ID: 1101122499

View in Genome Browser
Species Human (GRCh38)
Location 12:101597584-101597606
Sequence ATCTCGAAGAGGAAGTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101122499 Original CRISPR ATCTCGAAGAGGAAGTCTAA TGG Intronic
900964854 1:5950783-5950805 ATCTCGAGCAGGAAGTAAAAGGG - Intronic
904268713 1:29334103-29334125 ATGTGGAAGAGGGAGTCCAAAGG + Intergenic
908696743 1:66851688-66851710 GTGTCAAAGAGGAAGTCTCAAGG + Intronic
910494524 1:87811603-87811625 TTTTCCAAGAGGAAGTCTCAGGG - Intergenic
915823510 1:159051178-159051200 ATCTGGAAGAGGAAGTATGGAGG + Intronic
916307056 1:163348511-163348533 ATCTGCAAGAGGAAGTATGAAGG - Intronic
916412152 1:164556770-164556792 ATCTCTTATAGGATGTCTAAGGG + Intronic
916475921 1:165168936-165168958 ATCTGGAAGAGGCAGCATAAAGG + Intergenic
916685964 1:167146952-167146974 TTCTTGCAGAGCAAGTCTAATGG + Intergenic
916893843 1:169140650-169140672 ATTTCTAAGAGGAAGTGTCAAGG - Intronic
917672823 1:177289380-177289402 ATTTGAAAGAGGCAGTCTAATGG - Intergenic
918706083 1:187664096-187664118 ATCTCGAAGAGGAAGCAGAGAGG - Intergenic
918830909 1:189396890-189396912 AGATCAAAGAGGAAGTCTCAAGG + Intergenic
1068246562 10:54378573-54378595 ATATTAAAGGGGAAGTCTAACGG + Intronic
1073687352 10:105769856-105769878 ATCTTGCAGAGGAATTCTAGGGG + Intergenic
1077541527 11:3148773-3148795 ATCTCCCAGAGGGAGGCTAAGGG + Intronic
1077603670 11:3592272-3592294 AGTTCTGAGAGGAAGTCTAATGG - Intergenic
1082084205 11:48035849-48035871 ATCTTGAAGAGGAAGACAGAGGG - Intronic
1089546939 11:119235042-119235064 ATCTATAAGAGAAAGTCTAGAGG - Intronic
1090726371 11:129530719-129530741 ATTGAGAAGAGGAAATCTAAAGG - Intergenic
1099892011 12:88601291-88601313 ATGTTGAAAAGGAAGTCAAAAGG - Intergenic
1101015981 12:100501020-100501042 ATCTCTAAGAGAAATTCAAAGGG + Intronic
1101122499 12:101597584-101597606 ATCTCGAAGAGGAAGTCTAATGG + Intronic
1106203385 13:27564744-27564766 ATCTCGAAGAGGCAGTAAGATGG - Intronic
1111336275 13:86828057-86828079 ATCTCCACTAGGATGTCTAATGG - Intergenic
1113224093 13:108140286-108140308 ATCTCGAAGAGGGAGAGTGAAGG - Intergenic
1117452834 14:55867750-55867772 GTTTCAAAGAGGAAGTCTCAAGG - Intergenic
1118057541 14:62096765-62096787 ATCCCAAAGAGGGAGACTAAAGG + Intronic
1121642336 14:95494159-95494181 ATCTGGATGTGGAAGTCAAATGG - Intergenic
1124971744 15:34495760-34495782 AACTCGAAGAAGAAGTCCACAGG - Intergenic
1128019880 15:64381163-64381185 ACCTAGAAGAGGAAGTCGCAGGG - Intronic
1132162357 15:99554822-99554844 TTCTAGAACAGGTAGTCTAAAGG + Intergenic
1132239716 15:100248434-100248456 ATCTGGAAGAGGAACGCAAAGGG + Intronic
1133578631 16:7120104-7120126 AGTTCAAAGAGGAAGTCTCAAGG + Intronic
1135973914 16:27093641-27093663 AGGTCAAAGAGGAAGTCTCAAGG + Intergenic
1142277430 16:89128611-89128633 AAGTCAAAGAGGAAGTCTTAAGG - Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144321852 17:14131160-14131182 TTATTGAAGAGGAAGTCAAAGGG + Intronic
1146753251 17:35401478-35401500 AGATCAAAGAGGAAGTCTCATGG - Intergenic
1149089609 17:52762474-52762496 GTCTCCAAGAGGAAGGCTTATGG + Intergenic
1150527881 17:65942526-65942548 ATCTGGAAAAGGAAGGGTAAAGG + Intronic
1151193818 17:72417824-72417846 ATTTAGTAGAGGAAGTCAAACGG + Intergenic
1156246318 18:35302685-35302707 TTCTGGAAGAGGAAGTATAAGGG + Intergenic
1156675384 18:39521837-39521859 ATCTCAAAGAGAAAGGCTAGTGG + Intergenic
1166393431 19:42422992-42423014 TACTCAAAGAGGAAGTCTAGCGG - Intronic
1168495592 19:56845978-56846000 GTCGCAAAGAGGAAATCTAATGG - Intergenic
925148795 2:1600744-1600766 AGATGGAAGAGGCAGTCTAAGGG + Intergenic
927378823 2:22453358-22453380 ATCTCGAACATGTAGTCTCATGG + Intergenic
928831348 2:35488717-35488739 AGGTCAAAGAGGAAATCTAAAGG + Intergenic
932153479 2:69394001-69394023 AACTGGAAGAGAAAGTCTATTGG - Intergenic
938390349 2:130899966-130899988 AGTTCAAAGAGGAAGTCTCAAGG - Intronic
939348612 2:141001700-141001722 ATCTTTAAGAGGAAGTTTATGGG + Intronic
939469133 2:142597462-142597484 ATGTTGAATAGAAAGTCTAAAGG - Intergenic
940601470 2:155866975-155866997 ATCATGAAGTGGAAGACTAATGG + Intergenic
941486040 2:166084125-166084147 TACTCGAAGAGAAAGCCTAATGG + Intronic
943451982 2:188054803-188054825 ATCTCATAAAGGAAATCTAAAGG - Intergenic
944380595 2:199105070-199105092 AGGTCAAAGAGGAAGTCTCAAGG - Intergenic
945656994 2:212636360-212636382 ATCTCCAAGAGGTATTGTAAAGG + Intergenic
948251462 2:236533405-236533427 ATCTGGTAGAGGAAGCCCAAAGG + Intergenic
1169462475 20:5807720-5807742 TTCTCCAAAAGGAAGTCGAAGGG - Intronic
1171303639 20:24085786-24085808 ATTTGGAAGAGGAAATCTCAAGG - Intergenic
1178620987 21:34175360-34175382 AGGTCAAAGAGGAAGTCTCAGGG + Intergenic
1181122002 22:20676069-20676091 ATCTCTAAAAGGAAAACTAAGGG - Intergenic
950529616 3:13545672-13545694 AGCTGGAAGAGGAAGGCTAGAGG + Intergenic
952800453 3:37285786-37285808 ATCTCTAAGATGAAGTCATATGG + Intronic
956286753 3:67618487-67618509 ATCTCACAGAAGAAGTCTGAAGG + Intronic
956288726 3:67638904-67638926 ATAACCTAGAGGAAGTCTAATGG + Intronic
957006432 3:74953249-74953271 ATTTCAAAGAGAAATTCTAAAGG + Intergenic
957954176 3:87162122-87162144 AACTTGAAAAGGAAGTATAATGG - Intergenic
960984529 3:123266516-123266538 AGGTCAAAGAGGAAGTCTTAAGG - Intronic
964317105 3:155456589-155456611 ATCTCCAAAAGGAGGTCTAATGG + Intronic
970508761 4:16759306-16759328 ATCTCAAAGAGGAAGAGAAAAGG + Intronic
970961092 4:21871798-21871820 ATTTCTAAGAGGAAATCTCAGGG - Intronic
977481901 4:97589128-97589150 ATCTCCAAGAGGAAAAATAAGGG + Intronic
978937684 4:114398249-114398271 CTGTAGAAGAGGAAATCTAAAGG - Intergenic
985149562 4:186932482-186932504 ATCTAGAAGAGCATGTCAAAGGG - Intergenic
994880026 5:105478799-105478821 GACTCGAAGAGGAAATCAAAAGG + Intergenic
998313819 5:141160756-141160778 ATCCAGAAGAGGAAATCAAATGG - Intergenic
998560309 5:143165362-143165384 ATATCTAAAAGGAAGTTTAATGG + Intronic
1004332026 6:14730421-14730443 ATCAGGAAGAGGAAGTATAATGG + Intergenic
1004385579 6:15170019-15170041 ACCTCGAGGAGGAAGGCTCAGGG - Intergenic
1006633181 6:35443692-35443714 ATCTTGAAGAGGAAGGGGAATGG - Intergenic
1011864432 6:91805763-91805785 ATGTTGAAGGGGAAGTCCAAGGG + Intergenic
1013723036 6:113054247-113054269 ATCTCCATAAGGAAGTCTCAAGG + Intergenic
1014022998 6:116612522-116612544 AGCTCGATGAGCAAGTCTAAGGG + Intergenic
1015351120 6:132221270-132221292 ATCTCCAAGGAAAAGTCTAAAGG + Intergenic
1018338131 6:162817976-162817998 ATCTCGAATATGAAATCTACCGG + Intronic
1020139602 7:5605334-5605356 AACTCGAAGAAGAAGTCCACAGG - Exonic
1020408649 7:7865921-7865943 ATCTCCTAAAGGAAGTTTAATGG - Intronic
1021923473 7:25511269-25511291 ATCTTGGACAAGAAGTCTAAGGG + Intergenic
1023339923 7:39209436-39209458 ATTTCAAAGAGGAAGACAAAGGG - Intronic
1023684057 7:42717179-42717201 ATATCAAAGGGGAAGGCTAAGGG - Intergenic
1024038220 7:45526607-45526629 AACAGGAACAGGAAGTCTAAGGG - Intergenic
1024057647 7:45674033-45674055 AGGTCAAAGAGGAAGTCTCAAGG - Intronic
1026575300 7:71566630-71566652 AGCTAGAAGAGGAAGGCTACAGG - Intronic
1029268491 7:99361099-99361121 CTCTCAAACAGGAAGTCTAGAGG - Intronic
1036297021 8:7545533-7545555 ATATGGAAGAGAAATTCTAAGGG - Intergenic
1036325548 8:7775486-7775508 ATATGGAAGAGAAATTCTAAGGG + Intergenic
1038222035 8:25618738-25618760 AGGTCAAAGAGGAAGTCAAAGGG + Intergenic
1038472996 8:27841048-27841070 TTGTTAAAGAGGAAGTCTAAGGG - Intergenic
1041678592 8:60562799-60562821 CTCTGGAAGAGGAAGAGTAAAGG + Intronic
1044051405 8:87510318-87510340 ATCTCAAAGACAAAGTCCAAAGG + Intronic
1044532120 8:93319140-93319162 ATCTGGGAAAGGAAGTCTCAAGG - Intergenic
1048693638 8:136997675-136997697 ATAAAGAAGAGGAAATCTAAAGG - Intergenic
1053728864 9:41031979-41032001 ATGAAGAAGAGGAAGTCTAGAGG + Intergenic
1054699648 9:68400104-68400126 ATGAAGAAGAGGAAGTCTAGAGG - Intronic
1054979180 9:71184111-71184133 ATCTCGAAGAGCACCCCTAATGG - Intronic
1055920561 9:81455877-81455899 ATCTTGAAGAGAAAGGCAAAAGG - Intergenic
1056543328 9:87592911-87592933 ACCTCGTGGAGGAAGTCTAGGGG - Intronic
1186630129 X:11339758-11339780 ATCTCCAAACGGATGTCTAATGG + Intronic
1188340470 X:28994494-28994516 ATCTCTACTTGGAAGTCTAAAGG - Intronic
1191100939 X:56727892-56727914 ATCCCCAAGAGAAAATCTAAAGG - Intergenic
1192247944 X:69388794-69388816 ATCGCCAGGAGGAAGTCTTAAGG - Intergenic
1193473276 X:81933110-81933132 ATCTTGAAGGGGGAGCCTAATGG + Intergenic
1194532237 X:95064832-95064854 ATATCAAAAAGGAAGTCTTAAGG + Intergenic
1200090071 X:153631413-153631435 GGGTCCAAGAGGAAGTCTAAAGG + Intergenic