ID: 1101129167

View in Genome Browser
Species Human (GRCh38)
Location 12:101671402-101671424
Sequence CTCCCATGAAACCAAACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101129167 Original CRISPR CTCCCATGAAACCAAACTAA AGG Intronic
905677443 1:39837636-39837658 CTTCCATGATACCAATCTAGTGG + Intergenic
909312796 1:74174922-74174944 CTACCATCAAAGGAAACTAAAGG - Intronic
910486265 1:87717817-87717839 CCTCCAAGAAACCAAACCAAGGG + Intergenic
910979136 1:92941568-92941590 CTACCAGGACACCAAACAAAGGG - Intronic
912422969 1:109558810-109558832 CTGCCATAAAACTAAACTAAAGG - Intronic
914968164 1:152279821-152279843 CTCACATGAACCTAAAGTAAAGG + Intergenic
915254991 1:154620870-154620892 CTCCCATGAAAAAAATCTTAGGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
918530492 1:185515075-185515097 CTCCCATGAATTCAAGGTAAGGG + Intergenic
918842617 1:189561922-189561944 CTCTCATGAAACAACACAAAGGG + Intergenic
922221642 1:223612915-223612937 AGCTCATGAAACCAAATTAAGGG - Intronic
922977731 1:229799218-229799240 TTCCCATGAAACCAAATGAGGGG + Intergenic
1063876310 10:10482967-10482989 TTCCCATGAAAACACAATAAAGG + Intergenic
1063935092 10:11069258-11069280 CTCCCATGATAGCAAAGAAAAGG + Intronic
1064389206 10:14926983-14927005 CTAGCATGAAACCACTCTAATGG + Intronic
1068142467 10:53025629-53025651 CGCCCCTGAAACTAAAATAAAGG - Intergenic
1069938187 10:71934010-71934032 CTCACCAGGAACCAAACTAATGG - Intergenic
1070011959 10:72484105-72484127 CTCCCATGAAACTGTACTACAGG + Intronic
1073383522 10:103101165-103101187 CTCCCTTGAATACAGACTAATGG + Intronic
1079217657 11:18528117-18528139 CTCCAGTCAAACCAAACTAGAGG + Intergenic
1081134909 11:39428617-39428639 CTCTCATGAAGCCAAAATCAAGG + Intergenic
1081192416 11:40120002-40120024 TTCCCATAAAACCACAATAAAGG + Intronic
1085806766 11:79643568-79643590 CTCCCATGAAGCCACACAAAGGG - Intergenic
1086450345 11:86909348-86909370 CTCCCCTGAACCCAATCCAAGGG + Intronic
1086609228 11:88734198-88734220 CTCCAAAGAAAGCACACTAATGG + Intronic
1088486508 11:110345843-110345865 CTCTCAAGAAAACAACCTAAGGG - Intergenic
1091484778 12:875101-875123 CTCTAGTTAAACCAAACTAAAGG - Intronic
1092664091 12:10774891-10774913 CTCCTATTAAAGGAAACTAAGGG + Intergenic
1095641025 12:44484785-44484807 CTCCCATGACACAAAATTATGGG + Intergenic
1098221231 12:68271961-68271983 GTCACAGGAAACCAAAATAATGG + Intergenic
1098310636 12:69145609-69145631 CTCCAAGGAAACCAAAATCATGG + Intergenic
1098543733 12:71687804-71687826 CTCCTATGAAAACAAAATACTGG + Intronic
1101129167 12:101671402-101671424 CTCCCATGAAACCAAACTAAAGG + Intronic
1104448142 12:128849208-128849230 CTCCAAGGAAACAGAACTAATGG - Intergenic
1106061474 13:26297006-26297028 CTCCAATGAAACATTACTAACGG - Intronic
1106785750 13:33106620-33106642 CACCTATGAAAGCACACTAATGG + Intronic
1108474696 13:50802157-50802179 TTCCCAGAAAACTAAACTAATGG - Intronic
1114676877 14:24447250-24447272 ATCCTGTGAAACCAAACCAAGGG - Intergenic
1116527918 14:45929861-45929883 GTCCCATGAAAACTAACCAAAGG - Intergenic
1116939553 14:50777284-50777306 CTCCCATGAAACAGAATCAATGG + Intronic
1117780665 14:59228409-59228431 CTTCCAAGAAAAAAAACTAAAGG + Intronic
1118600374 14:67467836-67467858 CTCCCATAAAACAGAAATAATGG + Intronic
1120191680 14:81445756-81445778 CTGCCCTTAAACCAAACAAATGG + Intergenic
1121139889 14:91532121-91532143 CACCCATGAAACCAAATGGAGGG + Intergenic
1125267427 15:37899292-37899314 CTACCAAGAAACCAGAATAAAGG + Intergenic
1126267279 15:46769240-46769262 TTCCAATGAAACCAAAATCATGG - Intergenic
1127137474 15:55939559-55939581 CTCCAAAGAAAACAAACAAATGG + Intronic
1131707893 15:95018201-95018223 CTCTGATGAAACGAAAGTAAAGG + Intergenic
1135962148 16:27004356-27004378 CTCCAATGAAGAAAAACTAAGGG + Intergenic
1139068552 16:63350840-63350862 GTACAATGAAACCAAACTAGCGG + Intergenic
1140650579 16:77083747-77083769 CTCCCATGAGACCCAACCGAAGG - Intergenic
1140658919 16:77168477-77168499 TCCCCATGAAACCAAAATGATGG - Intergenic
1143368238 17:6422314-6422336 CTCCCTGAAAACCAACCTAAAGG - Intronic
1143934098 17:10464019-10464041 ATCCCCTGAATCCAAAATAAAGG - Intronic
1144278115 17:13696641-13696663 CTCACATGAAACCAAAAAAGAGG + Intergenic
1150329038 17:64279847-64279869 CTCCCATCAAACAAAAGTTAAGG - Intergenic
1150544057 17:66135159-66135181 CTCCAATGAAGCCCAAGTAATGG + Intronic
1151131534 17:71902409-71902431 CTCACAAGAAACCAAAAAAATGG + Intergenic
1151667085 17:75551152-75551174 CTCCCCTAAAACCAAAATAAGGG - Intronic
1156486756 18:37471369-37471391 CTCCCAAGAACCCAAAGGAAAGG + Intronic
1158685650 18:59611802-59611824 CATTCATGACACCAAACTAAAGG + Intronic
1163176810 19:15569958-15569980 CTCCCATGAACTCAAATTCAGGG + Intergenic
1168415788 19:56167317-56167339 TTACCATGAACCCAAATTAAGGG - Intergenic
926559309 2:14398434-14398456 CACCAATTAAACCCAACTAAAGG + Intergenic
930849962 2:55950194-55950216 CTCCCATGAAACTAAAAGGAGGG - Intergenic
932662921 2:73672659-73672681 CTGCAGTGAAACCAAACTCAAGG + Intergenic
937103230 2:119287662-119287684 CTGCCATGAAAAAAAACTCAAGG - Intergenic
940100574 2:150033833-150033855 CTCCTATGAAATTAAACTATAGG - Intergenic
942359310 2:175155288-175155310 CTTCCATGGAACAAAACAAATGG + Intronic
942496316 2:176543331-176543353 CTCCCAGGAAACCAAAGCTATGG + Intergenic
946162507 2:217844358-217844380 CCCCCATGAAACCACAGGAATGG + Intronic
947202499 2:227627143-227627165 CTCCCAGGAAAACAAACTCAGGG + Intronic
947680702 2:232029722-232029744 CCCCCAAGAAAACAAACTGAGGG - Intronic
1169576414 20:6967027-6967049 GACCCAAGATACCAAACTAAAGG + Intergenic
1176695367 21:9971310-9971332 CTCCCAGGGAACCAAACATAAGG + Intergenic
1179299899 21:40098303-40098325 ATTACATGAAACAAAACTAATGG + Intronic
949903286 3:8837677-8837699 TTCCCAGGAAACCAAAATAGAGG - Intronic
956067994 3:65417442-65417464 TTCACATGGAACCAAAGTAAGGG + Intronic
958533099 3:95360538-95360560 TACCCATAAAACCAAACTACTGG + Intergenic
960023348 3:112980465-112980487 TTCCCAAGAAACCAAATTAATGG + Intergenic
961561842 3:127735760-127735782 CTCCTCTGAAACCATACAAAGGG - Intronic
962079620 3:132123841-132123863 CTCTCATTAAACCAATATAATGG - Intronic
964917363 3:161853779-161853801 CTCCCCTGAAACTAAAGTAGAGG - Intergenic
970843506 4:20506065-20506087 CACACATGAAACCAAAGCAATGG - Intronic
971538020 4:27779241-27779263 ATTCCATGAAAAGAAACTAAAGG + Intergenic
971886575 4:32457045-32457067 CTTCCAGGGAACCAAACAAAAGG + Intergenic
981143058 4:141292861-141292883 CACCCATAAAATCAAACAAATGG - Intergenic
981432869 4:144682348-144682370 TTCCCATGAAAACAAAGTGAAGG + Intronic
981811800 4:148783886-148783908 ATCAAATGAAACCAAAATAAGGG + Intergenic
981953696 4:150443973-150443995 CTCCCATGAAAGGATTCTAATGG - Intronic
982374047 4:154668165-154668187 CTATCAGGAACCCAAACTAAGGG + Intronic
983726706 4:170937916-170937938 CTCCCATTCAACCAAAACAAAGG - Intergenic
983880721 4:172929424-172929446 CTCCAGAGAAACCAAACCAAGGG + Intronic
984289651 4:177779769-177779791 CTCTCATAAAACAAATCTAAAGG - Intronic
984524945 4:180847683-180847705 CTCCAATTAAAACAATCTAAAGG + Intergenic
990766636 5:59191182-59191204 CTCCAAGGAAAAAAAACTAATGG - Intronic
996429692 5:123359617-123359639 GTCCCATGATATCAAACTTAAGG + Intronic
998473720 5:142403539-142403561 CACCCATGAAACAAAGGTAATGG - Intergenic
1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG + Intronic
1009667155 6:66697962-66697984 GTCACATTAAAACAAACTAATGG + Intergenic
1009909073 6:69903999-69904021 CTCCCATCAAGGCAAACTGATGG + Intronic
1010163507 6:72888024-72888046 CTACCAAGAAAACAAACCAAAGG + Intronic
1015440809 6:133243181-133243203 CAGCCAGGAAAGCAAACTAATGG - Intronic
1018544056 6:164916105-164916127 CTCCCATGAATTCTAACTATAGG + Intergenic
1020995943 7:15264348-15264370 CTGCAATAAAACCAAAGTAATGG + Intronic
1021560212 7:21961998-21962020 CTACCATGAAACAACATTAATGG + Intergenic
1022653250 7:32296031-32296053 ATAGCATGAAACAAAACTAAGGG + Intronic
1023656996 7:42433507-42433529 ATCACATGGAGCCAAACTAAAGG + Intergenic
1024443729 7:49453103-49453125 CTCCCATGAAAGGCAACTATTGG + Intergenic
1030137198 7:106266033-106266055 CTTCCATCCAACCAAACAAAAGG - Intronic
1030690782 7:112530556-112530578 CTCCCCTGAAGCCATAATAAGGG - Intergenic
1038321187 8:26528806-26528828 CTTCCCTGAAACCACAATAAAGG - Intronic
1038729907 8:30117467-30117489 GTACAATGAAACCAAACTGAAGG + Intronic
1039287718 8:36060962-36060984 CTGCCATGATACCTAACTGATGG - Intergenic
1039562411 8:38523270-38523292 CTCCCATGAAAAAAAAAAAATGG - Intronic
1041816854 8:61982992-61983014 CTCCAAAGAAACAGAACTAAAGG + Intergenic
1043404348 8:79915505-79915527 CTCTTATGACACCAATCTAAAGG - Intergenic
1043930621 8:86086937-86086959 TTCCCATGAAACTAATCTACTGG - Intronic
1045987250 8:108262951-108262973 CTCCCAGGAATCCAAAATCAAGG + Intronic
1046471188 8:114676395-114676417 CTCCCATGAAAATAAACCAAAGG + Intergenic
1047704785 8:127487177-127487199 CTCCGATGAAGTAAAACTAAGGG - Intergenic
1047870577 8:129077499-129077521 CTCCCAGACAACCAAGCTAATGG - Intergenic
1048062496 8:130934921-130934943 CTCCCATAAAGCCAAAAAAATGG - Intronic
1050647735 9:7739720-7739742 CTCCTATGAAATCACAGTAAGGG + Intergenic
1052046029 9:23795036-23795058 CTGCTATCAAAACAAACTAAAGG + Intronic
1052820852 9:33137067-33137089 CTCAGAAGAAAACAAACTAATGG - Intronic
1053632348 9:39957262-39957284 CTCCCAGGGAACCAAACATAAGG + Intergenic
1053773412 9:41506269-41506291 CTCCCAGGGAACCAAACATAAGG - Intergenic
1054211540 9:62293435-62293457 CTCCCAGGGAACCAAACATAAGG - Intergenic
1054313444 9:63555412-63555434 CTCCCAGGGAACCAAACATAAGG + Intergenic
1055950749 9:81727675-81727697 ATCCCATGAAACCACAATATAGG - Intergenic
1055990384 9:82099862-82099884 CTCACATGTAACAAAACTATAGG - Intergenic
1056572835 9:87830828-87830850 ATCCCTTGAAACCACACTACAGG + Intergenic
1056686998 9:88775099-88775121 CTCCCATGTAGACACACTAAAGG - Intergenic
1058402931 9:104637701-104637723 ACCCCATGAAACCAAACTGCTGG + Intergenic
1059041158 9:110816875-110816897 CACCCATGAAAAAAAAATAAAGG - Intergenic
1060466629 9:123912697-123912719 CTCCACTGAAACCACACTGATGG - Intronic
1187549677 X:20289635-20289657 CTCCCATGAATATAAACTCAAGG + Intergenic
1187653242 X:21436041-21436063 CTTCCATGATAAGAAACTAAAGG + Intronic
1197117588 X:122851517-122851539 CTCCCTGCAAAACAAACTAATGG - Intergenic
1197764034 X:130047880-130047902 CTCCCATGACACCTAACACAGGG + Intronic
1198762935 X:140052776-140052798 ATACCATGAAACCTAACTCATGG - Intergenic
1201536658 Y:15056198-15056220 CTTAAATGAAACTAAACTAATGG - Intergenic