ID: 1101137421

View in Genome Browser
Species Human (GRCh38)
Location 12:101758755-101758777
Sequence ACTGTGTCTCCTCATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101137417_1101137421 -2 Left 1101137417 12:101758734-101758756 CCAATGGCTGCCACTTGTCACAC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1101137421 12:101758755-101758777 ACTGTGTCTCCTCATGAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 169
1101137416_1101137421 7 Left 1101137416 12:101758725-101758747 CCTCTTTCACCAATGGCTGCCAC 0: 1
1: 0
2: 0
3: 17
4: 206
Right 1101137421 12:101758755-101758777 ACTGTGTCTCCTCATGAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101137421 Original CRISPR ACTGTGTCTCCTCATGAGGG AGG Intronic
900125812 1:1068567-1068589 GCTGTGGCTCCTCCTGAGCGGGG - Intergenic
900437603 1:2639014-2639036 ACTGGGTCTCCACATGGTGGAGG + Intronic
900828868 1:4949609-4949631 ACTTTGCCTCCTCATGAAAGAGG - Intergenic
901422464 1:9160391-9160413 CCGGGGTCTCCTCATGAGTGAGG - Intergenic
902286547 1:15411321-15411343 ACTGTGTGCCCTCACCAGGGTGG + Intronic
902662543 1:17915156-17915178 GCTGTTTCTCCTTCTGAGGGAGG + Intergenic
903995191 1:27301045-27301067 ACTCTGTCTCCTGATGGGGGAGG + Intronic
909124405 1:71647587-71647609 ACTGTGGCTTGTCAGGAGGGAGG - Intronic
909773375 1:79454683-79454705 ACTGTTTCTCCTACTGAGGCTGG + Intergenic
916738355 1:167628059-167628081 ACTGGGACTTCTCCTGAGGGAGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
919274752 1:195399437-195399459 ACTGTGCAGCCTCATGAGGAAGG + Intergenic
920502291 1:206493005-206493027 TCTGTGTGTTCTCTTGAGGGTGG + Exonic
920913611 1:210239995-210240017 CCTGTGTGTCCACATGGGGGTGG + Intronic
1062917871 10:1255741-1255763 ACAGTGTGACCTCATGAGAGTGG + Intronic
1063942955 10:11149398-11149420 ACTGCATCTGCTGATGAGGGTGG - Intronic
1064617401 10:17174926-17174948 AGTGTGTCTCTTAATGAGGGAGG - Intronic
1065463774 10:25997656-25997678 CCTGTTTCTCCTTAGGAGGGAGG - Intronic
1068439032 10:57028416-57028438 ACTGTGTCACCTCCTGGTGGAGG - Intergenic
1068956257 10:62820540-62820562 ACTGTGGACACTCATGAGGGTGG + Intronic
1069291184 10:66781897-66781919 ACTGTGTGTCCTCCAGAGGCAGG - Intronic
1069669554 10:70190206-70190228 TCTGTCTCTCCTCATGAAAGTGG - Intergenic
1071802271 10:89076844-89076866 GCTGCATCTCCTCATGGGGGTGG - Intergenic
1073322423 10:102623521-102623543 TCTCTGTCTTCTGATGAGGGAGG - Intronic
1074313333 10:112341192-112341214 ACTGTGTGTTCTCCTTAGGGTGG + Intergenic
1075587914 10:123670762-123670784 ACAGTCTATCCTCAGGAGGGTGG + Intronic
1077900514 11:6483681-6483703 ACAGGGTCACCTGATGAGGGTGG - Exonic
1079499684 11:21089049-21089071 ACTGTGGCCCCTCATGAATGGGG + Intronic
1079641783 11:22814656-22814678 TCAGTGTCTCCTGATGTGGGTGG + Intronic
1082077216 11:47983242-47983264 ACTGTGTCTTCTCAAAATGGTGG + Intronic
1083541791 11:63516377-63516399 ACTGTGTCCACTCCTGAGGATGG + Exonic
1084312994 11:68327332-68327354 ACTGGGTCCCCTCATGACCGTGG - Intronic
1084962153 11:72722525-72722547 TCTCTGTCTCCTTATGCGGGTGG - Intronic
1087559236 11:99763626-99763648 ACTCTGTCTCTTAATGAGGTGGG - Intronic
1089680260 11:120115386-120115408 GCTTTGGCTCCGCATGAGGGAGG + Exonic
1091231065 11:133988386-133988408 ACTGTGCCTCCACATAAGGCAGG + Intergenic
1092303260 12:7273088-7273110 ACTGAGCCACCTCATGAGGATGG - Intergenic
1093280977 12:17195875-17195897 AGTGTGTCTTCACATGATGGAGG - Intergenic
1097348462 12:58521368-58521390 ACTGTGTCTTCTCTTCTGGGAGG - Intergenic
1101085767 12:101234230-101234252 ACTGTTTCTCATCATGCTGGGGG - Intergenic
1101137421 12:101758755-101758777 ACTGTGTCTCCTCATGAGGGAGG + Intronic
1101236507 12:102795172-102795194 TCTGTGTCTCCCCATGAGAGAGG + Intergenic
1107187886 13:37546112-37546134 ACTTCCTCTCCTCATTAGGGTGG + Intergenic
1113630279 13:111877686-111877708 GCTGTGCCCCTTCATGAGGGGGG + Intergenic
1114671751 14:24415328-24415350 CCTGGCTCTCCTCATCAGGGAGG - Exonic
1119442584 14:74638223-74638245 ACAGTGTCTCCTCCAGAGGAAGG + Intergenic
1120462756 14:84818029-84818051 ATTGTGTCTTCACATGATGGAGG - Intergenic
1120630213 14:86881344-86881366 AATCTGTCTCCACATGAGGATGG - Intergenic
1123906791 15:24929553-24929575 TGGGTGTCCCCTCATGAGGGTGG + Intronic
1124160218 15:27261427-27261449 ACTGTCTCTGCTCAAGATGGAGG + Intronic
1126968423 15:54083102-54083124 ACAGTCTCTCCCCATCAGGGTGG - Intronic
1127711289 15:61600997-61601019 ATTGTGTCCCCTGATGATGGTGG + Intergenic
1129232738 15:74205786-74205808 TCTGTGTCTTCCCATGAGGAGGG - Intronic
1130721760 15:86393919-86393941 ACTGTGTCTTCACATGTGGAAGG - Intronic
1131076907 15:89501084-89501106 ACTGTGTCTCATCCTGTGTGGGG + Intergenic
1133817858 16:9211944-9211966 ACTGTGTCTCCTCATGTGCATGG + Intergenic
1144777480 17:17792023-17792045 GCTGTGTCGCCCCATGTGGGTGG + Intronic
1145126080 17:20301037-20301059 ACTGTGGCTCCTCCAGAGTGTGG - Intronic
1146403474 17:32518585-32518607 ACTGTGGTTGCTCATGAGGAGGG - Intronic
1146644556 17:34568410-34568432 GCTGTGTCTCCTCATCAGAGAGG - Intergenic
1147182280 17:38693906-38693928 ATAGAGTCTCCACATGAGGGAGG + Intergenic
1149282673 17:55125670-55125692 ACTGAGCCTCCTTAAGAGGGAGG - Intronic
1151065789 17:71148191-71148213 ACTGTGTTTCCTCAATAGAGAGG + Intergenic
1152561921 17:81082909-81082931 ACTCTGTCTGCTCATCTGGGCGG + Intronic
1153276597 18:3373760-3373782 ATAGAGTCTCCTCATGAGGCTGG - Intergenic
1156747304 18:40407633-40407655 ACTGTCTCTCCTCAGAAGTGGGG - Intergenic
1156882808 18:42101001-42101023 ACTGTGTCTTCACATGGGGAAGG + Intergenic
1157522111 18:48352489-48352511 ACTGTGCCTCCTCTTGGGGATGG - Intronic
1158231137 18:55256747-55256769 TCTTTCTCTCCTCATGATGGTGG - Intronic
1159195879 18:65113394-65113416 ACTGTATCACCTGATGAGGCTGG - Intergenic
1159813912 18:73049722-73049744 ACTGTTTCCCCACATGAGGTTGG + Intergenic
1163426408 19:17243267-17243289 ACTGTGTCTCCTCCAGACTGGGG + Intronic
1168435146 19:56310686-56310708 ACTGTATTTCCTCAGGACGGTGG - Intronic
925916833 2:8612962-8612984 ACTGTGTCTACTCATGAAAAGGG - Intergenic
929473333 2:42219181-42219203 ACTGTATTTCCTTATGAAGGGGG - Intronic
935833040 2:107020546-107020568 TCTATGTCTCCTGATGAGCGCGG + Intergenic
939934454 2:148273557-148273579 ACTGTTTCTATTCCTGAGGGTGG - Intronic
941536621 2:166730195-166730217 ACTGTGTCTCTTCAGTAGAGAGG - Intergenic
942162875 2:173210493-173210515 ACTGTGTCTGCTAGTGAAGGGGG + Intronic
943167883 2:184354361-184354383 ATTATGTATCCTCTTGAGGGAGG - Intergenic
943519395 2:188929462-188929484 ACAGTGTCTCCTAACCAGGGAGG - Intergenic
944682871 2:202092706-202092728 ACTGGATCTCCTCCTGAGGCAGG + Intronic
945351239 2:208783374-208783396 ACTGTCTCACCTCAAGGGGGTGG - Intronic
1169475832 20:5930423-5930445 AGTGTCTCTCCACCTGAGGGGGG - Intergenic
1172129947 20:32648983-32649005 AGTTTGCCTCCTCATGGGGGAGG - Intergenic
1172133664 20:32673170-32673192 CCTGGGGCTCCTCAGGAGGGCGG - Intergenic
1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG + Intergenic
1174490388 20:50889172-50889194 AGTGTGTTTCCTCATTAAGGTGG - Exonic
1175996793 20:62815551-62815573 ACTTGGACTCCTCAGGAGGGTGG + Intergenic
1176305558 21:5121324-5121346 GCTGTGGCTCCCCAGGAGGGAGG + Intronic
1178448980 21:32674453-32674475 ACTGTCTCCCCTCATGAGAATGG + Intronic
1178629326 21:34245541-34245563 ACTCTGTCTCATCTTGTGGGAGG + Intergenic
1179533932 21:42039317-42039339 ACTGTGTCCCCACATGGTGGAGG + Intergenic
1179851498 21:44140707-44140729 GCTGTGGCTCCCCAGGAGGGAGG - Intronic
1181637686 22:24181895-24181917 ATTGTGGGTCCTCATCAGGGTGG + Intronic
1182585864 22:31344088-31344110 ACTGTCTCTCCTCCTGGGGCCGG - Intronic
1184767488 22:46579165-46579187 TCTGGGTCTCCTGCTGAGGGAGG + Intronic
949450630 3:4181144-4181166 ATTGTGCTTCCTCATGATGGTGG + Intronic
950074873 3:10180326-10180348 AGACTGTGTCCTCATGAGGGCGG - Intronic
954463128 3:50638914-50638936 ACTGTGTTTCCTAATGGAGGAGG - Intronic
954820768 3:53325168-53325190 ACTGTTTCTCATCTTGAGAGAGG + Intronic
955350358 3:58189043-58189065 GCTGAGTCTCCTGATCAGGGCGG - Intergenic
956210679 3:66798503-66798525 ACTGTTTCTCCAAGTGAGGGAGG + Intergenic
957122843 3:76118459-76118481 ACTGTTTCTCCAAATGAGGGAGG + Intronic
957255951 3:77838189-77838211 ACAGTTTCTCCTCATTAAGGCGG - Intergenic
960056985 3:113282924-113282946 ACTGTGTGTCCTCGTGAGTCCGG + Intronic
962505639 3:136044342-136044364 ATTGTGTCTGGTCTTGAGGGCGG + Intronic
963071068 3:141305734-141305756 ACTGTGTCCACACATGGGGGTGG - Intergenic
963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG + Intergenic
968500987 4:950011-950033 TCTGTGTATCCGCATGTGGGAGG - Intronic
968853564 4:3101581-3101603 ACTTTGTCTTCTCATGAGTATGG + Intronic
971349333 4:25842634-25842656 GCTGTGTTGCCACATGAGGGAGG - Intronic
972129083 4:35807782-35807804 AGTGTGTTTCTTCATAAGGGAGG - Intergenic
972629359 4:40829863-40829885 ACTGTGTGTCCTCAGGAAGTTGG + Intronic
976440480 4:85067843-85067865 ATTCTGTCTCCTCATGAATGTGG + Intergenic
977979398 4:103305539-103305561 TCTGTGTTTCCTCATGATTGCGG + Intergenic
980136089 4:128860163-128860185 ACTTTGTCTTCTCATGACAGTGG + Intronic
985948023 5:3201794-3201816 ACTGTGTCTCCTGTTGAGTTGGG + Intergenic
988129947 5:27091394-27091416 GCTTTGTCTCCTCCTCAGGGTGG + Intronic
991614795 5:68484670-68484692 ACAGTGGCTCCTCAGGAGGTTGG + Intergenic
991991441 5:72343872-72343894 ACTGTGTCTACTTGTGTGGGGGG + Intronic
992638857 5:78751420-78751442 TCTGAGGCTCCTCATGAAGGAGG - Intronic
993633004 5:90310104-90310126 ACTGTGTCTTCTTTTGAGGCAGG - Intergenic
996274888 5:121652805-121652827 ACTGTATTTCCTAATGAAGGAGG - Intergenic
998533446 5:142907052-142907074 AGTATGTCACCTCAAGAGGGAGG - Intronic
999070176 5:148736243-148736265 CCTGTGTCTCCTGCTAAGGGTGG - Intergenic
999194736 5:149774227-149774249 ACGGTGTCCCCTCACTAGGGGGG - Intronic
999202985 5:149829420-149829442 CCTGTGGCTCCTCAAGAGTGTGG + Intronic
999553901 5:152720488-152720510 AACGTGTCTCCTCATGAGAGGGG - Intergenic
999696832 5:154194614-154194636 ACTGTGTGTCCTCAGGAAAGAGG + Intronic
1001673360 5:173492478-173492500 GCTCTGTCTCATCATAAGGGAGG - Intergenic
1004993983 6:21170302-21170324 ACAGTGTCTACTTATGAGGTTGG + Intronic
1006179280 6:32144433-32144455 ATTTTATTTCCTCATGAGGGAGG + Intergenic
1007732215 6:43954197-43954219 GCTGGGTCTCCTCATGGGGCAGG + Intergenic
1007781055 6:44255000-44255022 ACTGTGTCGCCCCATGAAGCGGG + Exonic
1010694052 6:78948501-78948523 ACTGTGTCTCCCAAAAAGGGGGG - Intronic
1013177778 6:107691837-107691859 ACTGTGTATCCTAAAGAGGTAGG - Intergenic
1016344925 6:143103344-143103366 AGTGTGGCTCCTAATGTGGGTGG - Intronic
1022114179 7:27248262-27248284 ACTGGGTCTGCACTTGAGGGTGG + Intergenic
1026304288 7:69126587-69126609 ACTGTGGCCCATCATGAGAGTGG + Intergenic
1028561477 7:92180336-92180358 GGAGTGTCTCCTCATGAAGGTGG - Intergenic
1029314093 7:99695655-99695677 ACTGCTTCTCCTCAGGAGGAAGG - Intronic
1029941459 7:104484737-104484759 GCTGTGTCATCCCATGAGGGGGG + Intronic
1033313142 7:140277009-140277031 ACTGTGTACCCTCATGGGGAAGG - Intergenic
1035053186 7:156015855-156015877 TCTTTGTCTCCTGTTGAGGGTGG + Intergenic
1035856883 8:2985438-2985460 ACTGTTTCACCACGTGAGGGAGG + Intronic
1036695330 8:10970632-10970654 AGTGTTTTTCCTCATCAGGGTGG + Intronic
1038612734 8:29070279-29070301 ACTGTGCCTCCTCAGGTGGATGG - Exonic
1040334712 8:46410145-46410167 ACTGTGTCTCCTGCGGAAGGCGG + Intergenic
1040709641 8:50172993-50173015 TCTGTGTCTCTTCATGAAGATGG + Intronic
1041726869 8:61026226-61026248 TCTGTGTCTTCTCATGAAGAGGG - Intergenic
1042682477 8:71401121-71401143 ACTGGGGCTTCTCAGGAGGGTGG + Intergenic
1043614941 8:82113986-82114008 ACTGTGTCTTCACATGGTGGAGG + Intergenic
1044618641 8:94167385-94167407 ACTGTGTCAGCTGATGGGGGAGG - Intronic
1045307933 8:100974845-100974867 ACTGGGGCTCCTCATGGGGATGG - Intergenic
1045901746 8:107290043-107290065 GCTGAATCTCCTCATGAGGAAGG + Intronic
1049742629 8:144248432-144248454 ACTGTGTCTCCTGCAGAGGAAGG + Intronic
1051032154 9:12694160-12694182 GCTGTGGCTCATCATCAGGGAGG + Exonic
1053869864 9:42479588-42479610 GCTGTCTTTCCTCAGGAGGGAGG - Intergenic
1054086431 9:60749566-60749588 GCTGTCTTTCCTCAGGAGGGAGG + Intergenic
1054241697 9:62620804-62620826 GCTGTCTTTCCTCAGGAGGGAGG + Intergenic
1054459531 9:65455335-65455357 CCTGAGTCCCTTCATGAGGGCGG - Intergenic
1054555823 9:66655327-66655349 GCTGTCTTTCCTCAGGAGGGAGG + Intergenic
1055501089 9:76902855-76902877 ACTGAGTATTCTCAGGAGGGAGG + Intronic
1057804765 9:98212163-98212185 GCTGTGACTGCTCAGGAGGGTGG - Intronic
1058276905 9:103054571-103054593 ATTGGGGCTGCTCATGAGGGAGG - Intergenic
1060748234 9:126151767-126151789 ATTGTGCCTCCCCAGGAGGGAGG - Intergenic
1061858206 9:133454669-133454691 GCTGTGGCTCCTCATGTGTGAGG + Intronic
1185765702 X:2724243-2724265 ACTATGTCACTTCATCAGGGAGG + Intronic
1186515837 X:10165519-10165541 GCTGTGTTTCCTTATGGGGGAGG + Intronic
1190503324 X:51100625-51100647 ACTGTATGTCCTAATGAGAGAGG - Intergenic
1193932979 X:87580401-87580423 ACTCTGTCTTTTCATGGGGGAGG - Intronic
1193988009 X:88270289-88270311 ACTCTGTCTCCTCTTGAGTGAGG + Intergenic
1196599490 X:117585382-117585404 ACTCTGACTCTTCATGAGAGGGG + Intergenic
1199117046 X:144005230-144005252 ACAGTGTCTCCTCATATGGCTGG + Intergenic
1199677716 X:150201651-150201673 ACTGTGTGTGCACATGAGGAAGG + Intergenic
1200563294 Y:4734266-4734288 CCTGTGCCTCTGCATGAGGGTGG - Intergenic
1201322132 Y:12711105-12711127 AATGTGTCTGCTCATGTGGCAGG + Intronic