ID: 1101131301

View in Genome Browser
Species Human (GRCh38)
Location 12:101693897-101693919
Sequence CTTCTGAAGGCCATGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101131301_1101131308 24 Left 1101131301 12:101693897-101693919 CCTTTGATCATGGCCTTCAGAAG 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1101131308 12:101693944-101693966 TTTTTCCCCTTCCTATTGGTTGG 0: 1
1: 0
2: 1
3: 28
4: 319
1101131301_1101131309 25 Left 1101131301 12:101693897-101693919 CCTTTGATCATGGCCTTCAGAAG 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1101131309 12:101693945-101693967 TTTTCCCCTTCCTATTGGTTGGG 0: 1
1: 1
2: 2
3: 27
4: 292
1101131301_1101131307 20 Left 1101131301 12:101693897-101693919 CCTTTGATCATGGCCTTCAGAAG 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1101131307 12:101693940-101693962 TCTCTTTTTCCCCTTCCTATTGG 0: 1
1: 0
2: 4
3: 52
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101131301 Original CRISPR CTTCTGAAGGCCATGATCAA AGG (reversed) Intergenic
900659677 1:3776284-3776306 CTTGTGAAGGCCAGGATGAGGGG + Intergenic
901113388 1:6817959-6817981 CTTCTGAAGCACTTGATCATGGG + Intronic
903239010 1:21970141-21970163 CTTCTGAGGGCTACGAGCAAAGG + Intergenic
903242919 1:21995817-21995839 CTTCTGAGGGCTACGAGCAAAGG + Intronic
903774091 1:25781796-25781818 CCTTTGAAGGCCAAGAACAATGG - Intronic
904440470 1:30526454-30526476 CTTCAGAGGGACACGATCAAGGG - Intergenic
908648495 1:66306019-66306041 CTGATGTAGGCCTTGATCAATGG + Intronic
912405244 1:109432388-109432410 CTTCTGATGGCCTTGGTGAATGG - Intergenic
913656300 1:120963500-120963522 CTTCTGAAGGTCACCACCAATGG - Intergenic
914007443 1:143744730-143744752 CTTCTGAAGGTCACCACCAATGG - Intergenic
914451782 1:147798993-147799015 TTTCTGCAGGCCTTGATCACAGG - Intergenic
914520852 1:148414729-148414751 CTTCTGAAGGTCACCACCAATGG - Intergenic
914646259 1:149655213-149655235 CTTCTGAAGGTCACCACCAATGG - Intergenic
918378958 1:183935794-183935816 CTTCCGCAGGCACTGATCAATGG - Intronic
918470855 1:184871482-184871504 CTTCTGAGGGCAATGAGAAAAGG - Intronic
918938393 1:190955031-190955053 CTTCTGATGACCATGATGGAAGG + Intergenic
918949516 1:191118348-191118370 CTTCTGAAGAACTTGATAAAGGG + Intergenic
919140768 1:193568659-193568681 CTCCTGTAGCCCATGATAAAGGG + Intergenic
922243181 1:223770138-223770160 CATCTAAAGGCCACCATCAAGGG + Intronic
1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG + Exonic
1070422818 10:76254055-76254077 CTTATGAAAACCATGCTCAAAGG - Intronic
1077803529 11:5566883-5566905 CTTCTGAAGGCCCTAAGCACCGG - Intronic
1080086574 11:28290133-28290155 TTTCTAAAGTCTATGATCAATGG - Intronic
1080419430 11:32096828-32096850 CTGGTGATGGCCATTATCAACGG - Intronic
1080580400 11:33637642-33637664 CTTCTGAGGGCCATGAGGGAAGG + Intronic
1083481201 11:62948901-62948923 CTGCAGAAGGCCATGACCACAGG - Intronic
1085658226 11:78337019-78337041 CTTCAGAAGTCCATAGTCAAAGG - Intronic
1085740185 11:79071657-79071679 CCTCTGATGTCCATGGTCAAAGG - Intronic
1085921005 11:80957166-80957188 CTTTTCAAGGCCCAGATCAAGGG + Intergenic
1087218484 11:95520303-95520325 CTTCAGTAGGCTATAATCAATGG + Intergenic
1087696611 11:101384795-101384817 CATCTGAAGGCTTAGATCAAAGG + Intergenic
1088563998 11:111148228-111148250 CTTCTGCAGGGCAGGACCAATGG - Intergenic
1088667658 11:112109692-112109714 CTACTGAAGGCCATTATTGAAGG - Intronic
1089712561 11:120325983-120326005 CTTCTAAAGGCCAGGGTCACTGG - Intronic
1101131301 12:101693897-101693919 CTTCTGAAGGCCATGATCAAAGG - Intergenic
1101429123 12:104612287-104612309 CTTCTGAGGGCCGTGAAGAAGGG + Intronic
1101989060 12:109469544-109469566 ATGCTGAAGGCCATGTTCAGCGG - Exonic
1104580248 12:130006269-130006291 TTTCTGAAGGCCATGGACACTGG - Intergenic
1107088562 13:36451376-36451398 CTTTTGAAGTCCATAAACAAAGG + Intergenic
1108258028 13:48629308-48629330 CCTCTGAAGGGCATGAACAAGGG + Intergenic
1109674917 13:65663139-65663161 ATTGTGAAGACCATGAGCAACGG + Intergenic
1110179044 13:72593360-72593382 CTTCTGAAAGCCACAATCAAGGG - Intergenic
1110725572 13:78818740-78818762 TTTCTGAATGCCTTGTTCAAAGG - Intergenic
1112369740 13:98784336-98784358 CTTCTGAGGGCCATGAGGAAGGG + Intergenic
1113164241 13:107419949-107419971 CTTCTGAAGACCAAGCTCGATGG + Intronic
1113829943 13:113287848-113287870 TTTCTGAAGGCCAGCACCAAGGG + Intergenic
1114461642 14:22889921-22889943 ATTCTGAAGACCATGAACAGAGG + Intergenic
1118723422 14:68609790-68609812 CTACTGAAGGCCATTCTCAGTGG + Intronic
1119919667 14:78434766-78434788 TGGGTGAAGGCCATGATCAATGG + Intronic
1120546534 14:85819159-85819181 CTTTTGAAGGCCAGGAGCAGTGG + Intergenic
1121419007 14:93799241-93799263 CCTCTGCAGGCAATGAACAAAGG - Intergenic
1121933226 14:97992566-97992588 CTTCTGAAACCCATAGTCAATGG + Intergenic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1123196300 14:106619509-106619531 TTTCGGAAGGGCAGGATCAAAGG + Intergenic
1124138662 15:27057651-27057673 CACCTGAAGGACATGAGCAATGG - Intronic
1124788314 15:32702317-32702339 CTTCTGAAGGCCACAAGTAAAGG + Intergenic
1125078604 15:35650568-35650590 CCTTTGTAGGCCATGATCAGAGG + Intergenic
1126143651 15:45456980-45457002 CTGCCGAGGGCCATGAACAAGGG - Intergenic
1126745158 15:51818415-51818437 CTTCTGAAAGCCATAAAAAAAGG - Intergenic
1127094906 15:55502480-55502502 CTTCTTAAGGACATGAAGAATGG - Intronic
1128190560 15:65690716-65690738 CTTCTGCATGCCTTGACCAATGG + Exonic
1128834704 15:70799805-70799827 CTTCTGGAGGCCAGGAGCAGTGG - Intergenic
1131686260 15:94771356-94771378 CTTCTGAAGCCTATGAGGAAAGG + Intergenic
1133553403 16:6881427-6881449 CTTCTGAGGGCTGTGAGCAAAGG + Intronic
1137028468 16:35500928-35500950 CTTCTGAAGGCCAGGAAAAATGG + Intergenic
1143793354 17:9316100-9316122 CTACTGTAGGACATGCTCAAAGG + Intronic
1143876714 17:9997098-9997120 CTTCTCAAGGCAATGGTGAAAGG + Intronic
1144045909 17:11454462-11454484 CCTCTGAAGGCCAAGTACAATGG - Intronic
1144791240 17:17860523-17860545 CTTCTGAAGCCCCTGTCCAATGG - Intronic
1146690008 17:34866886-34866908 ATGCTGTAGGCCATGATCCATGG + Intergenic
1146730232 17:35186855-35186877 ATTCTGAAGGCCAGGATAATAGG + Exonic
1151234033 17:72705563-72705585 CATCTGAAGGTCAACATCAAAGG + Intronic
1153700502 18:7688553-7688575 CTCCTGAAGGCCATCATCTGGGG - Intronic
1155640878 18:28012943-28012965 ATTCTGAAGTCCATGAACTATGG - Intronic
1159869989 18:73750428-73750450 CAGCTGGAGGCCATGATCCATGG + Intergenic
1159900069 18:74037495-74037517 CTTCTGAAGGTCATGAGAAAAGG + Intergenic
1161896370 19:7084594-7084616 CTTCTGGAGGCCAAGATGAAAGG - Intronic
1164239540 19:23372479-23372501 CTGCTGAAGCCCAAGATCGAAGG + Intronic
1165981905 19:39731492-39731514 CTTCTGTAGGTAATGGTCAATGG - Exonic
1166006565 19:39911991-39912013 GTTCTTAAGGCCATGAGCAGTGG + Intronic
1166756208 19:45193293-45193315 CTTCTGAAGGAGATGATTACTGG + Intronic
927025870 2:19068599-19068621 CCTCTGAGGGCCATGAGGAAGGG + Intergenic
927109823 2:19856489-19856511 CCTCTGAATGCCATGGTGAAGGG + Intergenic
928696597 2:33855730-33855752 TTTCTGGAGGCCAAGATCAAGGG - Intergenic
928704907 2:33939073-33939095 CTGCTGAAGGCCCTGAATAATGG - Intergenic
931194046 2:60033553-60033575 CCTCTCCAGGCCATGAGCAATGG - Intergenic
933151413 2:78919516-78919538 CTTCTGAAAGCTGTAATCAAGGG + Intergenic
933582086 2:84139033-84139055 GTTCTGAAGGCTATGAACAGTGG + Intergenic
934508932 2:94921098-94921120 CTGGTGAAGGCCAGGCTCAATGG + Intergenic
935177604 2:100663478-100663500 CTCCTGAAGGCCAGGGTAAATGG - Intergenic
936429870 2:112453214-112453236 CTTCTGAAGGTCAAGAAGAATGG - Intergenic
936596955 2:113857211-113857233 ATTCTGAAGGCTATAATCCAAGG - Intergenic
936855772 2:116955559-116955581 CTTCTGAATGCCATTATCCTAGG + Intergenic
937425078 2:121792151-121792173 CTTTGGAAGGCCAAGATCAGAGG + Intergenic
939023099 2:136981576-136981598 CTTCTGCAGGCCATGCTACAAGG - Intronic
939106825 2:137958530-137958552 CTTCTGAACACCATGCTCATTGG - Intergenic
940129349 2:150363374-150363396 CTTCTGAAGGCTATGAGGAAAGG - Intergenic
940446339 2:153782721-153782743 CTTCTGAGAGCCATGAGAAAGGG - Intergenic
940893476 2:159057548-159057570 CTTCTACAGGCTATGAGCAATGG - Intronic
941248548 2:163132195-163132217 CTTCGGAAGGCCAAGATAGATGG + Intergenic
944815153 2:203368771-203368793 CTCCTGAAGGAAATAATCAATGG + Intronic
945093755 2:206200113-206200135 CTTCTAAAGGCCATTAAGAATGG + Intronic
945243590 2:207698435-207698457 CTTCTGAGGGCCGTGAGGAAGGG + Intergenic
947882046 2:233524586-233524608 TTTCTGATGGTCATGATGAATGG - Intronic
1169945895 20:10987685-10987707 CCTCTAAAAGACATGATCAAGGG - Intergenic
1170787877 20:19483177-19483199 CTTCTGGAGTCCATGGTCAGTGG - Intronic
1171819825 20:29824596-29824618 CTTCTGGAGGCCATTATCCTAGG - Intergenic
1172102046 20:32490712-32490734 CTCCTGAAAACCATGATAAAAGG + Intronic
1172585549 20:36081290-36081312 GTTGGGAAGGCCAAGATCAATGG + Intergenic
1175129122 20:56775955-56775977 CCTCTGAAGGAAAGGATCAAAGG + Intergenic
1175572888 20:60037397-60037419 CCTCTGAAGGGCAAGATCAGGGG - Intergenic
1178167082 21:29991671-29991693 CTTCTGAAGGCCATTGAAAAGGG + Intergenic
1180323824 22:11349287-11349309 CGTCTGGAGGCCATTATCATAGG - Intergenic
1181152576 22:20895690-20895712 CTTTGGGAGGCCAAGATCAATGG + Intergenic
1181548344 22:23618547-23618569 CTGCTGAAGCCCTTGATCACAGG - Intronic
1182101867 22:27663135-27663157 GTCCTGAAGGCCATGGTAAAAGG - Intergenic
1184711678 22:46254154-46254176 CTTTTGAAGGCCATTTTCACAGG - Intergenic
952691231 3:36208975-36208997 CTACAGAAGGCCAGGAGCAATGG + Intergenic
953709628 3:45259348-45259370 CATCTGAAGGCTGTGATCATAGG + Intergenic
954660060 3:52222232-52222254 CAGCTGAAGGCCCTGACCAATGG - Exonic
954786798 3:53099337-53099359 TGGCTGAAGGCCATGATTAAAGG + Intronic
955056850 3:55462587-55462609 TTTCTGAAGGTCATGGTCAGAGG + Intergenic
956161857 3:66363308-66363330 CTGCAGAAGGCCATGATTCACGG + Intronic
956611951 3:71133199-71133221 CTTCTAATGGCCATGAGAAATGG - Intronic
957126589 3:76169496-76169518 CTATTGAAGTACATGATCAAGGG - Intronic
961094865 3:124145542-124145564 CTTCTGAGTGACATGACCAAAGG + Intronic
962100559 3:132337784-132337806 CCTCTCAAGGCCATGAGTAAAGG - Intronic
962607988 3:137048645-137048667 CTTCTGAGGGCCATGAGGGAAGG - Intergenic
962649851 3:137477499-137477521 CTTCTAAAGGCCAGAATTAAAGG - Intergenic
963370590 3:144394893-144394915 CTTTTGAAGGCGATGAGGAAAGG + Intergenic
964193080 3:154028784-154028806 CATCTGAGGGCCATGATCTTTGG - Intergenic
964417503 3:156462930-156462952 CTTCTGAAAGCCACAACCAAGGG - Intronic
965560138 3:170054295-170054317 CTTCTGAAGCACAAGTTCAAAGG + Intronic
970404286 4:15747446-15747468 ATTCTGAAGGCCAGGATTGATGG - Intergenic
971081003 4:23211099-23211121 ATATTGAAGCCCATGATCAATGG + Intergenic
975330328 4:73105451-73105473 CTTCTGAAAGGCATAATCAGAGG + Intronic
976256847 4:83108747-83108769 CTACTGTCGGCCATGATCACAGG - Intronic
976288559 4:83393910-83393932 CTTCTGAAGACAAGGATCGAAGG + Intergenic
977328915 4:95611942-95611964 CTACTGAAGGCCAGGGCCAATGG - Intergenic
977399822 4:96518837-96518859 CTTCTAAGGTCCATGAACAAAGG + Intergenic
979750123 4:124269148-124269170 GTTGGGAAGTCCATGATCAAGGG - Intergenic
981571305 4:146153568-146153590 CTTCTGAAGGCCATTTCCCATGG - Intergenic
984469191 4:180144181-180144203 ATTCAGAAGCCAATGATCAATGG + Intergenic
987025194 5:13919957-13919979 CTTCTGAAGGCCATGACCTCAGG + Intronic
988049328 5:26004423-26004445 TTTCTGAAGGTGATGTTCAAAGG - Intergenic
990005137 5:50937201-50937223 CTTGGGAAGTCCAAGATCAAGGG + Intergenic
990832744 5:59978126-59978148 ATTCTGAAGCCCATGTTCCAAGG + Intronic
993000682 5:82377831-82377853 ATTTTTAAGGCCATGATCATAGG + Intronic
995869520 5:116729750-116729772 ATTCTGGAAGCCATGAGCAAAGG - Intergenic
997199871 5:132003451-132003473 CTTTTCAAGGCCAGGATGAATGG + Intronic
998246612 5:140512287-140512309 TTTCTAAATGCCATTATCAAGGG - Intronic
998924510 5:147107023-147107045 GTTCTGAAGTCCAAGATCAAGGG - Intergenic
999306782 5:150524811-150524833 CCTCTAAAGGTCATGCTCAAAGG - Intronic
1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG + Intronic
1000809835 5:165847285-165847307 TTTCTGAAGGCGATCATCAGTGG - Intergenic
1001301817 5:170539046-170539068 ATTCTGGAGGCCATGATCATAGG - Intronic
1001675329 5:173507418-173507440 CTTCTGGAGGCCTTGGCCAAGGG - Intergenic
1003299350 6:4863062-4863084 CAGCTGAAGGCCATTATCCAAGG + Intronic
1004008209 6:11656334-11656356 CTTCTGGAGACCATGAGCAGGGG - Intergenic
1004139671 6:13005688-13005710 CTTGTGAAGTGAATGATCAAAGG - Intronic
1009883170 6:69594839-69594861 CTTCTGAAGGCAGTGAGAAAAGG + Intergenic
1016308783 6:142711483-142711505 CTCAGGAAGTCCATGATCAATGG - Intergenic
1017370521 6:153700724-153700746 CTTCTGAATTCCATGATGAAAGG - Intergenic
1018835033 6:167476697-167476719 TCTCTGAAGGCAATGAGCAAGGG - Intergenic
1018912009 6:168106644-168106666 CCACTGAAGGCCATGATATAAGG + Intergenic
1020879025 7:13735715-13735737 CTTATTAAGGCCAACATCAATGG + Intergenic
1022826450 7:34019337-34019359 CGTCAGAGGGCCAAGATCAAGGG + Intronic
1023075503 7:36478297-36478319 CTTTTGGAGGCCAAGATGAAAGG - Intergenic
1027714405 7:81651926-81651948 CTTCTGAAGGGCCTCATCATAGG + Intergenic
1028089418 7:86679696-86679718 TTTCTGATGGAGATGATCAAGGG - Intronic
1028956530 7:96699652-96699674 CTTTTGAAAGCCCTGTTCAAAGG + Intronic
1029081529 7:97978350-97978372 CTTCAGAAGGCCAAGATTCAAGG - Intergenic
1030187947 7:106781543-106781565 CCTCTGTAGTTCATGATCAATGG - Intergenic
1031280939 7:119798233-119798255 CTTGTGAAGGGCATGATAAATGG + Intergenic
1035947856 8:3985119-3985141 CTCCTGAAGTACATGATCTATGG - Intronic
1036488769 8:9204943-9204965 CTACTGAAAGACATGATAAATGG + Intergenic
1037479446 8:19290408-19290430 CTTGTGAAGGCCACTCTCAAAGG + Intergenic
1038464624 8:27749813-27749835 CTTCAGAAGGACATGTTCAAGGG + Intronic
1038618616 8:29118721-29118743 CTTCTGGAAGTCATGATGAAAGG + Intronic
1039143875 8:34423416-34423438 CTTATGTGGGCCATTATCAAAGG - Intergenic
1041009315 8:53525802-53525824 CTTCTGAAGCCCATGGTTCAAGG + Intergenic
1041728898 8:61045027-61045049 CTTCCCCAGGGCATGATCAATGG + Intergenic
1044362775 8:91307940-91307962 CTTTGGAAGGCCAAGATGAAAGG - Intronic
1046340478 8:112847363-112847385 CTTCTGCACCCCATGATCATAGG - Intronic
1048456530 8:134583535-134583557 CTTCAGAAAGCCTTGATCCATGG - Intronic
1050343418 9:4662907-4662929 CTGCTGGTGGCCTTGATCAAAGG + Exonic
1051512602 9:17895319-17895341 ATTCTGATGCCCATGGTCAAAGG + Intergenic
1051982714 9:23043333-23043355 CTTCAGAAGGCATTAATCAATGG + Intergenic
1052057736 9:23922937-23922959 TGTCTGAGGGCCATGATTAAGGG + Intergenic
1055016413 9:71623426-71623448 CTTCTGAGGGCCATGAGGGAAGG + Intergenic
1060899893 9:127248045-127248067 CTTCTGAAGGCTATTAAAAAGGG - Intronic
1186226813 X:7407749-7407771 CTTCTGGAAGCCTTGTTCAAAGG - Intergenic
1187674013 X:21697729-21697751 TTTCTCAAGGCCATGAGGAAAGG + Intergenic
1188705303 X:33321205-33321227 CTTCTGATGGATATGAGCAAAGG - Intronic
1189544525 X:42027813-42027835 CTTCTGAAAGGCAAGATCAGAGG - Intergenic
1193348402 X:80430295-80430317 CTTCTGTAGGAAATGACCAATGG - Intronic
1193475529 X:81960185-81960207 CTGCTGATGGCTATGATTAATGG - Intergenic
1193703674 X:84793902-84793924 CTTCTGAAATCATTGATCAAGGG - Intergenic
1195603535 X:106775861-106775883 CTTCTGAAGGTTATGATACATGG + Intronic
1198447602 X:136733868-136733890 CTACTGAAGGTCTTGGTCAATGG + Intronic
1201066846 Y:10105266-10105288 CTTCTGGAGGCCATTATCCTAGG + Intergenic
1201542760 Y:15126166-15126188 CTTTTGTAGGCCATGTTCAAAGG + Intergenic