ID: 1101124481

View in Genome Browser
Species Human (GRCh38)
Location 12:101617204-101617226
Sequence CCAAGTAAAGAGAAGGAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 472}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101124481 Original CRISPR CCAAGTAAAGAGAAGGAGGC CGG Exonic
901003101 1:6158709-6158731 CGAGGTCAAGAGATGGAGGCCGG + Intronic
901007394 1:6178750-6178772 GCAAGCAAACAGAAGGGGGCAGG + Intronic
901390461 1:8942558-8942580 GCAAGGAAAAAGAAGGAGGCAGG - Intergenic
901923661 1:12552811-12552833 CCAAGGCCAGGGAAGGAGGCCGG - Intergenic
901945677 1:12701707-12701729 GCAAGAAAAGGGAAGGAAGCCGG + Intergenic
902129100 1:14243208-14243230 CAAAGAAAAGAGAAAGATGCTGG - Intergenic
902137918 1:14326674-14326696 CCAAGCACAGGGAAGGATGCAGG - Intergenic
902601177 1:17540719-17540741 CCAAGTAGAGAGGTGGTGGCTGG + Intronic
902822139 1:18949930-18949952 CCCAGAAAAGAAAAGGAAGCAGG - Intronic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
904204677 1:28846203-28846225 CCATGTGAAGTGAAGGAGGAAGG - Intronic
904937745 1:34143769-34143791 CCAAGGCAAGAGGAGCAGGCTGG - Intronic
905482241 1:38269516-38269538 GCAAGTGAAGAGAAGCAGACAGG - Intergenic
905689386 1:39931758-39931780 CCAAGAAATTAGAATGAGGCTGG - Intergenic
906296189 1:44650458-44650480 CCCAGTAATGAGAACAAGGCTGG - Intronic
906801938 1:48745568-48745590 ATAAGCAAAGAGTAGGAGGCAGG - Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907599174 1:55749514-55749536 CCAAGTTGAAAGAAGGAGACAGG + Intergenic
908532822 1:65049794-65049816 CAATGCTAAGAGAAGGAGGCAGG - Intergenic
908720827 1:67123911-67123933 CCAAGTGAAGAAAAGGAGATTGG - Intronic
909961293 1:81846918-81846940 GTAAGTAAAGTGAAGGAGACAGG + Intronic
910880521 1:91918791-91918813 CAAAGTCAAGAGATTGAGGCCGG - Intergenic
911480912 1:98439355-98439377 AAAAGTGAAGAGAAGAAGGCAGG + Intergenic
912601210 1:110934772-110934794 CAACCTAAAGGGAAGGAGGCGGG + Intergenic
913056560 1:115167123-115167145 CAAAGACAAGAGAAGGAGCCAGG - Intergenic
913332192 1:117676933-117676955 CCAAGTAATGAGATGGAGACAGG - Intergenic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
915837286 1:159187987-159188009 ACAAATAGAGAGAAGTAGGCAGG - Intronic
916056553 1:161072613-161072635 CCATGTCAACAGAAGGAGCCAGG + Exonic
916656201 1:166877445-166877467 TCAAGTGAAGAGAAGGTGCCCGG - Intergenic
916966451 1:169949231-169949253 CTAAGAAAAGAAAAAGAGGCAGG + Intronic
918132424 1:181641445-181641467 CCAAGGAGAGAGAAAGAGGTGGG - Intronic
919867441 1:201793038-201793060 CAAGGTAAAGGGAATGAGGCCGG - Intronic
920091090 1:203453754-203453776 CCAGGAAGAGAGAAGGAAGCTGG - Intergenic
920340447 1:205272249-205272271 GCAAGTACAGAGAAGGGGGCAGG - Exonic
920371511 1:205482109-205482131 ACAAGGAAAGAGAGGCAGGCAGG - Intergenic
921086522 1:211798932-211798954 CCTAGAAAAGAGAGGGAGGGAGG + Intronic
921850317 1:219927424-219927446 GCAAGTAATGAGAGGGAGGAGGG + Intronic
922416214 1:225425649-225425671 CCAAGTACAAAGAAAGAGGAAGG + Intronic
922608172 1:226904137-226904159 CCAAGGAATGAGCAGGAGGAGGG - Intronic
922922113 1:229314436-229314458 CCAAGAAAAGAGAACAAGGTGGG + Intergenic
924688799 1:246324965-246324987 ACAAGGAAGGAGAAGGAGTCAGG + Intronic
1062984099 10:1751017-1751039 CCAAGAAAAGATATGGAGGAAGG + Intergenic
1063096221 10:2911368-2911390 CCAAGTAGGGAGCGGGAGGCAGG + Intergenic
1063671809 10:8105240-8105262 CCAAGAAGAGAGAAGACGGCTGG - Intergenic
1064880511 10:20047651-20047673 CCATGTAAGGAAAGGGAGGCTGG - Intronic
1068038094 10:51786444-51786466 ACAAGTGAAGAAAAGAAGGCTGG - Intronic
1068264591 10:54630215-54630237 CTAAGTGAAGAGAAGAAAGCTGG + Intronic
1068590589 10:58849009-58849031 GGGAGTACAGAGAAGGAGGCTGG - Intergenic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1068742004 10:60483974-60483996 CAAAGTTAAGATAAGGAGCCTGG + Intronic
1068785392 10:60967161-60967183 CCAGGTAAAGAGTAGTAGTCCGG + Intronic
1070949943 10:80422949-80422971 CCAAGGAAAGAGAGACAGGCAGG - Intronic
1071737974 10:88323305-88323327 CTAAGCAAAGAGAACAAGGCTGG + Intronic
1072011692 10:91307438-91307460 GCAAGGAAAGAGAAGGAAGCTGG + Intergenic
1072587019 10:96791708-96791730 CAAAGTAAAGATAAGGATTCAGG + Intergenic
1072672064 10:97437642-97437664 TCAAAAGAAGAGAAGGAGGCCGG - Intronic
1073051148 10:100668177-100668199 TCCAGGAGAGAGAAGGAGGCAGG + Intergenic
1073280913 10:102353306-102353328 CCAAGTAAATATAAGCAGGAAGG + Intronic
1073834836 10:107429383-107429405 CCAAGTAAGGAGCAGCAGGCAGG - Intergenic
1074731564 10:116382808-116382830 CCAAGAAAAAAAAAGCAGGCAGG - Intergenic
1074887061 10:117702104-117702126 CTATGTAAAGAGGAGAAGGCAGG - Intergenic
1075250904 10:120871647-120871669 CCAATTACAGACAAGGAGCCTGG - Intronic
1075807114 10:125197300-125197322 CTAAGTTAAAAGAAGGAGACTGG - Intergenic
1075977021 10:126704950-126704972 CCGAGTCTAGACAAGGAGGCAGG + Intergenic
1076826325 10:132971417-132971439 CCAAAAAAAGAAAAGGAGGGAGG - Intergenic
1077117796 11:893185-893207 CCAAGTGGACAGAAGCAGGCTGG - Intronic
1077501863 11:2912947-2912969 CCAAGAAAAAACAAGGAGCCAGG + Intronic
1077721845 11:4637726-4637748 TTAAGTGAAGAGTAGGAGGCAGG - Intergenic
1077874667 11:6294092-6294114 TGAACTCAAGAGAAGGAGGCAGG + Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078905806 11:15686784-15686806 ACAAGTTGAGAGAATGAGGCAGG - Intergenic
1079035335 11:17014901-17014923 ACAGGGGAAGAGAAGGAGGCTGG - Intergenic
1079140510 11:17806269-17806291 GCAAGGAAAGAGAAGGAGGAAGG + Intronic
1079426495 11:20347335-20347357 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079666211 11:23109196-23109218 CCAAAGATAGAGAAGGAGGTTGG + Intergenic
1080166444 11:29242890-29242912 CCAAGCAAAGCCATGGAGGCTGG + Intergenic
1080956141 11:37098250-37098272 CCAAGAAAATAGAAAGAGGTGGG + Intergenic
1081760975 11:45576328-45576350 ACAAGCAAAGAGAAGGAGGCTGG + Intergenic
1082216986 11:49583380-49583402 GGAAGGAAAGAGAAGGAGGATGG - Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082789053 11:57335021-57335043 ACAAGTAGAGAGAAGGAAGGAGG - Intronic
1082952057 11:58827866-58827888 ACAAGAAAAAAGAAGGAGGCCGG - Intergenic
1083072084 11:59995038-59995060 CCAAGTTAAGAGACTGAGGAAGG - Intergenic
1083391531 11:62354842-62354864 CCAAGGAAAGAAAATGAAGCTGG + Intronic
1083451782 11:62751102-62751124 CAAAGAAAAGGGTAGGAGGCTGG + Exonic
1083631546 11:64097923-64097945 TCCAGTGAGGAGAAGGAGGCGGG + Intronic
1083799252 11:65036969-65036991 ACAAGAAAAGTGAAAGAGGCAGG - Intronic
1084100524 11:66945157-66945179 TCAAATAAAGAGAAAGAGGGTGG - Intronic
1084683546 11:70680727-70680749 CCAGGGAAAGAGAGAGAGGCTGG - Intronic
1085374902 11:76051555-76051577 ACAAGTAAAAAAAAGGAGGGGGG + Intronic
1086073092 11:82820618-82820640 TCAAGTTAAGAGAAGAAGGTAGG - Intergenic
1086632568 11:89040786-89040808 GGAAGGAAAGAGAAGGAGGATGG + Intronic
1087269587 11:96097914-96097936 CACAGTAAAGATATGGAGGCAGG + Intronic
1088698501 11:112390872-112390894 TCAAGAAAAGCCAAGGAGGCTGG - Intergenic
1089528665 11:119112871-119112893 TTAGGTAAAGAGAAGGAGCCTGG + Exonic
1089708183 11:120295840-120295862 GGAAGCAAAGAGAAGGAAGCGGG - Intronic
1090082055 11:123620175-123620197 CTAAGTAAGGAAAAAGAGGCCGG + Intronic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090721691 11:129481239-129481261 CCTACTAAAGGGAAGGAGCCTGG - Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092262098 12:6958327-6958349 CCAAATACAGAGGAGGAGCCCGG + Intronic
1092320067 12:7462601-7462623 CTAAGTAAAAAGAATGAAGCTGG - Intronic
1092873921 12:12831999-12832021 AGGAGTAAAGAGTAGGAGGCAGG + Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093728794 12:22544584-22544606 CCGAGGAAAGATAAGGGGGCGGG + Intergenic
1094108434 12:26836640-26836662 CCAAGTATAGAGACAGAAGCTGG - Intergenic
1095729870 12:45494792-45494814 TCAAGGAAAGAAAATGAGGCTGG + Intergenic
1096182860 12:49560091-49560113 CCAACCCCAGAGAAGGAGGCTGG - Intronic
1096279685 12:50241978-50242000 TTATGTAAAGAAAAGGAGGCTGG - Intronic
1096456201 12:51789125-51789147 GCCAGTGTAGAGAAGGAGGCAGG + Intronic
1097495502 12:60326640-60326662 GCAATTAAAGAGCATGAGGCAGG - Intergenic
1098472063 12:70856779-70856801 GCAAGGATAGAGAGGGAGGCAGG + Intronic
1098519383 12:71419011-71419033 GGAAGAAAAGAAAAGGAGGCAGG - Intronic
1099521069 12:83663372-83663394 GCAAGAAAAGAGAAGGAGTTTGG - Intergenic
1100406174 12:94274553-94274575 CCAAGGAAATAGGAAGAGGCAGG + Intronic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101320284 12:103667526-103667548 CCAGGGAAAGAGAAGGAAGAGGG + Intronic
1101352714 12:103947151-103947173 CCAAGCTAACAAAAGGAGGCAGG - Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101802172 12:108032013-108032035 CCGAGAAAAGAGAAGGACCCAGG + Intergenic
1102641951 12:114374584-114374606 TCTGGTGAAGAGAAGGAGGCAGG + Intronic
1103690271 12:122767049-122767071 CCAGGTAAAGGGAAAAAGGCTGG - Intronic
1103929632 12:124442963-124442985 CCAAGGAACGCCAAGGAGGCCGG + Intronic
1104221454 12:126788504-126788526 CCAACCAAAAAGAAGGAAGCGGG + Intergenic
1106780781 13:33057081-33057103 CCCAGTAAAGAGGAGGAGGAAGG - Intronic
1106913889 13:34490864-34490886 CCAGGTAAAGAGAAAGAGGAAGG - Intergenic
1107340282 13:39398136-39398158 TCAAGGAAAGAGAAGAAGGAAGG + Intronic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108814963 13:54279136-54279158 CCAAGGAAAAAGAAGAAAGCTGG - Intergenic
1109939118 13:69336202-69336224 CCAAGTAAAAAAATGTAGGCAGG + Intergenic
1111525230 13:89459729-89459751 CCAAGTAAAAAGAACAAAGCTGG - Intergenic
1112475418 13:99727370-99727392 CCTAGAAAAGAGGTGGAGGCAGG - Intronic
1112534997 13:100244728-100244750 CTAAGTAGAGAGAAATAGGCAGG + Intronic
1113949005 13:114060828-114060850 CCCTGTGAAGAGCAGGAGGCTGG + Intronic
1114387098 14:22266869-22266891 CCTAGAAAAGAGCAGGATGCTGG - Intergenic
1114415807 14:22543237-22543259 CCAAGTAAGTAGAATGAAGCAGG + Intergenic
1114962112 14:27905385-27905407 AGAAGGCAAGAGAAGGAGGCTGG + Intergenic
1114989488 14:28269720-28269742 CTAAGTGAAGAGAAGAAAGCAGG + Intergenic
1115797241 14:36951936-36951958 CCAATAAAAGAGAATCAGGCAGG + Intronic
1116939742 14:50779456-50779478 CCAAATGAAAAGAAGGGGGCAGG + Intronic
1117338839 14:54776981-54777003 CCAAGTAAAGGAAAGATGGCTGG - Intronic
1117652805 14:57924420-57924442 GAAAGTAAAGAGAATGAGCCTGG - Intronic
1117820562 14:59644821-59644843 CCATGGAAAGAGAAGCAGTCTGG - Intronic
1119294947 14:73525495-73525517 GCAAGTTAAGAGAAAGAGGGTGG + Intronic
1120369103 14:83608770-83608792 CCAAGCAAAGAGAAGGATATAGG - Intergenic
1121581507 14:95035643-95035665 CCAAGGAAGGAGGAGGAGGCTGG + Intergenic
1122280938 14:100622102-100622124 CGAAGCAGAGAGAAGGAGCCTGG + Intergenic
1124078324 15:26467446-26467468 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1124345533 15:28919241-28919263 CCGAGTCAAGGGAAGGAGGCAGG + Intronic
1125126740 15:36232368-36232390 CCAAGAAAGAAGTAGGAGGCAGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125883677 15:43213221-43213243 CCAAGCAGAGAGGAGGAGGCTGG - Intronic
1127539750 15:59925353-59925375 CCAAAAAAAGAAAAGGAGGAGGG + Intergenic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1128360482 15:66958220-66958242 CCATTTTAAAAGAAGGAGGCTGG - Intergenic
1128877824 15:71216482-71216504 CCAGGTAAAGAGCATGTGGCTGG - Intronic
1128940923 15:71786992-71787014 CCAAGAAAAGAGAGAGAAGCGGG + Intergenic
1129272226 15:74424985-74425007 CCAAGTGGAGGGAGGGAGGCAGG + Intronic
1129668412 15:77592640-77592662 CCAAGTAAAGGCAGGGAGGGAGG + Intergenic
1129994055 15:79989596-79989618 CCAAACCAAGAGAAGGACGCTGG + Intergenic
1131298456 15:91173133-91173155 CCAAGTGCTGAGAAGGAGGGAGG + Intronic
1131550412 15:93352232-93352254 CAAAGAAAAGAGGAGAAGGCTGG - Intergenic
1132681415 16:1143985-1144007 CCACGTCCAGAGAAAGAGGCCGG + Intergenic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1134279577 16:12805651-12805673 CCAAGAAATGTGAAGGAGGCCGG + Intergenic
1135719594 16:24803932-24803954 ACTAGTAAACAGAAGGTGGCTGG - Intronic
1136385587 16:29923876-29923898 AAAAGTAAAGAAAAGAAGGCCGG + Intronic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137467754 16:48726383-48726405 CCAAGTAAAGAGAGGCTGTCTGG - Intergenic
1137601830 16:49761476-49761498 CCCAGTAAGGAGAACGACGCTGG + Intronic
1137754984 16:50894042-50894064 CCAAATAAAGTCAAGGAAGCTGG - Intergenic
1137832933 16:51561714-51561736 GCTACTAAAGAGAATGAGGCAGG - Intergenic
1137846836 16:51698102-51698124 CCAAGTGAAGGGAGGGAGGAGGG + Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1139297748 16:65917968-65917990 CCAAGTAAAGAGGAGGAGGCAGG + Intergenic
1139616451 16:68097107-68097129 GTAAGGAAAGGGAAGGAGGCAGG + Intronic
1140218277 16:73025312-73025334 CCAAGTTAAGAGAGGGGGCCCGG + Intronic
1140931794 16:79634751-79634773 ACAGGTAAAGAGAAGGATTCAGG + Intergenic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141259418 16:82439160-82439182 GAAAGAAGAGAGAAGGAGGCCGG - Intergenic
1141513560 16:84528010-84528032 CCAAGAAAAGAGAAGTGGGTTGG + Intronic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1142685888 17:1576750-1576772 CCAAGCAAAGCCCAGGAGGCAGG - Intronic
1143107606 17:4537372-4537394 GCAAGAAAAGGGAAGGAGGGAGG + Intronic
1143545788 17:7594422-7594444 CCATATAAAGAAAATGAGGCTGG - Intronic
1143921431 17:10333604-10333626 CCCAGCAAAGAAGAGGAGGCCGG + Intronic
1143926865 17:10378806-10378828 CCAAGTCACGAGAATGATGCAGG + Intergenic
1144085837 17:11807713-11807735 GCAGCTAAAGAGAAGGAAGCAGG - Exonic
1144165676 17:12608045-12608067 CCAAGGAGAGGGAAGGAGACGGG + Intergenic
1144672047 17:17138340-17138362 CCAGGTGGAGAGAAGGCGGCTGG + Intronic
1144728643 17:17514419-17514441 CCAAGAGCAGAGAAGGAGCCAGG + Intronic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1146421333 17:32688785-32688807 CCAAGTCAAGGGAGGGAGCCTGG + Intronic
1147131629 17:38413035-38413057 CCAATTTAAGAGACTGAGGCAGG + Intergenic
1147305667 17:39562473-39562495 CCAAGGAAAGGGAACAAGGCAGG - Intronic
1147371093 17:39993551-39993573 CCAAGTGATGGGAAGGAGGATGG - Intronic
1147379103 17:40042376-40042398 GCAACAAAAGAGAAAGAGGCCGG + Intronic
1147955085 17:44128642-44128664 CCAGGCAAAGAGAAGAAGGGAGG - Intergenic
1147976981 17:44253426-44253448 CCAAGTATGGAGAAGGAAGGAGG - Intronic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148777041 17:50101773-50101795 CCCAGGAATGAGAAGGAGGAGGG - Intronic
1149362913 17:55912760-55912782 ACAGCTAAAGAGAAGAAGGCAGG - Intergenic
1149666799 17:58370659-58370681 CCAAGTGATGGGAAGGAGGTGGG + Intronic
1149786756 17:59442205-59442227 CAAAGTAAAGATAAATAGGCTGG + Intergenic
1150440021 17:65183590-65183612 GCAAGAAAAGAGATGGAGCCGGG - Intronic
1150517918 17:65833900-65833922 CAAAGTAAAGAGAACAAAGCTGG + Intronic
1150786118 17:68164154-68164176 CAATGTAAAGAAAAGGTGGCCGG + Intergenic
1151393812 17:73805962-73805984 CCAGCCAAAGAGAAGGAGGTGGG + Intergenic
1152208070 17:78986830-78986852 GCAAGAGAAGAGAAGCAGGCAGG + Intergenic
1152599514 17:81254890-81254912 CTAAGTGAAGAAAGGGAGGCTGG + Intronic
1152715062 17:81895513-81895535 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152715081 17:81895592-81895614 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1153525486 18:5991092-5991114 CCAAGCAAAGAGAAGAGGGGTGG - Intronic
1153732809 18:8031860-8031882 CCAAGAAGAGAGAAGGAGCAAGG + Intronic
1154075176 18:11193213-11193235 CAAAGTAAAGGGAAGGGGCCAGG - Intergenic
1154121364 18:11655082-11655104 CCCAGTTTGGAGAAGGAGGCCGG + Intergenic
1155206722 18:23564617-23564639 TCAAGAAAAGACAAGAAGGCCGG - Intronic
1155716890 18:28954826-28954848 CTAAGTAAAGAGAACAAAGCTGG + Intergenic
1156223887 18:35082533-35082555 CCAAGCAAAGACAAGGAATCAGG - Intronic
1157546576 18:48550681-48550703 CCAAGGAATGATGAGGAGGCAGG - Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1159070748 18:63621076-63621098 CCAAGTGAAGAGCACCAGGCTGG + Intergenic
1159893936 18:73979016-73979038 CCAAGTAAAGGGGTGGAGGATGG + Intergenic
1162548124 19:11343243-11343265 TCAAGGAAAGAGGGGGAGGCAGG - Intronic
1162583388 19:11544368-11544390 TCAAGAAACAAGAAGGAGGCTGG + Intronic
1163571612 19:18085368-18085390 CCAGGGAAAGGGAAGGAGGATGG - Intronic
1166863647 19:45823536-45823558 CCCAGGAAAGAGAAGCAGGCAGG + Intronic
1167110755 19:47459332-47459354 ACAAGAAAAGAGAGGGAGCCAGG - Intronic
1168182354 19:54670975-54670997 CCATGGAAAGAGGAGGAGGAAGG + Intronic
1168224010 19:54981535-54981557 CCAATTAGAGAAAAGGAGGCAGG - Intronic
925180601 2:1814647-1814669 CCCATAAAAGAGAAAGAGGCTGG - Intronic
925983479 2:9195833-9195855 TCAAGGTAAGAGAAGGTGGCAGG + Intergenic
926163103 2:10501869-10501891 CCCAGTGGAGGGAAGGAGGCTGG - Intergenic
927287911 2:21376197-21376219 AGAAGTTCAGAGAAGGAGGCCGG + Intergenic
928233653 2:29521634-29521656 CCAAGTAATGAGAAAGAAGGAGG + Intronic
929520383 2:42644869-42644891 CCCAGGAGAGAGAAAGAGGCAGG - Intronic
930307624 2:49695104-49695126 ACTAGTAAAGAGAAGGAGGCAGG - Intergenic
930443146 2:51434605-51434627 AAAAGTAAAGGGATGGAGGCTGG + Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
933504452 2:83160208-83160230 TCAAATAAAGACAATGAGGCTGG + Intergenic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936949340 2:117962345-117962367 CCAATTAAGGACAAGTAGGCTGG + Intronic
937132308 2:119523081-119523103 CTAAGGGAAGACAAGGAGGCTGG + Intronic
937153319 2:119701030-119701052 CCAAGGACAGAGCTGGAGGCAGG + Intergenic
937719413 2:125076315-125076337 CCAAGTAAAGAGGAGGTGAGAGG - Intergenic
938066353 2:128283958-128283980 CCAGGTCAAGAAATGGAGGCTGG + Intronic
938313282 2:130308786-130308808 AGAAGGAAAGAGAAGGAGGAGGG + Intergenic
938752818 2:134350632-134350654 CCAAGTAAACAGAAAGCAGCAGG - Intronic
939673096 2:145037983-145038005 CTAACCAAAGAGAAGGACGCAGG - Intergenic
939786828 2:146524903-146524925 ACAAATAAATAGAAGTAGGCGGG - Intergenic
940858802 2:158751368-158751390 CCATGTAAAGAGAGAGAGACAGG - Intergenic
941450907 2:165658995-165659017 TGAAGTAACGTGAAGGAGGCAGG + Intronic
941790407 2:169546625-169546647 CCAAGTGAGGAGAAGGGAGCAGG + Exonic
942081503 2:172403490-172403512 TGAAGTAAACAGAAGGAAGCTGG + Intergenic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942846935 2:180438092-180438114 CTAAGGAAAGAAAAGGAGGTAGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944540844 2:200752090-200752112 CCAAACAAAGAGATGGAGGAAGG - Intergenic
944592786 2:201233690-201233712 CCACGTGAAAAGATGGAGGCTGG + Intronic
946394561 2:219436608-219436630 CCAAGTCAGGAGAGGGAGCCGGG + Intronic
947055509 2:226096330-226096352 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
948379102 2:237540780-237540802 CCTAGGAAAGAGAAGGACGGAGG - Exonic
1170326053 20:15155470-15155492 TCAAGTAAAGAGTAGCAGGGTGG - Intronic
1170591151 20:17772995-17773017 TTAAGTAAATAGATGGAGGCCGG + Intergenic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1173017092 20:39235543-39235565 CCAAATACGGACAAGGAGGCGGG - Intergenic
1173542650 20:43866367-43866389 CCAAGTGAAGAAAAGCATGCTGG - Intergenic
1173903800 20:46611037-46611059 CCAAGCAAAGGCAGGGAGGCAGG - Intronic
1174102617 20:48138858-48138880 CCAAGTAAAGGAATGGATGCTGG - Intergenic
1174402693 20:50284374-50284396 CCAAGCAAAGGGAAGGGCGCAGG - Intergenic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174608781 20:51781713-51781735 CCAAGTAAGGAGGCTGAGGCAGG + Intergenic
1174673181 20:52327527-52327549 CCAAGGAAAGGGAAAGAGGTGGG - Intergenic
1175074959 20:56364419-56364441 ATAAGTGAAGAGAGGGAGGCAGG - Intronic
1176365854 21:6032381-6032403 CTAAGTCACGAGCAGGAGGCAGG + Intergenic
1177298470 21:19208143-19208165 CCAAGTAAAGAGAGAAAGACAGG + Intergenic
1177480561 21:21681650-21681672 CAAAGTAAAGGGATGGAGACAGG - Intergenic
1177540410 21:22485571-22485593 TGAAGAAAAGAAAAGGAGGCTGG - Intergenic
1178781090 21:35604018-35604040 ACAAGCAAAGAGAAAGAAGCTGG + Intronic
1179757662 21:43506164-43506186 CTAAGTCACGAGCAGGAGGCAGG - Intergenic
1181887209 22:26030797-26030819 CCAAGTGAAGAGGAGGAGGAAGG - Exonic
1182012818 22:27014782-27014804 CCAAATAAAGAGAAGACAGCAGG - Intergenic
1182511984 22:30826404-30826426 CCAAGTAGGCAGAGGGAGGCTGG - Intronic
1182677796 22:32053420-32053442 CCAAAAAAAGAGAAGGATGAAGG - Intronic
1183020125 22:35020249-35020271 GCAATTAAAGACATGGAGGCTGG - Intergenic
1183691707 22:39393563-39393585 TAAAGAAAAGAAAAGGAGGCTGG - Intergenic
1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG + Intronic
1184913294 22:47550260-47550282 GGAAGGAAAGAGAAGGAGCCGGG - Intergenic
949566580 3:5250996-5251018 CCAAGTAAAGAGAAAGCCCCAGG + Intergenic
950405246 3:12800203-12800225 GCTAGGAGAGAGAAGGAGGCTGG - Intronic
950916623 3:16652482-16652504 CCAAGTAAAAACAATGAAGCAGG + Intronic
951860054 3:27242108-27242130 CCATGTAAGGCCAAGGAGGCAGG + Intronic
952195908 3:31075152-31075174 CCTAGTAAAGAGATGGTGGGGGG + Intergenic
952767693 3:36969365-36969387 CTAATGAAAGAAAAGGAGGCTGG + Intergenic
953813547 3:46134419-46134441 CCAAGAAAATAGAAGGTGTCAGG + Intergenic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955644935 3:61126974-61126996 CCAAGAAAAAAGCAGGAGGAAGG + Intronic
957780004 3:84806811-84806833 CCAGGGACAGAAAAGGAGGCAGG + Intergenic
957829701 3:85500811-85500833 TCAAGTAAAAAGTAGCAGGCTGG - Intronic
959111327 3:102126378-102126400 ATAAGTAAAGAGGAGGAGACAGG - Intronic
959313953 3:104778218-104778240 CCAAATAAAGAGAAAGAGTATGG - Intergenic
959454401 3:106541049-106541071 ACAGATAAAGAGAAGGAAGCAGG - Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959560798 3:107778462-107778484 CCAAGAAAAAAGAAGAAGACTGG + Exonic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
960739102 3:120813143-120813165 CCATGTGATGAGAAGGAGGGAGG - Intergenic
961343300 3:126244864-126244886 CCCAGTGATGAGATGGAGGCTGG - Intergenic
961702541 3:128757631-128757653 CCCAGTTAGGAGAATGAGGCAGG - Intronic
962159605 3:132985098-132985120 CCAGGTTATGAGAAAGAGGCAGG + Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
964710003 3:159661767-159661789 CCAAGGGAGGAAAAGGAGGCTGG + Intronic
965994478 3:174862938-174862960 CCAAGTACAGAGGAGTTGGCTGG + Intronic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
967878462 3:194282288-194282310 TCATGGGAAGAGAAGGAGGCAGG + Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968139685 3:196245700-196245722 CAAAGTAAAGAATAGGAGGCCGG + Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968571635 4:1345322-1345344 CCAAGCGAACAGAAGGATGCAGG + Intergenic
969289925 4:6232120-6232142 CCAAATAAGGAGAAGGCCGCAGG - Intergenic
972289587 4:37679002-37679024 TCAAGTAAAGAGAAGAAGCCGGG + Intronic
972336478 4:38111233-38111255 CCAAGTAAAGAGGGAGAGGCAGG - Intronic
972846540 4:42998097-42998119 CCAAATAAAGGGACTGAGGCTGG + Intronic
973088796 4:46105146-46105168 ACAAACAAAGAGAAGGAAGCTGG + Intronic
974092095 4:57322104-57322126 CCAAGAAAGGAGAAAGAAGCTGG - Intergenic
975960162 4:79893322-79893344 CCAAGTAAAGACAGGAAGACAGG - Intergenic
977434978 4:96982893-96982915 CCAAGAAGAGAGAAAGAGACAGG + Intergenic
978382372 4:108143206-108143228 CCCAGTAAACTGAAGTAGGCAGG - Intronic
978614052 4:110575961-110575983 ACAAAAAAAGAAAAGGAGGCTGG + Intergenic
978937114 4:114391085-114391107 CCAAGGAAAGAGACGGAGAATGG - Intergenic
981786597 4:148486609-148486631 TAAAGGAAAGAGAAGGAGACAGG - Intergenic
982336777 4:154248636-154248658 CTAAGTAAAAAGAAGAAAGCCGG + Intronic
982411224 4:155079810-155079832 GCAGGTCAAGAGATGGAGGCAGG + Intergenic
982771573 4:159401550-159401572 GCAAGAAAAGAGAAGCAGGCGGG - Intergenic
983631561 4:169854444-169854466 CTCAGTAATGAGAAGGCGGCAGG + Intergenic
983671408 4:170241850-170241872 CCAAGGAAATAGAAGGAGGCTGG - Intergenic
983922120 4:173357382-173357404 CCAAGGAGAGAGGAGGAGACTGG - Intergenic
985945823 5:3182171-3182193 CCAAATAAAGAAAATGAGGGTGG + Intergenic
986417902 5:7546834-7546856 CCAAGGAAGAAGAAGGAGCCAGG - Intronic
986802314 5:11274819-11274841 CCAAGGAAAAAGAGTGAGGCAGG + Intronic
988632921 5:32950412-32950434 CCTAGTAATGTGAAGGAGGACGG + Intergenic
990253539 5:53941993-53942015 CCATGTAAAGAGTATGGGGCGGG + Intronic
990613770 5:57486216-57486238 CCAAGTGAAGACAGAGAGGCAGG - Intergenic
991230004 5:64321714-64321736 CTAAGCAAAAAGAAGAAGGCTGG + Intronic
992327452 5:75674957-75674979 TCAAGTAGAGAGAAGGAAGTTGG - Intronic
992532725 5:77667783-77667805 CCAAATCAAGAGAATGAGGCAGG + Intergenic
993420287 5:87693139-87693161 CCAAGCAAAAAGAACAAGGCTGG - Intergenic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993791315 5:92215057-92215079 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
993989942 5:94643793-94643815 CCAAGTAAGGAGGAGGATGTAGG - Intronic
995104178 5:108354531-108354553 CCAAGAAAAGAGAGAGAGACAGG + Intronic
995133390 5:108654534-108654556 CCAAGAAGAGATAAGGAAGCTGG + Intergenic
995600457 5:113790168-113790190 CCAAGCAAAGAGAATGGGGCTGG + Intergenic
996215812 5:120864078-120864100 CCAAGTTCAGAGAAGGTGGCTGG - Intergenic
997427261 5:133811887-133811909 CCAAGTGAAGACAAGGAGGAGGG - Intergenic
998987815 5:147781554-147781576 CCAATTAAAAATAAAGAGGCAGG + Intronic
999416717 5:151404270-151404292 CAAAGTAAAGAGATGGAGAAAGG - Intergenic
999585275 5:153082780-153082802 AAAAGTAAAGAGAATGAGACTGG + Intergenic
1000617023 5:163438085-163438107 CCAACTAAAGACAGGAAGGCAGG - Intronic
1000981542 5:167821901-167821923 CCAAGCAGAGAGAAGTACGCGGG - Intronic
1001148814 5:169208484-169208506 CCAAGCAAAGAGAACAAAGCTGG + Intronic
1002437453 5:179240383-179240405 GCAGTTTAAGAGAAGGAGGCTGG + Intronic
1002701798 5:181129931-181129953 CCAAGGAAAGAGAGAGAGGTGGG + Intergenic
1003147410 6:3520362-3520384 CCAAGGAAAGGGAAGAAGGAAGG - Intergenic
1003166725 6:3685956-3685978 CCAAGTAAAAGAAAGGAGACAGG + Intergenic
1003628240 6:7763512-7763534 CCCATTAAAAAGAAAGAGGCTGG + Intronic
1005309397 6:24544942-24544964 CCAAGGACAGAAAAGGAGGAGGG + Exonic
1005480123 6:26247667-26247689 CCAGCTAAAGAGAAGTAGCCTGG + Intergenic
1005572310 6:27157250-27157272 CCAGGTAAAGAGAAGAGGCCGGG + Intergenic
1005847225 6:29791771-29791793 ACAGGTAAGGAGTAGGAGGCAGG + Intergenic
1006419032 6:33921976-33921998 CCCAGTCAAGAGAAAGAGGAAGG + Intergenic
1007293092 6:40801801-40801823 CTAAGTGAAGAGAGGGTGGCAGG + Intergenic
1007820882 6:44559822-44559844 ACAAGTTCAGAGAGGGAGGCAGG - Intergenic
1008422185 6:51314257-51314279 CCAAATGCAGAGAAGGAGACTGG + Intergenic
1008637565 6:53425983-53426005 CCACATAAAAGGAAGGAGGCTGG + Intergenic
1008979838 6:57470458-57470480 CCAAAAAAAGAGAGGGAGACGGG - Intronic
1009037770 6:58138729-58138751 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009213557 6:60892367-60892389 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1010258928 6:73793167-73793189 CCAAGAAAACAGAGGGAGCCAGG + Intronic
1011666436 6:89638975-89638997 CAAATGAAAGTGAAGGAGGCCGG + Intergenic
1011771914 6:90682786-90682808 CCAGGTAAGGAGAAGGCAGCTGG + Intergenic
1012375943 6:98561571-98561593 CCAGGTAGAGAGATGGAGGGAGG - Intergenic
1012418798 6:99038789-99038811 CCAAGTTCAAAGAATGAGGCAGG - Intergenic
1012596520 6:101047615-101047637 CCAAGCAATAAGAACGAGGCTGG - Intergenic
1012812312 6:103975321-103975343 TCAAGTAAATAGAAGTAGACTGG + Intergenic
1013618247 6:111864729-111864751 CAAAGCAAAGGCAAGGAGGCAGG + Intronic
1013854443 6:114554970-114554992 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
1015046893 6:128787072-128787094 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015405810 6:132835783-132835805 CTAAGTAAAGTGAGGGAGGGAGG - Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016331233 6:142954099-142954121 CCAGGAAAAGATAAGAAGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017965876 6:159265597-159265619 ACAAAGAAAGAGAAGGAGGGCGG + Intronic
1018711415 6:166500424-166500446 CCAGGGAGTGAGAAGGAGGCAGG + Intronic
1018768223 6:166950791-166950813 CCAAGCACAGCAAAGGAGGCAGG + Intronic
1019033897 6:169038208-169038230 CTAAGTAAAAAGAACGATGCTGG + Intergenic
1019819179 7:3228196-3228218 CCAAGTAACCACAAGAAGGCAGG - Intergenic
1020560202 7:9721549-9721571 TCAAGAAGAGAGAAGGAGACAGG - Intergenic
1020580422 7:9992193-9992215 CCAGATTTAGAGAAGGAGGCAGG + Intergenic
1021441583 7:20682973-20682995 CCAGGTCAAGAGAAGAAAGCTGG - Intronic
1021791271 7:24208241-24208263 CCAACCAAAGTGAAGGAGACTGG + Intergenic
1022162628 7:27726936-27726958 CCAAAAAAAGAGAGGGAGGCAGG + Intergenic
1022381787 7:29867212-29867234 CTAAGTAGAGAGAAGGAGCCGGG + Intronic
1023435954 7:40140792-40140814 CCAAGTAAAAAGAACAAAGCTGG - Intronic
1023516712 7:41008783-41008805 CCCAGTCAAGAGAAGAGGGCAGG - Intergenic
1024106346 7:46091250-46091272 CCAAGTAAAAAGAATAAAGCTGG - Intergenic
1024150144 7:46563190-46563212 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1024423994 7:49204613-49204635 ACAAGCAAAGCAAAGGAGGCAGG - Intergenic
1026073110 7:67140305-67140327 TCAAGGAAAGAATAGGAGGCTGG - Intronic
1026703775 7:72671909-72671931 TCAAGGAAAGAATAGGAGGCTGG + Intronic
1028051536 7:86193942-86193964 AGAAGTGAAGAGAAGGAGGGAGG + Intergenic
1029253183 7:99251248-99251270 CCAGGTAAAGAAATGGAGGCTGG + Intergenic
1032467304 7:132154076-132154098 CCAAGGTAAGAAAAGGTGGCAGG - Intronic
1035482002 7:159194369-159194391 CCAAGTAAACAGAAAGAGGTCGG + Intergenic
1035483590 7:159205465-159205487 CCAAGGAAAGCAAAGGAGGAAGG + Intergenic
1035905817 8:3509064-3509086 CCAGGTAAAGAGGAGGAAACTGG - Intronic
1036413585 8:8526179-8526201 GCAAGTAAAGAGAAAGAACCTGG - Intergenic
1036437261 8:8746009-8746031 AAAAGTAAAGTGAAAGAGGCTGG + Intergenic
1037615845 8:20518420-20518442 CCCTGTGAAAAGAAGGAGGCAGG + Intergenic
1037887559 8:22602795-22602817 CCATTTACAGATAAGGAGGCAGG + Intronic
1038579894 8:28738890-28738912 GCAGACAAAGAGAAGGAGGCAGG - Intronic
1040108048 8:43551077-43551099 CCAAGAAAAAAAAAGCAGGCAGG - Intergenic
1040963283 8:53058250-53058272 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic
1041093087 8:54321989-54322011 CTAACTAAAAAGAAGGAGGGAGG + Intergenic
1042082246 8:65067515-65067537 CTAAGTAAAAAGAAGATGGCTGG - Intergenic
1042112242 8:65392884-65392906 ACATGTAAAGAATAGGAGGCCGG + Intergenic
1043387626 8:79764150-79764172 TAAATCAAAGAGAAGGAGGCAGG + Exonic
1044062747 8:87659738-87659760 CCAACTAAAGAGAAGGCGAGGGG + Intergenic
1044180571 8:89188713-89188735 CCAAGTAAAGAGTTGGAAGGAGG + Intergenic
1044315420 8:90745020-90745042 CTAAGCAAAAAGAAAGAGGCTGG - Intronic
1044550023 8:93501562-93501584 GCAAGAAAACAGAAGGAGGAAGG - Intergenic
1045216487 8:100154202-100154224 CCAAGCAAAGTGAATGAAGCAGG + Intergenic
1045272951 8:100677445-100677467 ACAACAAAAGAGAAGAAGGCCGG - Intergenic
1045280602 8:100746528-100746550 TCAGGTAAAGAGAGGTAGGCAGG + Intergenic
1045706881 8:104934205-104934227 ACAAATAAAGAGAGGGAGGGAGG + Intronic
1046789711 8:118307911-118307933 CCACCTACAGTGAAGGAGGCCGG - Intronic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1049434361 8:142579609-142579631 CCCAGTACTGGGAAGGAGGCAGG - Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1051680051 9:19597939-19597961 CTATGTAAACAGCAGGAGGCAGG + Intronic
1052598880 9:30598905-30598927 ACAAGTAAAGAGTAGGATGGTGG - Intergenic
1055353011 9:75408677-75408699 CCAAGAAGAATGAAGGAGGCAGG - Intergenic
1056847374 9:90052421-90052443 AAAAGTGAAGAGAAGAAGGCAGG - Intergenic
1058530584 9:105901710-105901732 CTCAGGAAAGAGAGGGAGGCAGG - Intergenic
1058813483 9:108663186-108663208 CCAAATCCAGCGAAGGAGGCAGG + Intergenic
1059978578 9:119744407-119744429 CCAGGTAAAAAGGAGGGGGCAGG + Intergenic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1062395619 9:136351460-136351482 CCAAGGAAGGAGTGGGAGGCTGG + Intronic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1186957152 X:14696157-14696179 CCAAGAAAGGAGAAGAAGGGAGG + Intronic
1187047313 X:15660021-15660043 GCAACTAAAGAGAAGCAGGAAGG + Intronic
1187134918 X:16538830-16538852 ACAAGATAAGAGAAGGAGGCAGG + Intergenic
1187800405 X:23056039-23056061 CCAAGGAAAGAGAAAGAGATGGG - Intergenic
1188284860 X:28315217-28315239 CCAAGGAAGGAGAGGGAAGCAGG + Intergenic
1189353326 X:40293599-40293621 CCAGGAAAAGAGAAGGGGGTCGG + Intergenic
1189367642 X:40401387-40401409 TCAAGGAAATAGAAGGAGTCTGG - Intergenic
1189657078 X:43255739-43255761 CCAATGAAAGAGAAGGGGCCAGG - Intergenic
1189848853 X:45159506-45159528 CCCAGTAAAGATAAGGGTGCAGG - Intronic
1190771023 X:53514107-53514129 TCAAGGAAAGAGAAAGAGGGAGG + Intergenic
1191123056 X:56926024-56926046 CCTAGTAAAGAGTAGGGGGTGGG + Intergenic
1191651747 X:63546034-63546056 CCAAGCAAAAAGAACAAGGCTGG + Intergenic
1191654265 X:63578691-63578713 ACAACTAGAGAGAAGGGGGCAGG + Intergenic
1192722319 X:73712055-73712077 TCAACTAAAGGGAAGGAGGATGG + Intergenic
1192849428 X:74938988-74939010 CTAAGTAAAAAGAACGAAGCTGG - Intergenic
1193639050 X:83989235-83989257 CCAAGCAAAGAGAACAAAGCTGG + Intergenic
1195318214 X:103699376-103699398 GGGAGTATAGAGAAGGAGGCAGG + Intergenic
1195537274 X:106023175-106023197 CCAAGGAAGGTAAAGGAGGCAGG - Intergenic
1195556569 X:106233630-106233652 TCAAGTCCAGAGAAGGAGACTGG + Intergenic
1195745024 X:108108319-108108341 ACAGGTAAATAGAAGGAGGCAGG - Intronic
1195920428 X:109977999-109978021 CCCTGTACAGAGATGGAGGCAGG - Intergenic
1196528473 X:116755115-116755137 CAAAGTAAAGAGTATGAGGAAGG + Intergenic
1197276886 X:124489855-124489877 CCAAGGAAAGAGGAGCAGGAAGG - Intronic
1198147346 X:133870646-133870668 TCAAGTGAAGAGAAAGAGGCAGG - Intronic
1198283485 X:135166934-135166956 CGAAGCAAATTGAAGGAGGCAGG + Intronic
1198502054 X:137260026-137260048 CCCAGTGAAGACAAGTAGGCTGG - Intergenic
1199060223 X:143347121-143347143 TCACGTATAGAAAAGGAGGCAGG + Intergenic
1199101083 X:143801321-143801343 AGAAGAAAAGAGAAGAAGGCTGG + Intergenic
1199118996 X:144028863-144028885 TCAAGTGAACAGAAGAAGGCAGG + Intergenic
1199599906 X:149535681-149535703 GCAAGTAAGGAGGAGGAGGGGGG - Intergenic
1199650728 X:149944567-149944589 GCAAGTAAGGAGGAGGAGGGGGG + Intergenic
1200394033 X:155972620-155972642 GCAAGTAAAAAAAAGGAGGATGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200428526 Y:3048775-3048797 CTAAGTAAAGAGAACAAAGCTGG - Intergenic
1201566747 Y:15373162-15373184 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic