ID: 1101131792

View in Genome Browser
Species Human (GRCh38)
Location 12:101697756-101697778
Sequence CGGCCGGGTCCTGCGACTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101131792_1101131805 22 Left 1101131792 12:101697756-101697778 CCGGCAGTCGCAGGACCCGGCCG 0: 1
1: 0
2: 0
3: 7
4: 232
Right 1101131805 12:101697801-101697823 CCTGCCCCCAGCGCCAGGCGCGG 0: 1
1: 0
2: 3
3: 34
4: 384
1101131792_1101131802 17 Left 1101131792 12:101697756-101697778 CCGGCAGTCGCAGGACCCGGCCG 0: 1
1: 0
2: 0
3: 7
4: 232
Right 1101131802 12:101697796-101697818 CTCTCCCTGCCCCCAGCGCCAGG 0: 1
1: 1
2: 15
3: 146
4: 1148
1101131792_1101131806 23 Left 1101131792 12:101697756-101697778 CCGGCAGTCGCAGGACCCGGCCG 0: 1
1: 0
2: 0
3: 7
4: 232
Right 1101131806 12:101697802-101697824 CTGCCCCCAGCGCCAGGCGCGGG 0: 1
1: 0
2: 4
3: 47
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101131792 Original CRISPR CGGCCGGGTCCTGCGACTGC CGG (reversed) Exonic
901626323 1:10627204-10627226 CGGGCGGGGCCTGCGGCTGCAGG - Intronic
901703940 1:11059835-11059857 CGGCCAGGCCCTGTCACTGCAGG - Exonic
911839267 1:102660291-102660313 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
912819391 1:112854792-112854814 CGGCCGGCTGCTCCGAGTGCCGG + Intergenic
915261206 1:154678119-154678141 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
917578565 1:176349549-176349571 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
920435933 1:205947242-205947264 AGGCCAGATCCTGCCACTGCAGG - Intergenic
921396403 1:214673425-214673447 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
921903857 1:220475948-220475970 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
921903864 1:220475973-220475995 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
921983693 1:221285937-221285959 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
923479809 1:234373570-234373592 GTGCCGAGTCCTGCCACTGCAGG - Intronic
923573794 1:235140366-235140388 CGGCCGGCTGCTCCGAGTGCGGG - Intronic
1068374005 10:56155204-56155226 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1069766124 10:70861725-70861747 CGGCCGGCTGCTCCGAGTGCGGG - Intronic
1070288615 10:75100591-75100613 CGGCCGGGCCCTGGCCCTGCTGG - Intronic
1071387987 10:85141481-85141503 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1071428198 10:85580732-85580754 GGGCAGGTTCCTGCTACTGCTGG + Intergenic
1072891710 10:99330122-99330144 CCACCGGGTCCAGCGACAGCAGG - Exonic
1077764575 11:5144496-5144518 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1078795805 11:14591143-14591165 CGGCCGGCTGCTCCGAGTGCAGG - Intronic
1081420880 11:42874000-42874022 AGGCCGGGTGCTCCGAGTGCAGG - Intergenic
1081422051 11:42881465-42881487 CGGCTGGGTGCTCCGAGTGCAGG - Intergenic
1089507211 11:118971901-118971923 TGGCCAGGTCCCGGGACTGCTGG + Exonic
1090229205 11:125089578-125089600 CGGCCGGCTGCTCCGAGTGCAGG - Intronic
1092221383 12:6716118-6716140 TGGCCGGCTCCTCCGAGTGCAGG - Intergenic
1092336659 12:7639921-7639943 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1092350538 12:7752352-7752374 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1092471754 12:8787348-8787370 CGGCCGGCTGCTCCGAGTGCAGG - Intergenic
1092583824 12:9876319-9876341 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1093189384 12:16057464-16057486 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1093652533 12:21661611-21661633 CGGCCGGCTGCTCCGAGTGCGGG - Intronic
1094327547 12:29256725-29256747 CGGCCGAGTGCTCCGAGTGCAGG - Intronic
1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG + Intronic
1098168238 12:67719511-67719533 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1098426233 12:70367341-70367363 AGTCCGGGTCCTGCGCCTACCGG + Intronic
1099790696 12:87330297-87330319 TGGCCGGCTGCTGCGAGTGCTGG - Intergenic
1101131792 12:101697756-101697778 CGGCCGGGTCCTGCGACTGCCGG - Exonic
1102035477 12:109768550-109768572 CGCCCGGGGCCTGGCACTGCTGG - Exonic
1103146165 12:118597454-118597476 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1104749220 12:131227893-131227915 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1107836095 13:44413657-44413679 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1109745801 13:66622030-66622052 CGGCCGGCTGCTCCGAGTGCGGG - Intronic
1110368848 13:74718473-74718495 CGGCCGGCTGCTCCGAGTGCAGG - Intergenic
1110792413 13:79600437-79600459 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1110862116 13:80355628-80355650 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1111591005 13:90348680-90348702 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1111841431 13:93455064-93455086 CGGCCGGCTGCTCCGAGTGCAGG + Intronic
1113926339 13:113943871-113943893 CAGCCGGGTGCAGGGACTGCGGG - Intergenic
1115268649 14:31527365-31527387 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1120330963 14:83092466-83092488 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1122422104 14:101584107-101584129 CGGCCCAGTCCAGCCACTGCAGG - Intergenic
1122842425 14:104472973-104472995 CGGCCGGGTGCCGGGACAGCCGG + Intergenic
1125914571 15:43474157-43474179 CGGCCGGCTGCTCCGAGTGCAGG + Intronic
1130132844 15:81158704-81158726 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1132012233 15:98286270-98286292 CGGCTATGTCCTGGGACTGCTGG + Intergenic
1132591246 16:727290-727312 CGGCCGGGTTCCGCTCCTGCTGG + Exonic
1132942360 16:2514431-2514453 CAGCCGGGTCGTGCGGTTGCGGG + Intronic
1135262141 16:20989919-20989941 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1135751086 16:25059189-25059211 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1136068188 16:27772466-27772488 CGGCCTGCTCCTGGGAGTGCGGG + Intronic
1139955604 16:70691628-70691650 AGGCCTAGTCCTGCCACTGCAGG + Intronic
1141116800 16:81315632-81315654 CGGCCGGGACCCGCACCTGCGGG + Intronic
1141430612 16:83968771-83968793 CGGCGGGGGCCAGCGACTCCCGG - Exonic
1142293084 16:89201601-89201623 TGGCCGGGCCCGGCGCCTGCTGG - Exonic
1143190345 17:5035580-5035602 CCGCTGGGTCCGGGGACTGCCGG - Intronic
1143503598 17:7352219-7352241 CGGCCGGGTCCCGAAACTCCTGG + Exonic
1143664293 17:8347398-8347420 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
1144676843 17:17167501-17167523 CAGCCGGGTCCTGAGCCAGCTGG + Intronic
1148016851 17:44528047-44528069 CGGCCGGCTGCTCCGAGTGCAGG - Intergenic
1148366196 17:47057561-47057583 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1150778261 17:68099364-68099386 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1151464290 17:74274550-74274572 CTGCAGGGTCCTGCGACTTGGGG - Intronic
1151759158 17:76090807-76090829 CAGCTGGGGCCTGCCACTGCTGG + Intronic
1155226620 18:23734878-23734900 CGGCCAGGTCCTGCTCCTGCTGG - Intronic
1156038651 18:32794657-32794679 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1158697280 18:59714371-59714393 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
1158893592 18:61894323-61894345 GGGCCGGGTGCTGGGGCTGCAGG - Intergenic
1159167972 18:64725908-64725930 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1159230779 18:65605336-65605358 CGGCCGGCTGCTCCGAGTGCAGG - Intergenic
1160237013 18:77093758-77093780 CGGGCGGGCGCTGCAACTGCTGG + Intronic
1161283064 19:3456198-3456220 CCGCCCGGTCCTGCCACTGAGGG - Intronic
1162524180 19:11197774-11197796 AGGCAGGGTCCTCCCACTGCCGG + Intronic
1162632720 19:11941574-11941596 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1162683801 19:12365449-12365471 CGCCCGGGTCCCGCCACAGCCGG + Intronic
1163218827 19:15899765-15899787 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1166072615 19:40395732-40395754 CGGCTGGGACCTGCCCCTGCAGG + Exonic
1166367508 19:42284780-42284802 CGCCTGGGCCCTGGGACTGCAGG + Intronic
925719649 2:6814461-6814483 TGGCCGGTTCCTGCCACTGTGGG - Intergenic
927904521 2:26847639-26847661 CGGCGGGGTCCTGCGGCGGAGGG + Intergenic
929890892 2:45917952-45917974 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
930485487 2:52006881-52006903 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
932902030 2:75711656-75711678 CGGCCGGCTGCTCCGAGTGCAGG - Intergenic
933487277 2:82938723-82938745 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
934898474 2:98139085-98139107 CGGCCGGCTGCTCCGAGTGCGGG - Intronic
936346868 2:111681932-111681954 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
937596830 2:123683855-123683877 CGGCCGGCTGCTCCGAGTGCAGG - Intergenic
938401009 2:130991527-130991549 CGGCCGGCTGCTCCGAGTGCCGG - Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942867268 2:180691469-180691491 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
943680369 2:190761242-190761264 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
944482788 2:200174865-200174887 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
944857953 2:203785852-203785874 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
1170989865 20:21291953-21291975 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1172431878 20:34899081-34899103 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1172841107 20:37903207-37903229 GGGCCGGGTCCGGGGACAGCGGG + Exonic
1173790087 20:45822873-45822895 CGGAGGGGTCCTGAGACGGCAGG - Intergenic
1175210047 20:57348478-57348500 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1175254133 20:57628876-57628898 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1175333424 20:58179740-58179762 CGCCCGGTTCCTGCAACTCCAGG - Intergenic
1175756965 20:61536109-61536131 TGGCCGGGTTCTGTGCCTGCAGG - Intronic
1177871039 21:26573105-26573127 CGTCCCGGGCCAGCGACTGCGGG + Exonic
1178585663 21:33868595-33868617 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1180741065 22:18053635-18053657 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1183474060 22:38026327-38026349 GGGCTGGGTCCTGGGTCTGCTGG - Intronic
1183606049 22:38867186-38867208 CGGCCTGGGCCCGCGCCTGCGGG + Exonic
1184430243 22:44438196-44438218 CGGCCAGGTCCTGGGGCTGGGGG + Intergenic
1185254258 22:49823513-49823535 CGGGCCGGGCCCGCGACTGCAGG + Exonic
951024956 3:17818274-17818296 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
951551898 3:23882814-23882836 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
952355370 3:32578836-32578858 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
955186407 3:56719015-56719037 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
957206427 3:77204986-77205008 CGCCCGGCTCCTGCACCTGCCGG - Intronic
957665202 3:83217889-83217911 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
958419857 3:93917669-93917691 CGGCCGGCTGCTCCGAGTGCCGG - Intronic
958665708 3:97135689-97135711 CTGCTGGTTCCTGCTACTGCTGG + Intronic
960282118 3:115791644-115791666 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
962600523 3:136987865-136987887 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
963862150 3:150323050-150323072 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
965200362 3:165649595-165649617 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
965837351 3:172866863-172866885 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
966096813 3:176213706-176213728 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
970649346 4:18159547-18159569 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
970673185 4:18418616-18418638 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
970803507 4:20004094-20004116 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
971030765 4:22634846-22634868 CGGCCGGGCGCTCCGAGTGCGGG - Intergenic
971377133 4:26064257-26064279 CGGCCGGCTGCTCCGAGTGCCGG + Intergenic
973765112 4:54155402-54155424 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
974804366 4:66860251-66860273 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
978080233 4:104582065-104582087 CGGCCGGCTGCTCCGAGTGCAGG - Intergenic
979755854 4:124339136-124339158 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
979825723 4:125229869-125229891 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
979899727 4:126201568-126201590 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
979920442 4:126490092-126490114 CGGCCGGCCGCTGCGAGTGCGGG - Intergenic
980051951 4:128047836-128047858 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
981146742 4:141333296-141333318 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
981146749 4:141333321-141333343 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
981146756 4:141333346-141333368 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
981146763 4:141333371-141333393 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
981146770 4:141333396-141333418 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
981146777 4:141333421-141333443 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
981146784 4:141333446-141333468 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
981146791 4:141333471-141333493 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
983026081 4:162739623-162739645 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
983230676 4:165126215-165126237 CGGCCGGCTGCTCCGAGTGCAGG + Intronic
984192856 4:176625442-176625464 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
984238837 4:177193473-177193495 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
984948740 4:184990366-184990388 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
985653192 5:1116390-1116412 CCCCCGGGTCCTGTGCCTGCTGG + Intergenic
986697979 5:10375240-10375262 CGGCCGGCTGCTCCGAGTGCAGG - Intronic
987146268 5:14994083-14994105 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
987156807 5:15096833-15096855 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
987384030 5:17312050-17312072 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
987476715 5:18399950-18399972 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
988143073 5:27267475-27267497 CGGCCGGCTGCTCCGAGTGCCGG + Intergenic
988883570 5:35531709-35531731 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
990345245 5:54865159-54865181 CGGCCGGCTGCTCCGAGTGCCGG - Intergenic
993328597 5:86569801-86569823 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
994841375 5:104929086-104929108 CGGCCAGGTGCTCCGAGTGCGGG - Intergenic
999406164 5:151309275-151309297 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
999855302 5:155587029-155587051 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1001856134 5:175012459-175012481 CGGCCAGGCCCTGTGAGTGCAGG + Intergenic
1002710431 5:181191835-181191857 CGGCCGAGTTCTGTGGCTGCTGG + Intergenic
1003065880 6:2903261-2903283 GGGCCGGGTCCTGCGCCTCGGGG - Exonic
1003070206 6:2939713-2939735 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1003897027 6:10617294-10617316 CGGCCGGCTTCTCCGAGTGCTGG + Intronic
1003908112 6:10720677-10720699 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1003947264 6:11087300-11087322 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1003982484 6:11402859-11402881 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1004053169 6:12108667-12108689 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1004224382 6:13772573-13772595 CGGCCGGCTGCTGCGAGTGCGGG - Intergenic
1004233722 6:13854993-13855015 CGGCCGGCTGCTCCGAGTGCTGG + Intergenic
1004866073 6:19854704-19854726 CGGCCGGTTGCTCCGAGTGCGGG + Intergenic
1005707462 6:28469630-28469652 CGGCCGGTTGCTCCGAGTGCGGG + Intergenic
1005978256 6:30816575-30816597 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1006748918 6:36364509-36364531 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1008005609 6:46406043-46406065 CGGCCGGCTGCTCCGAATGCGGG + Intronic
1008038765 6:46774682-46774704 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1009685319 6:66949298-66949320 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1010235667 6:73572813-73572835 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1013025739 6:106269683-106269705 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1013556212 6:111259595-111259617 CCGCCGGGGCCTCCGCCTGCAGG - Exonic
1015572271 6:134633822-134633844 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1017182224 6:151564617-151564639 AGGCCAGGCCCTGCGCCTGCAGG + Intronic
1017839527 6:158210065-158210087 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1019317019 7:391516-391538 CGGCCGCTCCCTGCGTCTGCTGG - Intergenic
1019944287 7:4314215-4314237 CGGCCGGCTGCTCCGACTGCCGG + Intergenic
1024335655 7:48203190-48203212 CGGCCGGCTGCTCCGAGTGCGGG + Intronic
1024521193 7:50305107-50305129 CGGCCTGGTCCTGCACCTGCTGG - Intronic
1025071574 7:55904206-55904228 CGGCCTGGTGCTGGGATTGCAGG - Intronic
1025236638 7:57239246-57239268 CAGCCGAGTCCTGGGAGTGCAGG - Intergenic
1026596576 7:71738356-71738378 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1027561651 7:79739383-79739405 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1027564058 7:79768241-79768263 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1029849368 7:103446210-103446232 CGGCCGCGCCCCGCGACTCCCGG + Intergenic
1030600001 7:111582220-111582242 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1030780395 7:113593402-113593424 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1031109957 7:117596228-117596250 CGGCCGGCTGCTCCGAGTGCGGG - Intronic
1031378780 7:121060053-121060075 CGGCCGGCTGCTCCGAGTGCAGG - Intronic
1032119238 7:129144724-129144746 CGGGCTGGTCCTGCGGCCGCGGG + Intergenic
1032248058 7:130230105-130230127 CGGCCGGCTGCTCCGAGTGCAGG - Intergenic
1032437102 7:131909410-131909432 CGGCCGGCCCCTCCGAGTGCGGG - Intergenic
1032561623 7:132898884-132898906 CGGCCGGCTGCTCCGAGTGCAGG + Intronic
1033312440 7:140271582-140271604 CGGCCGGCCCCTCCGAGTGCGGG + Intergenic
1034179384 7:149126086-149126108 CGGCCGGGGCCTGGGCCTGGGGG - Intronic
1035308183 7:157946861-157946883 CGGCCGGGGCCCGACACTGCCGG + Intronic
1036914959 8:12796378-12796400 CGGCCAGCTGCTGCGAGTGCGGG - Intergenic
1037263861 8:17037095-17037117 TGGCCGGCTGCTCCGACTGCGGG + Intronic
1037810955 8:22086637-22086659 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1037957573 8:23071063-23071085 CGGCCGGCTGCTCCGAGTGCAGG + Intergenic
1043073368 8:75665742-75665764 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1043346442 8:79303577-79303599 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1044633494 8:94300611-94300633 CGGCCGGCTTCTCCGAGTGCGGG + Intergenic
1044788664 8:95823721-95823743 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1047631724 8:126714914-126714936 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1049654213 8:143790707-143790729 CGGCCGGGGCCCGGGACTGCCGG - Intergenic
1056471591 9:86909861-86909883 GGGCCTGGTCCTGGGACTCCGGG + Intergenic
1056743728 9:89282508-89282530 CGGCCGGCAGCTGCGAGTGCAGG - Intergenic
1056815687 9:89799229-89799251 AGGCCAGGTCTTGTGACTGCAGG + Intergenic
1062294888 9:135819184-135819206 CGGCCGTGTCCGGCGTCTGAGGG - Intronic
1185449474 X:274940-274962 GGGCCGGGCCCTGTGACTGTGGG + Intergenic
1187139027 X:16575535-16575557 CGGCCAGCTGCTCCGACTGCCGG - Intergenic
1192429162 X:71101021-71101043 CAGCCGGGTGCTGACACTGCTGG - Exonic
1194118051 X:89926813-89926835 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1196827299 X:119751107-119751129 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1196845037 X:119890673-119890695 CGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1198299962 X:135325536-135325558 CGGCCGGCTGCTCCGAGTGCGGG - Intronic
1200155427 X:153972397-153972419 GGGCCGCCTCCTGCGGCTGCTGG - Exonic
1200470928 Y:3584376-3584398 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1201285505 Y:12375287-12375309 CGGCCGGCTGCTCCGAGTGCGGG + Intergenic