ID: 1101137934

View in Genome Browser
Species Human (GRCh38)
Location 12:101764755-101764777
Sequence TTGGATTTGCAACTGGAACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101137934_1101137938 -4 Left 1101137934 12:101764755-101764777 CCATGTTCCAGTTGCAAATCCAA 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1101137938 12:101764774-101764796 CCAAGGTATTGAGACTCAACTGG 0: 1
1: 0
2: 0
3: 6
4: 72
1101137934_1101137939 -3 Left 1101137934 12:101764755-101764777 CCATGTTCCAGTTGCAAATCCAA 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1101137939 12:101764775-101764797 CAAGGTATTGAGACTCAACTGGG 0: 1
1: 0
2: 0
3: 2
4: 101
1101137934_1101137940 7 Left 1101137934 12:101764755-101764777 CCATGTTCCAGTTGCAAATCCAA 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1101137940 12:101764785-101764807 AGACTCAACTGGGCGTCTTTTGG 0: 1
1: 0
2: 1
3: 4
4: 64
1101137934_1101137941 11 Left 1101137934 12:101764755-101764777 CCATGTTCCAGTTGCAAATCCAA 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1101137941 12:101764789-101764811 TCAACTGGGCGTCTTTTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 72
1101137934_1101137943 30 Left 1101137934 12:101764755-101764777 CCATGTTCCAGTTGCAAATCCAA 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1101137943 12:101764808-101764830 AAGGAGTGAAATATTTACCAGGG 0: 1
1: 0
2: 1
3: 17
4: 292
1101137934_1101137942 29 Left 1101137934 12:101764755-101764777 CCATGTTCCAGTTGCAAATCCAA 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1101137942 12:101764807-101764829 GAAGGAGTGAAATATTTACCAGG 0: 1
1: 0
2: 1
3: 22
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101137934 Original CRISPR TTGGATTTGCAACTGGAACA TGG (reversed) Exonic
900922749 1:5684042-5684064 CTGGCTTTGCTACTGCAACACGG + Intergenic
901916657 1:12505500-12505522 TTAAAATGGCAACTGGAACAAGG + Intronic
902555554 1:17244612-17244634 TTGCATCTGCACCTGGAACGGGG + Exonic
905729397 1:40286282-40286304 TTAGACTAGCACCTGGAACATGG + Intronic
906083559 1:43110065-43110087 GTGGCTTTGGAACTGGAAAACGG - Intergenic
908134861 1:61120878-61120900 TTAGATTTAAAACTTGAACACGG + Intronic
908164112 1:61440827-61440849 ATGGATTTGAAAATGGTACAGGG - Intronic
908942600 1:69453973-69453995 GTGGCTTTGCAACTGGAAAGTGG + Intergenic
909073987 1:71031025-71031047 TATTATTTGCAACTGAAACATGG + Intronic
909163487 1:72185086-72185108 TTGGCCTGGCACCTGGAACATGG + Intronic
911674515 1:100644192-100644214 TAGGATTTGCAACTTCCACATGG - Intergenic
913006215 1:114634725-114634747 TGATATTTGAAACTGGAACACGG + Intronic
913176562 1:116278047-116278069 TCGGATTTGACACTGGAACTGGG + Intergenic
916259866 1:162830789-162830811 TTGGCTTTGGAACTTGGACATGG - Intronic
918638379 1:186807782-186807804 TTGGAGTAGCAGCTGGCACATGG + Intergenic
921625664 1:217375122-217375144 TTGAAGTTCCAACTGGAACATGG - Intergenic
921898140 1:220422589-220422611 TGGGATTTTGAACAGGAACATGG - Intergenic
922819348 1:228473408-228473430 TTGGATTTTCAACTGGACAGGGG + Intergenic
1064158640 10:12924576-12924598 GTGGATTAGAAACTGGAAAATGG - Intronic
1064815786 10:19260447-19260469 TTGAAATTTCAACTGGGACATGG + Intronic
1065276070 10:24086928-24086950 TTAGATTTCCAGCTGGTACAGGG + Intronic
1065317826 10:24481615-24481637 TTGGATTTCCAGCTGGCCCATGG - Intronic
1070765685 10:79054813-79054835 TTGGAGTTGGACCTGGAAGAAGG + Intergenic
1071128216 10:82360346-82360368 TTAGATTGGCCACTGTAACATGG - Intronic
1072658971 10:97350792-97350814 ATGGATTTGCAACTGGTGCCAGG - Intergenic
1073705668 10:105981185-105981207 TTGGATTTACAACTAGGACAGGG - Intergenic
1074567465 10:114593827-114593849 TTGAATTCCAAACTGGAACAGGG - Intronic
1076150034 10:128154422-128154444 TTGGATTTGGGTCTGGAATAAGG - Intergenic
1078147587 11:8732187-8732209 ATGGATTTGGAGCTGGGACATGG - Intronic
1079800023 11:24857533-24857555 TTGGATATGCACCTGAAAAAGGG - Intronic
1081673494 11:44954916-44954938 GTGCATTCTCAACTGGAACAGGG + Intergenic
1082816761 11:57514591-57514613 TTGGAGGGGCAACTGGAAGATGG - Intronic
1087521281 11:99240025-99240047 ATTGATGTGCATCTGGAACAAGG - Intronic
1088220276 11:107563370-107563392 TGAGATTTGAACCTGGAACATGG - Intronic
1089131932 11:116219165-116219187 CTGGAGATGCAACTGTAACAAGG + Intergenic
1090615380 11:128509514-128509536 TTGGATTTGAAAATGCACCATGG + Intronic
1090943282 11:131407747-131407769 CTGGCTTTGCAGCTGGAACCAGG + Intronic
1091358497 11:134956529-134956551 TTGGATTTTTAAGTGGAAAAAGG + Intergenic
1092891706 12:12975206-12975228 TTGGACTTGCAGCTGGAACTTGG + Exonic
1095812875 12:46389401-46389423 TTGAACTTGCTACTGGAAGAGGG + Intergenic
1095819138 12:46458209-46458231 TTGGAATAGCACCTGGTACATGG - Intergenic
1096591292 12:52660828-52660850 TTGAATTTTCAACTGCAAGAGGG - Intergenic
1099679941 12:85814328-85814350 TTGGTTTTAAATCTGGAACAGGG - Intronic
1100161592 12:91866926-91866948 TTGGACTTCCAACCAGAACATGG - Intergenic
1101137934 12:101764755-101764777 TTGGATTTGCAACTGGAACATGG - Exonic
1102335428 12:112074897-112074919 TTAGATTTGCAAAGGAAACATGG - Intronic
1103659674 12:122503696-122503718 TTAGATTTGTCACTGAAACACGG + Intergenic
1104312376 12:127665061-127665083 TGGGATCTGCATCTGGAAGATGG - Intergenic
1105995441 13:25666785-25666807 ATGGATTTGCAACTGAATTAAGG + Intronic
1106337495 13:28796893-28796915 TGGGTTTTGAAACTGGAATAGGG - Intergenic
1108868693 13:54954666-54954688 TTAGATTTGCTACTGAAAAATGG + Intergenic
1109083297 13:57935740-57935762 TTGGATATGCAACTCACACAAGG + Intergenic
1109391310 13:61697283-61697305 TTGGTTTTGGAACTGGAAAGAGG - Intergenic
1109835877 13:67856779-67856801 TTAGATTTTTAACTAGAACAAGG - Intergenic
1110462851 13:75765412-75765434 TTGGATCTGCAACTTGAGCATGG + Intronic
1111136926 13:84059308-84059330 TTAAATATGCATCTGGAACAGGG + Intergenic
1112297668 13:98202502-98202524 TTGTATTTAAAACTGGAAGAGGG + Intronic
1112780253 13:102892650-102892672 TTGAAATTGGAGCTGGAACAGGG + Intergenic
1113342347 13:109439380-109439402 TTGGATTTATTACTGGATCAAGG + Intergenic
1119436965 14:74603832-74603854 TTAGATTTGCAAGTAGAATAGGG - Intronic
1120612397 14:86658234-86658256 TTGGCTTGGCCACTGGTACAGGG - Intergenic
1121478774 14:94241847-94241869 TTGGGTTTGCAACAAGAAAATGG + Exonic
1127643510 15:60937387-60937409 TTGGCTTTCCAACTAGAAGATGG - Intronic
1137879886 16:52034996-52035018 TTGGAGGTACAGCTGGAACAGGG - Intronic
1138317452 16:56082432-56082454 TTGGATCTGGAACTGGATAATGG - Intergenic
1139748223 16:69091698-69091720 TAGTATTTGCACCTGGGACACGG - Intergenic
1141151118 16:81565320-81565342 TGGGATCTGCATCTGGAACAGGG - Intronic
1141604217 16:85143807-85143829 TGGGGGTTGCACCTGGAACATGG - Intergenic
1142725174 17:1808294-1808316 TTAAATTTTCCACTGGAACATGG - Intronic
1144379095 17:14675249-14675271 TTGGCTTTACAGCTTGAACAAGG - Intergenic
1148652122 17:49257809-49257831 TTGGTTTTGCACCTGTAAAATGG + Intergenic
1149258203 17:54850854-54850876 CTGGATTTGCAAATGAGACAGGG + Intergenic
1153894982 18:9550676-9550698 TAGTATGTTCAACTGGAACATGG + Intronic
1154496455 18:14964689-14964711 TTGGATTTTTAAGTGGAACAAGG - Intergenic
1155052717 18:22162859-22162881 TGGCATTTGCAAGGGGAACAAGG + Intergenic
1155516921 18:26632836-26632858 TTGGATATGAAAATGGAATATGG + Intronic
1156006039 18:32442877-32442899 TTGTATTTGCTACTGTAAAAGGG + Intronic
1156194380 18:34757250-34757272 TTGGATTTGTAACTGCACAAAGG - Intronic
1156473007 18:37389129-37389151 TTGGAGATGCACCTGAAACATGG + Intronic
1159495933 18:69204777-69204799 TTGGATATGCAAGTGAAAAATGG - Intergenic
1167798052 19:51723530-51723552 TTGGATTTGCCTGTGGCACATGG - Intronic
925153354 2:1632646-1632668 GAGGATGTGCACCTGGAACACGG + Exonic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929135745 2:38622249-38622271 TTGGAATTCTAACTGGAATAAGG - Intergenic
929206413 2:39299782-39299804 TAGGATCTGCAACTGGAATATGG - Exonic
930342258 2:50132026-50132048 TTAGAATTGCAAATGGAAAAAGG - Intronic
935996270 2:108777151-108777173 TTGGATTTGGAAGTAGCACAGGG + Exonic
936257774 2:110931688-110931710 TTGAATTTGCATCTGTAAAATGG - Intronic
937389824 2:121475469-121475491 CTGTATCTGCAACTGGACCATGG + Intronic
937835615 2:126467856-126467878 TGGGATCTGAAACTGAAACAAGG + Intergenic
939681155 2:145134827-145134849 TAGGATTTGCCACTTGTACATGG - Intergenic
940219228 2:151334449-151334471 TTTTGTTTGCAACTGAAACATGG + Intergenic
942596631 2:177597656-177597678 TTGGATATGATACTGGAACTTGG - Intergenic
944179159 2:196868212-196868234 TTGGAATAGTAACTGGTACATGG + Intronic
944834182 2:203562000-203562022 ATGGAATTTCAACTAGAACAGGG + Intergenic
1169901355 20:10555743-10555765 TTGGAATTGAAATAGGAACATGG - Intronic
1171429681 20:25074222-25074244 TTGGTTTTTCAACTGTAAAATGG - Intronic
1172392677 20:34576523-34576545 CTGGATTTGCAGCTGGAAGGGGG - Intronic
1173614298 20:44392883-44392905 TTCGCTTGGCAAGTGGAACAAGG + Intronic
1175272778 20:57746581-57746603 TTGGATCTCCCACTTGAACATGG + Intergenic
1175578426 20:60080015-60080037 TTGGTTTTGTAAATCGAACAGGG - Intergenic
1177146786 21:17415244-17415266 TGGGAATTGCTACAGGAACACGG - Intergenic
1178787508 21:35667456-35667478 TGGGATTTGCACCTGGTAAAGGG - Intronic
1180985124 22:19899506-19899528 TTGGATGTGCCTCTGGCACATGG - Intronic
1181068635 22:20319198-20319220 TTTGATGTGCAACTGGAATGAGG + Intronic
1184613906 22:45624899-45624921 TGGGAGTGGCATCTGGAACAAGG + Intergenic
949721755 3:6998238-6998260 TTGGATTTCCAACTTGAATGGGG - Intronic
950067517 3:10124852-10124874 TTGGCTTTGAAAGTGGAAGAAGG - Intronic
951139143 3:19141123-19141145 CTGGATGTGCAACTGTAACATGG + Intergenic
951223521 3:20094641-20094663 GTGGGTTTGCAGCTGGATCACGG + Intronic
951858620 3:27225770-27225792 TTGGATTTGCAAGTGAGAAATGG - Intronic
954494685 3:50945601-50945623 TTAAATTTGCAAATGGAAGATGG + Intronic
956858090 3:73295536-73295558 ATGGATTAGCAACAGGAAAATGG + Intergenic
957561688 3:81830227-81830249 ATGGAATTGGAAATGGAACATGG + Intergenic
959597023 3:108139974-108139996 TTGGATTTTCAACTGCATGAGGG + Intergenic
960079485 3:113526040-113526062 TTGGATTTGCAACTGGATTGAGG + Intergenic
960853364 3:122078427-122078449 CTGGATTTCCCACTGGCACAGGG - Intronic
961106838 3:124249778-124249800 TTGGATCTTGAAATGGAACAGGG - Intronic
962735632 3:138322937-138322959 TTGTCTGGGCAACTGGAACATGG - Intronic
962935671 3:140078302-140078324 TTGGATTGGAAATTAGAACATGG + Intronic
966630686 3:182071026-182071048 GTGGCTTTGGAACTGGATCATGG - Intergenic
970986489 4:22165074-22165096 TTGTTTTTACAACTGGAACAAGG - Intergenic
972631609 4:40847045-40847067 TTAAAGTTGAAACTGGAACATGG - Intronic
973239033 4:47937498-47937520 TTGGATTTGGAAATGATACATGG - Exonic
975238941 4:72034011-72034033 ATGGATTTCCAGCTGTAACATGG + Intronic
976932595 4:90587084-90587106 CTGGCTTTGCAAATGGATCAAGG + Intronic
977376551 4:96212302-96212324 TTGCATCTGCCACTGCAACATGG + Intergenic
978495517 4:109355615-109355637 TTGGATCTCCAACTGGAACTTGG - Intergenic
979419387 4:120485224-120485246 TTTTATTTGAAAATGGAACATGG + Intergenic
985275451 4:188233582-188233604 TTAGATTTTCATCTGAAACATGG - Intergenic
986760181 5:10872936-10872958 TAGGGTATGGAACTGGAACAGGG - Intergenic
986994115 5:13586686-13586708 TTGAATTTCCCACTGGCACAAGG - Intergenic
987941214 5:24540517-24540539 TTGGATTAGAAAATTGAACATGG + Intronic
988270452 5:29007822-29007844 TTGGTTTTACTACTGGAAAAGGG + Intergenic
989330405 5:40251680-40251702 CTGGATTTTCAACAGGTACAGGG + Intergenic
992689928 5:79232086-79232108 GTGGATTTGCAAATGGACCCCGG + Intronic
992751118 5:79862721-79862743 TTGGATCTGCAAAAGGAATAAGG - Intergenic
994010318 5:94894767-94894789 CTGGAGTTGCAGCTGGAAGAGGG - Exonic
996131870 5:119791268-119791290 GTAGTTTTGCAACTGGAGCAAGG + Intergenic
996599870 5:125250597-125250619 TTGGACTTGGAATTGGAACTGGG - Intergenic
996995553 5:129692662-129692684 ATGGCTTGGCAAATGGAACATGG - Intronic
997827255 5:137117297-137117319 ATGGATTTGAAGCTTGAACAAGG - Intronic
999304560 5:150511343-150511365 TTGTTCTTGCAACTAGAACATGG - Intronic
999754961 5:154657430-154657452 TTGGGTCTCCAGCTGGAACAAGG - Intergenic
999931509 5:156438038-156438060 CTGGATTTGCAACTTTAAAATGG + Intronic
1000414415 5:160968255-160968277 TAGGAATAGCAACAGGAACATGG - Intergenic
1001459704 5:171900486-171900508 TTGGCTTTACTACTGGAACTCGG + Intronic
1001840034 5:174867948-174867970 TTGGACTTGTAACGGGAAGAAGG - Intergenic
1003040313 6:2681858-2681880 TTTGATTGGCAACTGGAACTAGG - Intronic
1003204692 6:3997135-3997157 TTGGATTGGCAAGTTAAACAGGG - Intergenic
1004842054 6:19598638-19598660 TTGTATTGGCATCTGGATCATGG + Intergenic
1006664534 6:35682635-35682657 TAGGATTTGCAACTACAAAAGGG + Intronic
1009195062 6:60674421-60674443 CAGCATTTTCAACTGGAACATGG + Intergenic
1011117377 6:83908374-83908396 TTTGATTTGCAAATGCAACTAGG - Intronic
1011722422 6:90171476-90171498 TTGGATTTGGAAAGGGCACATGG - Intronic
1012945256 6:105459133-105459155 AAGGATTTGCAACAAGAACATGG - Intergenic
1014178332 6:118354468-118354490 TTGGATGTTCTAATGGAACATGG - Intergenic
1014558108 6:122857397-122857419 TTTGATTTGGTACAGGAACAAGG - Intergenic
1014845796 6:126275389-126275411 TTATATTTGCAACTGACACAGGG + Intergenic
1016548667 6:145252665-145252687 TTTGATTTGCAACAAAAACAAGG - Intergenic
1016617590 6:146070496-146070518 TTGCATTTCCAATTGGATCACGG + Intronic
1018788656 6:167129195-167129217 TTGTACTTGCACCTGGATCATGG + Intronic
1020019968 7:4859707-4859729 TTGGATTTGCAGGGAGAACAGGG + Exonic
1022157526 7:27675312-27675334 ATGGTTTTGCAACTGGAACCAGG + Intergenic
1027797073 7:82709140-82709162 TTTCATTTGGAACTGGAAAATGG - Intergenic
1031827172 7:126580231-126580253 TTGGATTTCAACTTGGAACATGG - Intronic
1033763534 7:144462894-144462916 TTGGCTCTTTAACTGGAACATGG - Intronic
1034295678 7:149970222-149970244 TTGAATTTGCACCTGGAAATGGG - Intergenic
1034810379 7:154126683-154126705 TTGAATTTGCACCTGGAAATGGG + Intronic
1035785815 8:2259945-2259967 TTGTAATTAAAACTGGAACACGG + Intergenic
1035806992 8:2461771-2461793 TTGTAATTAAAACTGGAACACGG - Intergenic
1036426953 8:8653874-8653896 CTGGATTTGCAACTGGAGGAGGG - Intergenic
1043812539 8:84759047-84759069 TTGGCTTTGAATATGGAACAAGG - Intronic
1044940556 8:97337814-97337836 TATGATTTGCAACAGGATCAAGG + Intergenic
1045017637 8:98012742-98012764 GTGGATGTGCAGCTGGACCAGGG + Intronic
1046316029 8:112502619-112502641 TTGCATTTGCCATAGGAACAGGG - Intronic
1047818224 8:128488487-128488509 TGGGATTTGTAACTGCCACAAGG - Intergenic
1050996213 9:12220971-12220993 TTGGATTTGAAAATCAAACATGG - Intergenic
1053467807 9:38323851-38323873 TGGGCTTTCTAACTGGAACAAGG - Intergenic
1057893124 9:98884554-98884576 CTGGATATGAAACTGGAGCAAGG - Intergenic
1058644239 9:107115916-107115938 CTGGATTAGAAACTGGAAGATGG + Intergenic
1058942217 9:109823674-109823696 TTGGATTTCCCACAGTAACAGGG - Intronic
1061004051 9:127918394-127918416 TTGGCTTTGAACCTGGAGCAGGG - Intergenic
1185713484 X:2322844-2322866 TTGGATTTTCAACTGTGCCAGGG + Intronic
1192584912 X:72312008-72312030 TTGGAATTGGAACTGGAGTATGG - Intergenic
1193913657 X:87338471-87338493 TTAGATTTGCACTTGGAAAATGG + Intergenic
1194616371 X:96108590-96108612 TGGGATTTGCAATTGGAAACTGG + Intergenic
1196744011 X:119052207-119052229 TTGGCTTTCCACCTGGCACAAGG - Intergenic
1196947304 X:120840502-120840524 CTGAATTTGGAAGTGGAACAGGG + Intergenic
1198675932 X:139130245-139130267 TTGTCTTTTCATCTGGAACAAGG + Intronic
1199252502 X:145679331-145679353 TTTGAGTTGCATCTGGAACCTGG - Intergenic
1202189904 Y:22231154-22231176 TTTAATTTTCTACTGGAACATGG - Intergenic