAGCAGGGGGACGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
978896616 4:113896008-113896030 TCTTCTAGGCAGAAAGAGAAAGG + Intergenic
979426155 4:120570488-120570510 TCTACTAATGTGAAGGAGGAGGG - Intergenic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
981864559 4:149400248-149400270 TGTTCTAAGCAGAAGGATGTAGG - Intergenic
982709331 4:158744467-158744489 TCTTCTAGGGAGAAGAGAGAAGG + Intergenic
983102293 4:163639781-163639803 TCTAATAAGGAGGAGGAGTAAGG + Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
985219032 4:187683042-187683064 TCATGCAAGGAGAATGAGGAGGG + Intergenic
986029793 5:3883246-3883268 TCATCAAAGGAGCTGGAGGATGG - Intergenic
986043857 5:4019028-4019050 AATTGTCAGGAGAAGGAGGAAGG + Intergenic
986212872 5:5690599-5690621 TCTTCGAGGGAGAAGGAGAAAGG + Intergenic
987962308 5:24825793-24825815 ACTTCTAAGGAAAAGGCTGAGGG + Intergenic
988709421 5:33758612-33758634 AATTCTGAGCAGAAGGAGGAAGG + Intronic
990088093 5:52003908-52003930 TCTTCAAGGGAGAAGAAAGAAGG - Intergenic
990432518 5:55750436-55750458 TATTCTCAGGAGGAGGAGGAGGG + Intronic
990992204 5:61697405-61697427 CCCCCTAAGGAGAAGGAGGTTGG - Intronic
992738351 5:79746241-79746263 TTTTCTAAAGGGTAGGAGGATGG - Intronic
993308186 5:86295826-86295848 TCTTCTAGGGAGGAGTGGGAGGG - Intergenic
993423051 5:87725971-87725993 TTTTCTAAAGAGCAGGATGAGGG - Intergenic
993573216 5:89568574-89568596 TTTTCTAAGGAAAAAGAGGTCGG - Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
994829093 5:104754818-104754840 ACTTCTAAGAAGCAGGAGGTGGG - Intergenic
995098469 5:108269187-108269209 GCTTTTAAGGAGTAGGAGGAAGG + Intronic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
998604069 5:143615613-143615635 TCTTAAAAGGAGAAGAAAGAAGG - Intergenic
999323024 5:150626319-150626341 TCTCCTAAGGAGACAGAGGAAGG - Intronic
999695584 5:154186030-154186052 TCTTCTAAGGAGCTAGAAGAGGG + Intronic
1000014450 5:157265577-157265599 TGCTCTGAGGAGAAGGAGCAGGG - Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1001426537 5:171626162-171626184 TTTTCTAAGAAGAAGAAGAAAGG - Intergenic
1002091159 5:176807320-176807342 TCATGTCAGGAGAAGGAGGAGGG - Intergenic
1002802819 6:542388-542410 GCATCAAAGGAGAAAGAGGACGG + Intronic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1003291804 6:4786139-4786161 TCTCCTAAGGAGGTGGAGGTGGG + Intronic
1003331116 6:5129540-5129562 TCTTCTAAGAGGAAGGCAGAGGG - Intronic
1003335448 6:5167631-5167653 TCTTGACAGGAGAAGAAGGAAGG - Intronic
1003366495 6:5479908-5479930 GCTCCTCAGGAGAAGGAGAAGGG + Intronic
1003493401 6:6642863-6642885 TCGTCTCCGGAGGAGGAGGAGGG - Intronic
1003914467 6:10773105-10773127 TCTTCTAAAGAGAAGACAGATGG + Intronic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1004871556 6:19909865-19909887 TCTTCTATGGAAAATGAGGGAGG + Intergenic
1005009569 6:21322976-21322998 TTTTCTGAGGAGGAGGAGGGAGG + Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005489816 6:26337238-26337260 TGTTCAAAGCAGAAGAAGGATGG + Intergenic
1008000204 6:46352404-46352426 TCCTCAGAGGGGAAGGAGGACGG - Intronic
1010061600 6:71628719-71628741 TCTGGCAAGGATAAGGAGGAGGG - Intergenic
1010371434 6:75113904-75113926 CCTTCTAAGGAGAAGTCAGAAGG - Intronic
1011489277 6:87874116-87874138 TCTTCAAGGGAGAAGAGGGAGGG + Intergenic
1011528442 6:88292897-88292919 CCTTTTAAGGATAAGAAGGAAGG - Intergenic
1011850255 6:91618404-91618426 TATTCTAAGGATACAGAGGAGGG - Intergenic
1011984090 6:93419816-93419838 TGTTCAGAGGAGAACGAGGATGG + Intergenic
1013167148 6:107604613-107604635 GCTTCCAAAGAGAAGGAGGTGGG - Intronic
1013301083 6:108805433-108805455 TCTCCTAATGAAAAGGGGGACGG + Intergenic
1013615284 6:111837356-111837378 TATTCTAAAGAGTAGGAGTAGGG - Intronic
1013640164 6:112067444-112067466 GCTGCTAAGGAGAAATAGGAGGG - Intronic
1013852121 6:114528597-114528619 TGTTCTAAGCAGAGGGACGAAGG - Intergenic
1014054791 6:117001295-117001317 TGTTTTAAGGACAAGGAAGATGG - Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016042136 6:139442327-139442349 GCTTATCACGAGAAGGAGGAAGG + Intergenic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1016798826 6:148147333-148147355 TCTTCGAAGGAAAAAGAGGCAGG + Intergenic
1017557057 6:155583066-155583088 TCTGCCATGGGGAAGGAGGATGG + Intergenic
1017589372 6:155961993-155962015 TGGTCTGAGGAGAAGAAGGATGG + Intergenic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018331463 6:162732213-162732235 TCTCCTCAGGAAAAGGATGAAGG + Intronic
1018730835 6:166649247-166649269 TGATCTAAGAAGAAGGAAGAGGG - Intronic
1020452976 7:8340884-8340906 TTTTGTAGGGAGAATGAGGATGG + Intergenic
1021067238 7:16191490-16191512 ACTCCTAAGGTGAAAGAGGAAGG + Intronic
1023909804 7:44545623-44545645 GCTTCTCAGGAGACGGAGGTTGG - Intergenic
1024010043 7:45259446-45259468 TTTTCTAGGGAGCAGCAGGATGG - Intergenic
1024296257 7:47845032-47845054 TCTCCTAAGGAGAAAGCTGAAGG - Exonic
1024969302 7:55054004-55054026 TATTCTACGGAGAGGGAGGGAGG - Intronic
1025138920 7:56446629-56446651 ACTTCTAATGAGGAGGGGGAAGG - Intergenic
1026714456 7:72775404-72775426 TCTTCCAAGTAGCAGGAGGTTGG + Intronic
1027532341 7:79352521-79352543 TCTGCTAAGCAGAAGCATGAGGG + Intronic
1027869430 7:83687908-83687930 TCTTCAAGGGAGAAGCAAGAAGG + Intergenic
1031458143 7:122010325-122010347 TTTTCAAAGGAGGAGGAAGAGGG + Exonic
1031501362 7:122521830-122521852 ACTTCTCAGGAAAAGGAAGAGGG - Intronic
1031562985 7:123260623-123260645 CCTTCTAAGGACAAGGAAGGAGG - Intergenic
1032634569 7:133692800-133692822 AATTCTAAGGAGGAGGAGAAAGG - Intronic
1033324852 7:140368918-140368940 TCTTTTGAGGTGAAGGATGATGG - Intronic
1034485504 7:151358622-151358644 TTTTCCATGGACAAGGAGGAAGG - Intronic
1035514636 8:222199-222221 GCTACTAGGGAGAATGAGGAAGG + Intergenic
1036076359 8:5506184-5506206 TTTTCTAAGTTGAAGAAGGATGG - Intergenic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1037490918 8:19396299-19396321 TGTTCTAATGAGAAAGATGATGG + Intergenic
1037638135 8:20719034-20719056 TCTCCTAAGGAAAGGAAGGATGG - Intergenic
1037877313 8:22554433-22554455 TCCTCTGTGGGGAAGGAGGAAGG - Exonic
1038969420 8:32615832-32615854 TCTTCTGAGGAAAGGAAGGAAGG + Intronic
1040071402 8:43191694-43191716 GCCTCAAAGGAGAAGGAAGAGGG - Intronic
1042263366 8:66883356-66883378 TCTTAAAAGGAGAAGAATGAGGG + Intronic
1042977302 8:74483773-74483795 TCTACTTAGGAGAAGTTGGAGGG + Intronic
1043684381 8:83068280-83068302 TCTGCTACAGAGAAGGAGCAGGG - Intergenic
1043915067 8:85913040-85913062 TCTTCTAATGAAAAGCAAGATGG + Intergenic
1044476250 8:92629960-92629982 CCTTCAAAGGAGCAGGAGAATGG - Intergenic
1044931132 8:97252707-97252729 TCTTCTAAGCAGGAGAAGGATGG - Intergenic
1045487676 8:102644958-102644980 TCTTCTAAAGAGAAAGGGTAGGG + Intergenic
1045825224 8:106389035-106389057 TCTTCTTATTAGAAGGATGAGGG - Intronic
1046225391 8:111272162-111272184 TCTTCTTAAGAGAAAGTGGAAGG - Intergenic
1046605655 8:116368831-116368853 TCATCCAAGGAATAGGAGGAGGG + Intergenic
1046995816 8:120521421-120521443 TCTTCAAAGGAAGAGAAGGAAGG + Intronic
1047251877 8:123186931-123186953 TCTCCTAAGGAGCAGGTGGTTGG - Intronic
1047298742 8:123594424-123594446 TCTACCAAGAAGAAGCAGGATGG - Intergenic
1047750469 8:127876666-127876688 TCCTCTAAGCAGGCGGAGGAGGG + Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1049195345 8:141312769-141312791 TCTTCCTAGGAAAAGCAGGAGGG + Intergenic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1049442410 8:142615379-142615401 ACTTCTAAGGGGATGGAAGAGGG + Intergenic
1049949105 9:627263-627285 TGGTTTAGGGAGAAGGAGGAGGG - Intronic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050243913 9:3667961-3667983 TCTGGTGAGGTGAAGGAGGAGGG + Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051263057 9:15284724-15284746 TCTTCTGAGGAGAGGAAGGGAGG + Intronic
1051605932 9:18917824-18917846 TCATCCATGGAGAAGGATGAGGG - Intergenic
1053052518 9:34973603-34973625 TCGTCTAAGCAGCAGGAAGAAGG - Intronic
1053186254 9:36019111-36019133 TCTTGTAAGAAGAAAGATGAGGG - Intergenic
1055654739 9:78441006-78441028 TCCTCCAAGGAGAGGGGGGATGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056512831 9:87321875-87321897 TGGTCTATGGAGTAGGAGGAAGG - Intergenic
1056992843 9:91426525-91426547 GGTTCTCAGGAGGAGGAGGAAGG + Intergenic
1057452244 9:95175134-95175156 TCTTTTAAGGATACGGAGGCAGG - Intronic
1057827929 9:98385312-98385334 TCTTCTCAGGAGGCTGAGGAGGG - Intronic
1058159516 9:101552668-101552690 TCTGCTAAGGATAAAGAGAAAGG + Exonic
1058462442 9:105195685-105195707 ACTTCTGAGGAGAGAGAGGAGGG + Intergenic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1059872631 9:118594977-118594999 TGGTCTAATGAGAATGAGGAAGG + Intergenic
1060846220 9:126839553-126839575 TCTTGTGAGGAGAAAGAAGATGG + Intergenic
1062314170 9:135957612-135957634 TCTTCTGGGGAGGAGCAGGATGG - Intronic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1186859823 X:13661323-13661345 TCTTCTAAGGAGAAATTAGAAGG - Intronic
1187082096 X:16001421-16001443 TCTCTGAAGGAGAAGGGGGATGG - Intergenic
1187122570 X:16423493-16423515 TCTTATGATTAGAAGGAGGAAGG - Intergenic
1189000796 X:36942575-36942597 TCTTCTAAGAAGAAAAGGGAAGG - Intergenic
1190291165 X:48993340-48993362 TCCTCTCAGGGGAAGGAGAAGGG - Intronic
1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG + Intronic
1191055290 X:56233768-56233790 GCTTCTGAAAAGAAGGAGGAGGG + Intronic
1191936943 X:66436881-66436903 TTTTCCAGGGAGAAGGAGGCAGG - Intergenic
1192178351 X:68899666-68899688 TCTTCCCAAGAGAAGGAGGTGGG + Intergenic
1192722319 X:73712055-73712077 TCAACTAAAGGGAAGGAGGATGG + Intergenic
1192817954 X:74614191-74614213 TCTTTGAAGGGGAAGGAGGTGGG - Intronic
1193780994 X:85701249-85701271 TCTCTCAGGGAGAAGGAGGAGGG - Intergenic
1194937853 X:99972533-99972555 TATTCTAAGCAGAAGGACGGAGG - Intergenic
1196464712 X:115960268-115960290 TGTGCTCAGGAGAAGGGGGAAGG - Intergenic
1197006420 X:121507380-121507402 TCATCAAAGGAGGAAGAGGAGGG - Intergenic
1197149827 X:123207997-123208019 GCTTCTGAGCAGCAGGAGGAAGG - Intronic
1197275910 X:124478772-124478794 TCTACTAAGTGGAAGGAAGAAGG + Intronic
1197853441 X:130889375-130889397 TCTTCTTACAAGAAGTAGGATGG - Intronic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199779306 X:151043839-151043861 TGTTGTCAGAAGAAGGAGGAAGG + Intergenic
1199902690 X:152192663-152192685 TCTCCTAAGGGGAGGGAGAATGG - Intronic
1200184092 X:154170469-154170491 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200189746 X:154207597-154207619 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200195499 X:154245406-154245428 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200201151 X:154282527-154282549 GCTACAAAGGTGAAGGAGGAGGG + Intronic
1202192897 Y:22262289-22262311 AATTCTAAGGAAAAGTAGGATGG + Intergenic