ID: 1101139717

View in Genome Browser
Species Human (GRCh38)
Location 12:101782809-101782831
Sequence ATGTTTGAAGAAAAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 12, 3: 61, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101139717_1101139723 13 Left 1101139717 12:101782809-101782831 CCTCCTGGCTTTTCTTCAAACAT 0: 1
1: 0
2: 12
3: 61
4: 447
Right 1101139723 12:101782845-101782867 CTGCCTCAGGGCCTTTGCAATGG 0: 2
1: 61
2: 193
3: 337
4: 651
1101139717_1101139719 0 Left 1101139717 12:101782809-101782831 CCTCCTGGCTTTTCTTCAAACAT 0: 1
1: 0
2: 12
3: 61
4: 447
Right 1101139719 12:101782832-101782854 GCCAGATACACTCCTGCCTCAGG 0: 1
1: 2
2: 15
3: 57
4: 384
1101139717_1101139721 1 Left 1101139717 12:101782809-101782831 CCTCCTGGCTTTTCTTCAAACAT 0: 1
1: 0
2: 12
3: 61
4: 447
Right 1101139721 12:101782833-101782855 CCAGATACACTCCTGCCTCAGGG 0: 1
1: 0
2: 16
3: 96
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101139717 Original CRISPR ATGTTTGAAGAAAAGCCAGG AGG (reversed) Intronic
900583090 1:3418921-3418943 ATGTTTGAGGATGAGGCAGGAGG + Intronic
901139015 1:7016014-7016036 ATGTTGGAGGAAGAGCCTGGGGG - Intronic
901259367 1:7860374-7860396 CTGTTTGAGGAACAGCCAGGAGG + Intergenic
901574513 1:10189996-10190018 ATGTTTCAAGAATAGCACGGAGG + Intergenic
902571493 1:17349879-17349901 AAGTTTGAAGAACAGGAAGGAGG - Intronic
902790594 1:18765300-18765322 ATTTTGGAGGAAAAGCCAGCAGG + Intergenic
903232446 1:21930132-21930154 ATGTCTGTGGAAAAGCAAGGAGG - Intronic
905142169 1:35856108-35856130 GTGGTGGAAGAAAAGCCGGGAGG + Exonic
905198673 1:36301472-36301494 ATGTTTGAACAAAAAGCAGGGGG + Intronic
905824862 1:41019987-41020009 TTGTGTGAAGAAAGGCCACGAGG - Intronic
905958990 1:42027558-42027580 CTGTGTGAAGAACAGCAAGGAGG - Intronic
906359120 1:45137676-45137698 ATGTTCAAAGAATAGCAAGGAGG + Intronic
906815769 1:48876680-48876702 ATGTTGGAAGAGAAGGCAGAGGG - Intronic
907291547 1:53416625-53416647 CTGTTTGCATAGAAGCCAGGGGG + Intergenic
907382215 1:54100563-54100585 ATGTTTGAACCAAAGCCAGAAGG + Intronic
909422902 1:75485974-75485996 ATGTTGGAAGAGAGGCCTGGTGG - Intronic
910446921 1:87308200-87308222 ATATTTGAAGAAATGCAAGATGG - Intergenic
910527965 1:88202639-88202661 ATGTTTGAGAAAAAGCAAGAAGG + Intergenic
910622990 1:89276230-89276252 ATGTTTGTAGACAAGCCAGCAGG - Intergenic
910662544 1:89689248-89689270 AATGTTGAAGAAAAGCCATGAGG + Intronic
910668024 1:89745025-89745047 CTGTTTGAAGAATGGCAAGGAGG - Intronic
910983973 1:92986512-92986534 ATGTATGAAGAAAATTCAGTGGG - Intergenic
911390453 1:97234624-97234646 ATGTATTAAGAAAAGACAGTGGG + Intronic
913370110 1:118089296-118089318 ATATTTGAGGAAAAACCAGAAGG + Intronic
914686442 1:149984084-149984106 GTGTTTCAATAAAAGCAAGGTGG - Intronic
915296883 1:154927681-154927703 GTGTCTGAGGACAAGCCAGGTGG - Intronic
915598682 1:156909206-156909228 GTGGTTGAAGAAAAGCAAAGTGG - Intronic
917089514 1:171338521-171338543 ATGTTTGAGGAACAGGTAGGAGG - Intronic
917247595 1:173021498-173021520 ATGTTTGCAGAATATCCAAGTGG - Intergenic
917628764 1:176872728-176872750 ATGTTTGAAGAAGAGGAAGGAGG - Intronic
918083174 1:181222956-181222978 ATGTGTGGAGAAAGGCCAAGAGG - Intergenic
918224631 1:182470410-182470432 ATGTTTGAGGAATTGCAAGGAGG - Intronic
918754346 1:188318444-188318466 GTGGAAGAAGAAAAGCCAGGTGG + Intergenic
918993718 1:191730195-191730217 GTGTTGGAGGAAAAGCCTGGTGG - Intergenic
919486573 1:198155200-198155222 ATGTTTGAGAAATAGGCAGGAGG - Intergenic
920193797 1:204212880-204212902 GTGTTTGAAGAACAACAAGGAGG - Intronic
920328145 1:205183194-205183216 ATGCTTGAAGGAAAGGCAGGAGG + Intronic
920698258 1:208198351-208198373 GTCTTTGAAGAAGAGCCCGGGGG + Intronic
921915992 1:220611145-220611167 ATGGTTGAACAAAAGGCAGCAGG - Intronic
921941462 1:220844307-220844329 CTGTGCGAAGAAAAGCCAGCAGG + Intergenic
923389744 1:233502319-233502341 GTGTTTGAAGAGTAGCCAAGAGG + Intergenic
923422423 1:233830455-233830477 ATGTTTGATGAAGGGCCTGGTGG - Intergenic
923628980 1:235637081-235637103 ATCTTTACAGAAATGCCAGGAGG - Intronic
1063240251 10:4161902-4161924 GTGTTGGAAGAGAAGCCTGGTGG - Intergenic
1064381831 10:14849962-14849984 ATATTTGATGAAATGCCAAGAGG + Intronic
1065953303 10:30671572-30671594 ATTGTTGAAGAAAAGCGGGGAGG + Intergenic
1067233540 10:44427914-44427936 ATGCTTAAGGAAAAGTCAGGAGG - Intergenic
1067988427 10:51180447-51180469 ATCTTTGAAGTAAAGACAGCTGG + Intronic
1068693969 10:59946236-59946258 GTGTTTGAGAAAGAGCCAGGAGG + Intergenic
1068855867 10:61796658-61796680 ATGTTTGAGGAAAACCAAGGTGG - Intergenic
1069060372 10:63888554-63888576 ATGTTTGAGGAACAGCAAGGAGG + Intergenic
1069333261 10:67318617-67318639 ATGTTTGAGAAAGAGCAAGGAGG - Intronic
1070035716 10:72721515-72721537 ATGTTTGAGGAATAGCAAGGAGG - Intronic
1070533942 10:77361488-77361510 TTGCTTGCAGAAAATCCAGGGGG - Intronic
1070897826 10:80000205-80000227 ATGTTTAAGAAAAAGCAAGGAGG - Intergenic
1071962876 10:90823730-90823752 ATGCTGGAAGAGAAGCCTGGTGG + Intronic
1072618292 10:97063907-97063929 GTGTTTGAAAATGAGCCAGGTGG - Intronic
1073095369 10:100976361-100976383 ATGTCTGAAAAAAAGTCAAGTGG - Intronic
1074047418 10:109851417-109851439 CTTTCTGAAGAAAGGCCAGGGGG - Intergenic
1074440091 10:113470660-113470682 CTGTTTCAAGTAAAGCAAGGTGG + Intergenic
1074441784 10:113484012-113484034 ATGTATGAAGCAAAGGGAGGAGG + Intergenic
1074843452 10:117376139-117376161 AAGTTGAAAGAACAGCCAGGAGG + Intergenic
1075827142 10:125368414-125368436 ATGTATCAAGAAAAGAGAGGAGG - Intergenic
1077321098 11:1942303-1942325 TGGTTGGGAGAAAAGCCAGGTGG + Intergenic
1077769699 11:5202825-5202847 ATGTTTGTAGAAAAGCAATTTGG - Intergenic
1077798212 11:5513181-5513203 ATGTTTTAAGAATAACAAGGAGG - Intronic
1078001484 11:7500286-7500308 TTGCCTGAAGAAAAGCCAGCAGG - Intronic
1078133032 11:8629044-8629066 AGGGTTGAAGAGAAGCAAGGTGG + Intronic
1078451965 11:11447123-11447145 ATGTTTGAGGAAGAGGAAGGAGG - Intronic
1079176680 11:18148375-18148397 TTGCTTGAGGAAAAGTCAGGAGG + Intronic
1079504303 11:21136249-21136271 ATGTGTGAGGAAAAGACAGAAGG + Intronic
1079785559 11:24667113-24667135 ATATAAGAAGAAAAGTCAGGAGG - Intronic
1080171749 11:29312068-29312090 ATAATTGAAGAAAAAACAGGTGG + Intergenic
1080878106 11:36295038-36295060 ATTTTTAAAGAAAAGCCAGAAGG - Intergenic
1080924325 11:36740240-36740262 ATGTTTGAAGAACATCAAGGAGG + Intergenic
1081086233 11:38804542-38804564 ATGGTTCAAGGAAAGGCAGGAGG + Intergenic
1082059143 11:47845826-47845848 ATTTTTTAAAATAAGCCAGGCGG - Intronic
1082771419 11:57210717-57210739 AAGTTGCAGGAAAAGCCAGGGGG + Intergenic
1082860095 11:57847321-57847343 CTGTTAGAAGAAAATACAGGGGG + Intergenic
1083939658 11:65888754-65888776 AAGGTGGGAGAAAAGCCAGGAGG - Intergenic
1084460575 11:69294598-69294620 ATGTTTTAAGGAAAGCCCTGTGG + Intronic
1084886810 11:72215887-72215909 ATGTTTTCAGAAATGCCAGATGG + Intergenic
1085287697 11:75374882-75374904 ATGGCTGAAGAACAGCAAGGAGG + Intergenic
1085849519 11:80103440-80103462 AAGGTTGAAGAAAAGGAAGGGGG - Intergenic
1086234373 11:84610488-84610510 ATCTTGGAAGAGAAGTCAGGTGG + Intronic
1086482008 11:87251308-87251330 ATGTTTGAAGCATAGGCAGTAGG + Intronic
1086848330 11:91779251-91779273 GTGTTTGATGAACATCCAGGGGG - Intergenic
1086885420 11:92200078-92200100 ATGCTGGAGGAACAGCCAGGAGG + Intergenic
1087282895 11:96232214-96232236 CCGTTTGAAGAAAAGGCACGTGG - Intronic
1087660848 11:100986370-100986392 ATGTTTGAAGGAAAGAAAGAGGG + Intronic
1087676882 11:101173876-101173898 ATGTATGAAGAAAATGGAGGGGG + Intergenic
1087940697 11:104093485-104093507 CTGTTTGAAGGCAAGCGAGGAGG - Intronic
1088191187 11:107230032-107230054 CTGTTTGAAGAATGGCCAGTTGG + Intergenic
1088684513 11:112273767-112273789 AAGAGTGAAGAAAAGCCGGGTGG + Intergenic
1090806108 11:130203303-130203325 ATGTTTCAGGAACACCCAGGAGG - Intronic
1091314057 11:134598375-134598397 AAGTAGGAAGAAAAGCCAGACGG - Intergenic
1091427778 12:406411-406433 ACGTTTGAAGAACAGCCAAGAGG + Intronic
1091684834 12:2554369-2554391 ATTCTTGAAGAAGAGCGAGGAGG - Intronic
1093368700 12:18337743-18337765 ATGTTGGAAGTGAAGCCTGGTGG - Intronic
1093759944 12:22897984-22898006 ATGTTTGAAGAAACTCCTGTTGG + Intergenic
1093813383 12:23513677-23513699 ATGATTGAAGCAAAACAAGGTGG + Intergenic
1094188351 12:27669514-27669536 ATTTTTAAAGAAAAGCCAGGAGG + Intronic
1094422627 12:30287591-30287613 ATTTCTGCAGAAAAGCCAGCTGG + Intergenic
1094789851 12:33899727-33899749 ATATTTGGAGAAAAGGAAGGAGG - Intergenic
1095196307 12:39322677-39322699 ATCTTAGAAGGTAAGCCAGGTGG + Exonic
1095744861 12:45646621-45646643 ATAACTGAAGAAAAGCCAGGAGG - Intergenic
1096293541 12:50362923-50362945 ATGCTTTAAAAAAAGCAAGGAGG + Intronic
1096444858 12:51680438-51680460 TTGGTTGAAGAAAAACTAGGAGG - Intronic
1097936717 12:65260673-65260695 ATTATTGCAAAAAAGCCAGGTGG + Intergenic
1097964993 12:65569637-65569659 ATATTTGAAGATAACCCATGTGG + Intergenic
1098335776 12:69403017-69403039 ATGTTTGAAAAATAGCAAGCCGG - Intergenic
1098420572 12:70292560-70292582 GTGTTTGAGGAATAGCAAGGAGG + Intronic
1099361734 12:81710894-81710916 GTGTTTAAAGAAAATTCAGGTGG - Intronic
1100381935 12:94070596-94070618 ATGTTTGAGCAAAGGCCTGGAGG + Intergenic
1100403197 12:94250130-94250152 ATGTTTGAAGAGCAGCAAGGAGG + Intronic
1100560164 12:95740270-95740292 AAGTTTGAAGAAAAACTGGGTGG - Intronic
1100729938 12:97453790-97453812 ATGTTTGAAGAAATGGAGGGAGG - Intergenic
1100811003 12:98338300-98338322 AGGTGTGAAGAAAAGCCACATGG - Intergenic
1101103159 12:101414703-101414725 ATATTTGAAGAGAAGCCACCAGG + Intergenic
1101112723 12:101501815-101501837 ATTTTTGGAGATTAGCCAGGTGG - Intergenic
1101139717 12:101782809-101782831 ATGTTTGAAGAAAAGCCAGGAGG - Intronic
1101848472 12:108383003-108383025 ATGTTTGAGGAAAAACAAGGAGG + Intergenic
1102042995 12:109812443-109812465 ATGATTGAAGAAGACCCAGGAGG + Intronic
1102253135 12:111401050-111401072 GAGTTTGAGGAACAGCCAGGAGG + Intergenic
1102500819 12:113351139-113351161 ATGTTTTAAGAACATCAAGGAGG + Intronic
1102694132 12:114785057-114785079 ATGTTTGAAGAAGAGCAAGGAGG + Intergenic
1102717541 12:114987109-114987131 ATATTTGAGGAAAAGCCCAGGGG - Intergenic
1103269923 12:119664813-119664835 ATGTTTGTAGACAGGCCAGCTGG + Intergenic
1104072054 12:125354298-125354320 ATATTTGAAAGAATGCCAGGTGG - Intronic
1105876212 13:24555568-24555590 ATGTTAAAAGAAAAACTAGGGGG - Intergenic
1105914454 13:24900262-24900284 GTGTTCAAAGAACAGCCAGGAGG + Intronic
1106188294 13:27427650-27427672 ATGTGTGTAAAAAAGCTAGGGGG + Intronic
1106426831 13:29639132-29639154 ATGTTTGAAAAGAAGAAAGGTGG + Intergenic
1107131397 13:36900123-36900145 ATGTTTGAGGGAAAGTAAGGAGG - Intronic
1107708968 13:43133994-43134016 ATGTTTGAGGAACAGCCGGGCGG + Intergenic
1108394837 13:49982035-49982057 ATGTTTGAGGAATAGCAAGGAGG + Intergenic
1108804735 13:54140543-54140565 ATGTTCAAGGAACAGCCAGGAGG - Intergenic
1108893697 13:55295493-55295515 ATGTTGGAGGCAAAGCCTGGTGG + Intergenic
1110064894 13:71091271-71091293 ATGTTTCAAGGAAAGCCATACGG - Intergenic
1110420841 13:75306262-75306284 TTTTTTAAAGAAAAGCCTGGGGG - Intronic
1110636188 13:77769132-77769154 GTGTTTGAGGAAGAGCAAGGAGG + Intergenic
1112603514 13:100880365-100880387 ATATTTGCAGAAGAGCCAGGAGG - Intergenic
1112668413 13:101604266-101604288 ATGTTTGAGGAAAAACCTAGTGG - Intronic
1113334255 13:109363080-109363102 ATATTTGAAGAAAAGGAAGGAGG + Intergenic
1113974475 13:114216253-114216275 ATGTCTGAAAACAAGCCGGGAGG - Intergenic
1115465906 14:33713904-33713926 GTGTTTGAGGAATAGCAAGGAGG - Intronic
1116182280 14:41550229-41550251 ATATTTGAGGAAAAACAAGGAGG + Intergenic
1116570104 14:46505545-46505567 ATGATTGACTAAAAGCTAGGGGG - Intergenic
1116862551 14:50006268-50006290 GTGTTTGTGGGAAAGCCAGGAGG - Exonic
1117780762 14:59229593-59229615 ATTTTTGAAGTAAATCCAGTAGG + Intronic
1117780928 14:59231129-59231151 ATGTTTGAAGAAAAAGGAAGTGG - Intronic
1118058820 14:62113370-62113392 ATGGAGGAAGAAAAGCCATGAGG + Intergenic
1118119500 14:62823079-62823101 ATGTTTCCAAAAGAGCCAGGTGG - Intronic
1118235943 14:64005063-64005085 GTGTTTGAGGAAAGGCAAGGAGG + Intronic
1119967593 14:78934396-78934418 ATGGATGAAGAGAACCCAGGGGG + Intronic
1120157767 14:81112847-81112869 ACGTTTGAGGAATAGCAAGGAGG + Intronic
1120926660 14:89803915-89803937 ATGTGTTAAGAAAAGCCATTCGG + Intronic
1121409868 14:93742494-93742516 ATGTTTGCAGAAGAAGCAGGTGG + Intronic
1121661529 14:95638820-95638842 ATGTTTGAGGCATTGCCAGGAGG + Intergenic
1121719207 14:96097541-96097563 CTGCTGGAAGGAAAGCCAGGAGG + Intergenic
1121943429 14:98095108-98095130 ATGGAACAAGAAAAGCCAGGAGG + Intergenic
1124101542 15:26698749-26698771 ATCTGTGAACACAAGCCAGGCGG - Intronic
1125495752 15:40192016-40192038 ATTTCTGCAGAAAAGCCAGCTGG + Intronic
1125729463 15:41884816-41884838 AGGTTTGAAAAATAGCCTGGAGG - Intronic
1125785337 15:42311762-42311784 ATGTTGGAAGAGGAGCCTGGTGG - Intronic
1127223058 15:56900383-56900405 ATGTTTAAAGAAAGGCTAGCCGG - Intronic
1127369043 15:58319347-58319369 ATTTTTTAAAAAAAGCCATGTGG - Intronic
1128527289 15:68421301-68421323 GTGTTTGAAGAACAGCCCGGAGG + Intronic
1129794884 15:78368626-78368648 ATGCTTCATGAAAAGCCAGAAGG + Intergenic
1130059036 15:80556385-80556407 AGGTTTGCAGAAGAGACAGGTGG + Intronic
1130457420 15:84126425-84126447 ATGATTGAAGACAAGTTAGGAGG - Intergenic
1133105893 16:3509275-3509297 GTGTTTGAGGAAAAGCAAGGAGG + Intronic
1133626759 16:7577332-7577354 ATGTATGAAGGGAAGGCAGGAGG - Intronic
1133726656 16:8543669-8543691 ATGTTAGAAGAAAGGTCAGGAGG - Intergenic
1133874046 16:9716482-9716504 GTGTTTGAGGAACAGGCAGGAGG + Intergenic
1134041325 16:11070733-11070755 GTGTTTGAAGAAGAGCAAGGAGG - Intronic
1134332963 16:13267118-13267140 ATGTTTAAAAAGAAGCCAAGTGG + Intergenic
1135236688 16:20763429-20763451 GTGTTTGAGAAAAAGCAAGGAGG + Intronic
1135485322 16:22859964-22859986 ATGTTTGAGGAAGAGCAATGTGG - Intronic
1135645826 16:24160921-24160943 GTGTTTGAGGAACAGCGAGGAGG + Intronic
1135958129 16:26973449-26973471 GTGTTTCAAGAAAGGCCAGATGG - Intergenic
1137405479 16:48185849-48185871 AGGTTTGAAGGATAGCAAGGTGG - Intronic
1137511402 16:49103987-49104009 ATGCTTGTGGAAAAGCCAAGTGG - Intergenic
1137731083 16:50691022-50691044 ATATTTGAGGAACAGCCAGGAGG + Intergenic
1138150173 16:54649647-54649669 ATGTTTGAGGAGCAGCAAGGTGG + Intergenic
1138744194 16:59344301-59344323 AAGTTTGAAGAAAGCCCTGGGGG - Intergenic
1138856881 16:60704938-60704960 ATGTTTGCAGAAAATGCAGAGGG - Intergenic
1138902316 16:61287670-61287692 CTGTCTGAGGAAAAGCCAGGAGG - Intergenic
1139198264 16:64946535-64946557 GTGTGTGAAGAGAAGCCAGGAGG + Exonic
1139285537 16:65810061-65810083 ATTTTATAAGAAAAGCCAGTGGG - Intergenic
1140551417 16:75870208-75870230 ATGTTTGAGAAAAAGCAAGGAGG + Intergenic
1141753416 16:85975141-85975163 GTGCTGGCAGAAAAGCCAGGTGG + Intergenic
1143097719 17:4487354-4487376 ATGTTTGAGGATCAGCAAGGAGG + Intronic
1144126536 17:12207749-12207771 ATGTTTGAAGGACAGCAAGAGGG - Intergenic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1144348630 17:14372947-14372969 AAGTAGGAGGAAAAGCCAGGAGG + Intergenic
1144798063 17:17905947-17905969 GTGTTTGAGGAATAGCAAGGTGG - Intronic
1145009440 17:19359352-19359374 ATGTTTGAGGACCAGCAAGGAGG - Intronic
1146474192 17:33149274-33149296 ATGTTAGAAAAAAAGACAGCTGG - Intronic
1148761980 17:50009185-50009207 GAGTTTGAAGAACAGCAAGGAGG + Intergenic
1149248816 17:54744225-54744247 ATGTTTGAAGAACAACAAGAAGG + Intergenic
1149446163 17:56714852-56714874 ATGTTGGAAGTAGAGCCTGGTGG + Intergenic
1149727627 17:58912481-58912503 ATGTTTGAGGAATAACAAGGAGG + Intronic
1150361509 17:64538918-64538940 ATGTATGATGAGAGGCCAGGAGG + Intronic
1151432743 17:74075279-74075301 ATGTTTGAGGAGAGGCCTGGTGG - Intergenic
1152715045 17:81895383-81895405 TTGATAGAAAAAAAGCCAGGTGG + Intronic
1152974491 18:201192-201214 ATATTTGAAGAAGGGCCTGGAGG + Intronic
1153243822 18:3054378-3054400 ATGTTTGAATAACAGCAAGTTGG - Intergenic
1155367966 18:25067701-25067723 AGCTTTGGAGGAAAGCCAGGGGG + Intronic
1155381799 18:25231017-25231039 CTGCTTGGAGAAAAGTCAGGCGG - Intronic
1156447013 18:37244631-37244653 CTGTTTCAAGAACAGCCATGAGG + Exonic
1156457083 18:37300898-37300920 AAGTTTGAGGAACAGCCATGAGG + Intronic
1156898435 18:42273140-42273162 ATGATTGAAGAAAAGTGAGCAGG + Intergenic
1157092287 18:44650410-44650432 ATCTTTGAAGAACAGCGAGAAGG + Intergenic
1159110358 18:64048708-64048730 CTGCTTGAATAAAAGCTAGGTGG - Intergenic
1159615384 18:70573657-70573679 ATGTTTGAAGAATAGCAAAAAGG - Intergenic
1159680080 18:71338476-71338498 ATGCTTGAAGAGCAGCAAGGAGG - Intergenic
1159779244 18:72642335-72642357 ATGTTTAAAGAAGAGCCACAAGG + Intergenic
1159880369 18:73853218-73853240 AACTTTGAAGAAATGCCAGGTGG + Intergenic
1160246912 18:77166457-77166479 ATGCTCCAAGAAAAGGCAGGTGG + Intergenic
1160416981 18:78718396-78718418 ATGTTTGCTTAAAAGCAAGGTGG - Intergenic
1161258904 19:3324768-3324790 ATGTTGGAGGAACAGCAAGGAGG - Intergenic
1161390648 19:4018735-4018757 AGGTTTGGAGAAAAGTGAGGTGG + Intronic
1161488315 19:4547844-4547866 GTGTTGGAAGAACAGCAAGGTGG - Intronic
1161503808 19:4633174-4633196 ATGTTGGAGGAATAGCAAGGAGG + Intergenic
1161623211 19:5310093-5310115 ATGTTGGAGGAACAGCGAGGAGG - Intronic
1161649332 19:5474724-5474746 ATGTTGGAGGAACAGCGAGGAGG + Intergenic
1161664226 19:5565181-5565203 ATGTTGGAGGAACAGCGAGGAGG - Intergenic
1161863708 19:6818452-6818474 ATGTTGGAGGAACAGCAAGGAGG - Intronic
1162087840 19:8259338-8259360 ATGTTAGAGGAAGAGCAAGGAGG + Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1162597525 19:11640463-11640485 ATGTTTGAAACAAAGCCTGGGGG - Intergenic
1162756314 19:12862496-12862518 ATGTTTTAAGAAAATCCATTTGG + Intronic
1163022258 19:14488829-14488851 ATGTTTGAGGAACAGTGAGGAGG + Intronic
1163284264 19:16336609-16336631 ATGTTTAAAGAAAAAGGAGGGGG - Intergenic
1163518587 19:17779211-17779233 CTGTCTGAAGAACAGCAAGGAGG + Intronic
1163797271 19:19344880-19344902 ATGGTTGGAGAAGAGCCGGGGGG - Exonic
1163822333 19:19503031-19503053 GTGTTTGAAGAACAACCAGTGGG + Intronic
1164811376 19:31159242-31159264 ATTTGTGAAGCAAAGGCAGGTGG - Intergenic
1165863405 19:38921388-38921410 ATGGTCGGAGACAAGCCAGGTGG - Exonic
1166350158 19:42194094-42194116 AAAATTGAAGAAAAGCAAGGCGG + Intronic
1167644663 19:50699420-50699442 GTGTTTGGAGAGAAGCCAGATGG + Intronic
926120940 2:10240930-10240952 ATGTTTGAGGAAAGACCAGCCGG + Intergenic
926494967 2:13575050-13575072 ATGTTTGAAAAATAGCAGGGAGG - Intergenic
926855947 2:17256373-17256395 CTGTTTGAGGAATAGCAAGGAGG - Intergenic
926871491 2:17422911-17422933 GTGTTCCAAGAAAAGCAAGGAGG - Intergenic
927272098 2:21222697-21222719 GTGTTTGAATAATAGCAAGGAGG + Intergenic
928490255 2:31776504-31776526 ATGTTTGAGGAACAGCAAGGGGG - Intergenic
928504943 2:31941223-31941245 GTGTTTGAGGAGAAGCAAGGAGG - Intronic
928708131 2:33974109-33974131 ATGGTTGAAGAAAAGCAAGGAGG + Intergenic
929205196 2:39283782-39283804 ATGTTTAAAGTATACCCAGGGGG - Intronic
929206908 2:39306316-39306338 ATGTCTGAAGAAAACACAGTCGG - Intronic
929839931 2:45447653-45447675 ATATTTGAAGAATAGCCATTAGG + Intronic
930216372 2:48701410-48701432 GTATTTGAAGAACAGCAAGGAGG - Intronic
930680200 2:54249539-54249561 GCGTTTAAAGAAAAGCCAGAGGG + Intronic
931613759 2:64133204-64133226 ATGATTGAAGAAAACTCATGGGG - Intronic
931876587 2:66520172-66520194 TTATTTAAAGAAAAGCCAGTTGG + Intronic
932235665 2:70119286-70119308 GTGTTTTAAGAACAGCAAGGAGG + Intergenic
932377758 2:71253115-71253137 ATGTTTGAGGAACAGCAAGAAGG - Intergenic
933216068 2:79631464-79631486 TTGTTTGCTGAATAGCCAGGGGG + Intronic
935393929 2:102585858-102585880 AGGTTTGAAAAAAAGCCAAATGG - Intergenic
935791143 2:106591354-106591376 ATGTTGGAAGTGAAGCCTGGTGG - Intergenic
935959920 2:108414664-108414686 ATGTTTGAGGAAAAGCAAGAAGG + Intergenic
936821899 2:116531282-116531304 ATGTTGGAAGAGAGGCCTGGTGG + Intergenic
938829541 2:135036789-135036811 AGGTAAGAAGAAAAACCAGGAGG + Intronic
939173551 2:138723597-138723619 TTTTATGAAGTAAAGCCAGGGGG - Intronic
940051394 2:149468812-149468834 ATGTCTGAAGAGAAGGCAGCTGG - Intronic
940236569 2:151517344-151517366 ATGTTGGAATAAAGGCCTGGGGG + Intronic
940273062 2:151912596-151912618 ATTTTAGAATAAATGCCAGGTGG + Intronic
941359153 2:164530669-164530691 ATGTTTGAAATACAGCCAGGAGG + Intronic
942500329 2:176582946-176582968 ATGGTTGAAGAAGAGAAAGGAGG - Intergenic
942994372 2:182243466-182243488 ATGTTTGAGGAACAGGAAGGAGG + Intronic
943272605 2:185826378-185826400 ATGTTTGAGGAACAGCAAGGAGG - Intronic
944174938 2:196818615-196818637 ATGCTTGAGCAAAAGCCAGCTGG + Intergenic
944921649 2:204420440-204420462 AGGGTAAAAGAAAAGCCAGGTGG + Intergenic
946085443 2:217166150-217166172 AAGTTCTAAGAAAAGCAAGGTGG - Intergenic
946355165 2:219179953-219179975 GTCTTAGAAGCAAAGCCAGGAGG - Intronic
946523946 2:220497540-220497562 TTGCATGAAGAACAGCCAGGAGG + Intergenic
946819392 2:223614580-223614602 ATGTTGGAAGTGAGGCCAGGAGG - Intergenic
946939869 2:224759516-224759538 TTGTTAGAAAAAAAGGCAGGAGG - Intergenic
948954683 2:241278734-241278756 GTGCTGGAAGAAAATCCAGGAGG + Intronic
1169224848 20:3849536-3849558 ATGTTTGAAGAATAGAAAGCAGG - Intronic
1170536730 20:17348223-17348245 ATGTGAGAAGAGAAGCCAGCTGG - Intronic
1170883791 20:20320602-20320624 ATGCTTCAAGATAACCCAGGAGG + Intronic
1171400874 20:24872461-24872483 ATGTTAGAAGGAAAGGGAGGTGG + Intergenic
1173091588 20:39977168-39977190 ATGTTTGAAGAAAAGCTAGATGG + Intergenic
1173233502 20:41221842-41221864 ATGTTCAAAGAACAGCAAGGAGG + Intronic
1174511637 20:51057916-51057938 CTGGTGGAAGAAAAGCAAGGGGG - Intergenic
1174586033 20:51609108-51609130 ATGTCTGAAGAACAGCCATAAGG + Intronic
1174783946 20:53415287-53415309 ATGTCTTAAGAAATGCCAGTGGG + Intronic
1174828884 20:53794764-53794786 TTGGTTGAAGAACAGCCAGAAGG - Intergenic
1175311525 20:58015046-58015068 GTGTAGGAAGAAATGCCAGGAGG + Intergenic
1177015403 21:15781690-15781712 AGGATTGAATCAAAGCCAGGGGG + Intronic
1177048253 21:16199084-16199106 ATGTTGGAAGCAAAGGCACGGGG + Intergenic
1177836161 21:26188499-26188521 GTGTTTGGAGAACAGCGAGGTGG + Intergenic
1179038334 21:37779598-37779620 ATGACTGAAGAAAAGCCACTTGG + Intronic
1182710221 22:32317922-32317944 AAGTTGGAAGAAAAGCCTGTTGG - Intergenic
1184397784 22:44254876-44254898 AAGTTGGAAGAAAAGCCTGTTGG - Intronic
1184936296 22:47724815-47724837 ATGTTTGAAGAGAAAAAAGGAGG + Intergenic
1184967101 22:47986756-47986778 ATTTTTGAAGAATAGTCTGGTGG + Intergenic
951092155 3:18586816-18586838 ATTTTTGAAGACAATCCAGATGG - Intergenic
951589209 3:24245003-24245025 CTGTTTGAACAAAGGTCAGGGGG + Intronic
951669579 3:25165313-25165335 ATGTATACAGAAAAGCAAGGTGG - Intergenic
952223001 3:31343250-31343272 TGGTTTGATGAAATGCCAGGAGG + Intergenic
952932819 3:38373261-38373283 ATCTCTGAAGGAAGGCCAGGTGG + Intronic
954012230 3:47651469-47651491 ATACTTGAAGAACAGCAAGGAGG - Intronic
954593078 3:51800895-51800917 ATGTTTGAAGAACACGGAGGAGG + Intergenic
955078575 3:55636945-55636967 ATGATTGGAGAGAAGCTAGGAGG - Intronic
955146441 3:56324834-56324856 ATGATGGAAGAACAGCAAGGAGG - Intronic
955151782 3:56374763-56374785 TTATTTGAAGAATAGCCAGCAGG + Intronic
955958971 3:64319537-64319559 ATGCTTGAGGAACAGCAAGGAGG + Intronic
956747413 3:72320708-72320730 GTGGCTGCAGAAAAGCCAGGTGG + Intergenic
957867816 3:86047354-86047376 ATGTTTGATCAAGAGCCAGATGG + Intronic
958689967 3:97451769-97451791 AAATTTAAAGAAGAGCCAGGAGG - Intronic
959479305 3:106852469-106852491 TTGATTAAAGTAAAGCCAGGTGG + Intergenic
959689442 3:109182725-109182747 ATGTTTGAAGAGCAGCAAGGGGG - Intergenic
959805863 3:110553042-110553064 ATGTTTGAGAAAATGTCAGGGGG - Intergenic
960750937 3:120952214-120952236 ATTTTTGCAAAAAAGCCAGCTGG + Intronic
960796706 3:121495366-121495388 TTCTTTGAAGAAAATGCAGGTGG - Intronic
962727788 3:138250616-138250638 ATGTCTTAAGAAAAGTAAGGAGG + Intronic
963069663 3:141292554-141292576 ACGTTTGAAAAACAGCCAGCTGG + Exonic
963395401 3:144725967-144725989 ATGTGTGAATATTAGCCAGGAGG + Intergenic
963400627 3:144792549-144792571 ATATTTGAATCAAAGCCAGTTGG - Intergenic
963762657 3:149299575-149299597 ATGTTTGAAGAAAAGCAAAGGGG - Intergenic
963775062 3:149430417-149430439 ATGTTTAAACAGAAGCCAGATGG - Intergenic
965843485 3:172935069-172935091 ATGGTTGTAGAAAATCCAAGAGG + Intronic
966182397 3:177198457-177198479 ATGTGTGAAGCACAGCAAGGCGG + Intergenic
966425870 3:179779062-179779084 ATGTTTGAGGAGGAGCCCGGAGG + Intronic
967522870 3:190455141-190455163 AAGTTTGTAGAAAAGCAAGAAGG - Intergenic
967573665 3:191063996-191064018 ATTGTTGAACAAAAGCCATGTGG + Intergenic
968560183 4:1276119-1276141 CTGTTAGAAGAAAACACAGGGGG + Intergenic
968650881 4:1759833-1759855 ATGTTAGAGCAAACGCCAGGTGG - Intergenic
969835490 4:9836740-9836762 CTCTTTGGAGAAAAGCCTGGAGG + Intronic
970136758 4:12933532-12933554 ATGTACGAAGAAAAGCCATTTGG - Intergenic
970760140 4:19475828-19475850 GTGTTTGAAAAACAGCAAGGAGG + Intergenic
970919016 4:21370766-21370788 ATGTTGGAGGAACAGACAGGAGG + Intronic
970968161 4:21950699-21950721 ATGTTTGCAGGGCAGCCAGGAGG + Intergenic
971255383 4:25009265-25009287 CTGTTTGAAGAACATCCAGGGGG - Intronic
971507882 4:27386286-27386308 ATTTTGGAAGAACAGCAAGGAGG - Intergenic
972052021 4:34748548-34748570 ACGTTTGAAGAAAAAGCAGGTGG + Intergenic
972113106 4:35591181-35591203 AAGTTAGAAGAAAAGGCAGGTGG - Intergenic
974373853 4:61051046-61051068 ATGTCTGAAGAAAAGGCATGTGG - Intergenic
974615110 4:64270327-64270349 ATGTTTGAAGATAATACCGGGGG + Intergenic
975319856 4:72997604-72997626 ATATTTGAGGAACAGCAAGGAGG - Intergenic
975698405 4:77037643-77037665 ATGTTTGAACAAAAGATATGGGG - Exonic
976056370 4:81072658-81072680 ATGTTTGAGGAAGAGCAAGGGGG + Intergenic
976660349 4:87534300-87534322 AAGTTTTAAGAAAAGCACGGCGG + Intergenic
976842762 4:89451154-89451176 ATGTTTGAGGAAGAGCAAGAAGG + Intergenic
977554134 4:98471496-98471518 ATGTTTGTAGAAAAGCTGGCAGG + Exonic
978168421 4:105637530-105637552 ATCTTTGAAGAGAAGCCAGGAGG - Intronic
978567084 4:110094601-110094623 ATGTTTGAGGAACAGCAAGGAGG + Intronic
979024910 4:115558320-115558342 ATATTTGAAGAATAGCCAGGAGG - Intergenic
979610895 4:122687812-122687834 ATGTTTGAAGAACAAAGAGGAGG + Intergenic
980864243 4:138535920-138535942 GTGTTTGAAGAAAGGCCTTGTGG + Intergenic
982187904 4:152820721-152820743 ATGTTGGAAGAGGAGCCTGGTGG - Intronic
982430802 4:155319877-155319899 ATGCTTGAAGAAAAGGAAGATGG + Intergenic
982438422 4:155403685-155403707 ATGTTTGAAAAAAAGGGGGGGGG + Intergenic
982863279 4:160481326-160481348 TTGGTTGAAGAATAGCGAGGAGG + Intergenic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
984504300 4:180597584-180597606 CTGTTTGAAGAAAATCAAGCAGG + Intergenic
985368738 4:189261991-189262013 ATGTTGGAAGAAGGGCCTGGTGG - Intergenic
986935051 5:12873617-12873639 ATGTTGTAAGAAAGGCCTGGTGG - Intergenic
988071614 5:26296639-26296661 ATGTTTAAAGAAATGCCATAAGG + Intergenic
988382677 5:30518277-30518299 ATGTCTGATGGAAAGCCATGGGG - Intergenic
988901851 5:35741422-35741444 GTGTTTGAAGAACAGCAAGGAGG + Intronic
989662480 5:43814689-43814711 ATGTTGGAGGAAATGCCAGATGG + Intergenic
989703668 5:44301530-44301552 ACTTTTGGAGGAAAGCCAGGTGG - Intergenic
990002089 5:50906191-50906213 ATGTTCCAGGAAGAGCCAGGAGG + Intergenic
990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG + Intergenic
991074858 5:62523606-62523628 TTCTTTGAAGAAGAACCAGGAGG + Intronic
991214541 5:64147602-64147624 ATGTTTGAGGAACATCAAGGAGG - Intergenic
991260761 5:64665235-64665257 ATAAGTGAAGAAAAGCCAAGGGG - Intergenic
991404851 5:66291824-66291846 ATTTAAGAAAAAAAGCCAGGAGG - Intergenic
992278971 5:75153481-75153503 ATATCTGAGGAAAAGCAAGGAGG + Intronic
994572433 5:101531277-101531299 ATGTTGGGAGAAAAGCCTGTTGG - Intergenic
995505414 5:112855275-112855297 GTGTTTGAAGAAAAGGAAGATGG - Intronic
995821378 5:116237168-116237190 ATGTTTGATGAACAGCAAGCAGG + Intronic
997702983 5:135917861-135917883 AGGTTTGAGGAACAGCAAGGAGG + Intergenic
998992481 5:147833197-147833219 ATGTTTGAGAAACATCCAGGAGG + Intergenic
999100092 5:149016624-149016646 ATGTAAGAATAAAAGCCAGACGG + Intronic
1000162427 5:158612205-158612227 AAGTTTAAAGAAAAGCAATGTGG + Intergenic
1000993731 5:167937836-167937858 ATGATTGGAGGAAACCCAGGAGG + Intronic
1001283505 5:170405553-170405575 ATGAATCAAGAGAAGCCAGGAGG - Intronic
1001884021 5:175272076-175272098 ATGTGTGAGGAAGAGCCAGGAGG - Intergenic
1002349616 5:178574825-178574847 TGGTTTGAAGAGAAGTCAGGTGG - Intronic
1003332783 6:5143570-5143592 CTGGTTAAAAAAAAGCCAGGAGG + Intronic
1003757713 6:9140480-9140502 ATGTTTGATGACAAGCCAGATGG - Intergenic
1005492740 6:26361687-26361709 TTGTGTGAAGAAAAGCAATGAGG + Intergenic
1005808005 6:29493203-29493225 ATGGTTGAAGAAAAGAAAGAAGG + Intergenic
1006019800 6:31111430-31111452 ATGTTCCAAGAAGAGCCAGGAGG + Exonic
1006333068 6:33405901-33405923 CTGGTTGAGGAACAGCCAGGAGG - Intronic
1006386340 6:33733149-33733171 ATGTTTCTATATAAGCCAGGAGG - Intronic
1006753320 6:36393317-36393339 GTGTTTGAAGAATGGCAAGGAGG - Intronic
1007909977 6:45503835-45503857 ATGTTAAAAGAAAAACCAGAAGG - Intronic
1008562377 6:52735586-52735608 ATGTTGGAAGTAGAGCCTGGTGG - Intergenic
1009739973 6:67732021-67732043 ATTTTTGAATAAATGCTAGGTGG + Intergenic
1010550564 6:77217328-77217350 ATGTATGATGAATAGCAAGGTGG + Intergenic
1011229496 6:85144317-85144339 ATGTTTGAAGGAAAGTGGGGAGG - Intergenic
1011247726 6:85337156-85337178 ATGTTTGAAGATAACCCAGGGGG - Intergenic
1011463473 6:87630832-87630854 ATATTTGAAGAAGAGCAAGGAGG + Intronic
1011787821 6:90866411-90866433 ATATTTGAGGAATAGCAAGGGGG - Intergenic
1012142543 6:95642329-95642351 ATGAATGAAGAAAAGCATGGTGG + Intergenic
1013515278 6:110879499-110879521 ATCTTTGAACAAAAGGGAGGAGG + Intronic
1013827910 6:114237129-114237151 ATTTTTGATGAAAGGCAAGGAGG + Intronic
1014982274 6:127958798-127958820 ATGTTTGAAGAACAGGTAGTCGG - Intergenic
1015017051 6:128425996-128426018 ATGTTTGAAAAATTTCCAGGAGG + Intronic
1015415320 6:132941158-132941180 ATGTTGGAAGTGAAGCCTGGTGG + Intergenic
1015735983 6:136400449-136400471 ATTTTTTAAAAAAAGCCAGATGG + Intronic
1015838331 6:137447037-137447059 CTGCTTGAAGAAAACACAGGAGG - Intergenic
1015972157 6:138753043-138753065 ATGGTTGAGAAAAAGCAAGGGGG - Intronic
1017292326 6:152753652-152753674 ATATTTGAAGCAAAGCTTGGGGG + Intronic
1017361916 6:153583359-153583381 ATGTCTGAAAAGAAACCAGGGGG + Intergenic
1017925835 6:158910977-158910999 ATCTTTGAAGAAAAGCACAGGGG + Intergenic
1018378330 6:163234224-163234246 ATGTTTGAAGTGAGGCCTGGTGG + Intronic
1018615630 6:165683924-165683946 ATATCTGAGGAATAGCCAGGAGG - Intronic
1021143543 7:17056991-17057013 ATGTTCAAACAACAGCCAGGAGG + Intergenic
1021292799 7:18866524-18866546 AGGTTAGAAGGAAAGGCAGGTGG - Intronic
1021466054 7:20944672-20944694 GTGTTGGAGGAACAGCCAGGAGG + Intergenic
1022512635 7:30950411-30950433 CTGTTTGCAGAAAAGCCATGAGG + Intronic
1023053482 7:36273369-36273391 GTTTTTTAAAAAAAGCCAGGGGG - Intronic
1023605341 7:41926265-41926287 TTGTAAAAAGAAAAGCCAGGTGG + Intergenic
1024105711 7:46083185-46083207 ATTTTTTACCAAAAGCCAGGGGG + Intergenic
1024151642 7:46577814-46577836 ATGTTTGATGAATGGCCAGGTGG - Intergenic
1025831176 7:65051796-65051818 ATGTATGCAGAAAAGCCTTGTGG - Intergenic
1025918324 7:65885676-65885698 ATGTATGCAGAAAAGCCTTGTGG - Intronic
1027650394 7:80860040-80860062 ATATTTGAATAAAAGCTAAGTGG - Intronic
1027821653 7:83053464-83053486 ATGTTGGAAGAAAAGAATGGAGG + Intronic
1028439710 7:90846077-90846099 ATGTTTGAAGTAAAGTAATGGGG - Intronic
1028480724 7:91301674-91301696 ATGTTTGAGGAACAACAAGGAGG - Intergenic
1029136760 7:98378430-98378452 CTGTTTGGAGAACAGCCCGGAGG - Intronic
1029824419 7:103174211-103174233 ATGTTTGAGGTACAGCCAGTGGG - Intergenic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030729649 7:112971551-112971573 ATATTTGAAGAAGAACAAGGAGG + Intergenic
1031534727 7:122919257-122919279 ATGCTTGAAGAAAAGGGAAGGGG + Intergenic
1031990426 7:128194570-128194592 GAGTTTGAAGAACAGCAAGGAGG + Intergenic
1033457940 7:141519202-141519224 ATGTTAGAGGAAGAGCAAGGAGG - Intergenic
1033789654 7:144776060-144776082 ATGTTTTAAGAGCAGCAAGGAGG - Intronic
1033790535 7:144788065-144788087 ACGTTTGAAGAAAATCAAGTTGG - Intronic
1034137482 7:148784246-148784268 CTGTTTGAAAAACAGCCAGTGGG - Intronic
1035606299 8:931766-931788 ATTTTTAAAGAAAAACCAAGTGG - Intergenic
1037274747 8:17165938-17165960 ATGTGTGAGGAAGAGCAAGGAGG + Intronic
1038178992 8:25208960-25208982 ATGTTGAAAGAATAGCCAGTAGG + Intronic
1038267681 8:26048811-26048833 ACGTTCGAAGACAGGCCAGGGGG - Intergenic
1038660101 8:29489913-29489935 ATGTTTGAGCAATAGCAAGGGGG - Intergenic
1038834711 8:31106504-31106526 ATGTCCGAAGAAAAACAAGGAGG - Intronic
1039600861 8:38836034-38836056 ATGTTTAAAGAAAAGTCAGCGGG - Intronic
1042772723 8:72396859-72396881 ATGTGTGAAGCAAGACCAGGAGG - Intergenic
1043196902 8:77306502-77306524 ATGTTTGAAGAATAGCAAGGGGG + Intergenic
1043352959 8:79382755-79382777 ATGTTTGAAGAGGAGGAAGGAGG - Intergenic
1043926293 8:86040788-86040810 ATTTCTGAAGAAAATCCTGGTGG + Intronic
1044166717 8:88993642-88993664 ATGTTTGAATAAAAACCTAGAGG + Intergenic
1045685395 8:104706188-104706210 ATGTTTGAAGAATAGCAAGGAGG - Intronic
1046885060 8:119357355-119357377 ATAATTGAAGAAAAGACAGATGG - Intergenic
1047167214 8:122452460-122452482 ATGTTGGAGGAATAGCAAGGAGG + Intergenic
1047778040 8:128089754-128089776 ATATTTGCAGACAAACCAGGAGG + Intergenic
1048912839 8:139152624-139152646 ATGTTTAAAAAAAAGAAAGGTGG + Intergenic
1049115034 8:140678776-140678798 ATGTGTGAGGAACAGCAAGGTGG + Intronic
1049974090 9:845498-845520 AAGATTGAAAAAAGGCCAGGCGG - Intronic
1050174624 9:2856895-2856917 TTGTTTGAAGAACAGCAAGAAGG + Intergenic
1050559760 9:6822799-6822821 ATGTCTGTAGAAAAGACAGAAGG + Intronic
1050565734 9:6880797-6880819 TTTTTTAAAGATAAGCCAGGCGG + Intronic
1051252451 9:15175056-15175078 ATCTTTGTATAAAAGCCAGGGGG - Exonic
1052491288 9:29172040-29172062 ATATTTGACCAAAAGGCAGGTGG + Intergenic
1053010857 9:34632319-34632341 GTGTTGGAAGAAAAGCAAGGAGG + Intergenic
1055420585 9:76136981-76137003 ATGTCTGAAGAAATGTAAGGAGG - Intronic
1055421023 9:76142468-76142490 CTGTTCAAAGAAAAGCAAGGAGG + Intronic
1055462158 9:76529295-76529317 ATATTTGAAAATTAGCCAGGTGG + Intergenic
1055716072 9:79119781-79119803 ATGTGACAAGAAAAGCCAGAAGG - Intergenic
1056129557 9:83570539-83570561 ATTGTTGAAGAACAGCCATGAGG + Intergenic
1056821691 9:89846656-89846678 ATGTTTCCAGAAAAGTCAAGTGG - Intergenic
1057011553 9:91607113-91607135 ATGTTTGAAGAAATAAAAGGCGG + Intronic
1057310256 9:93938534-93938556 ATGTTGGAGGAATAGCCAAGAGG + Intergenic
1058555189 9:106159396-106159418 ATGTTTGAAGAATAGCAAGAAGG + Intergenic
1058575300 9:106394716-106394738 AAGTTTGAACAACAGCAAGGAGG + Intergenic
1059711722 9:116873688-116873710 ATGTTGGAGGAGGAGCCAGGTGG + Intronic
1059788973 9:117618970-117618992 ATGTTTAAAGAACAGCAAGTAGG + Intergenic
1059916040 9:119101637-119101659 ATGTTTGGAGAAAAGACTAGTGG - Intergenic
1059938756 9:119337397-119337419 TTGTTTCAGGATAAGCCAGGAGG + Intronic
1060385820 9:123227370-123227392 CTGTTTGAAGAAGAGCAAGGAGG + Intronic
1060612851 9:124984199-124984221 ATGTTTCAGGAACAGCAAGGGGG + Intronic
1061123922 9:128661743-128661765 ATGTCTGAAAAAAAGCCGGCCGG + Intergenic
1186089629 X:6031514-6031536 ATTTATGAAGATAAGCAAGGAGG + Intronic
1186240868 X:7564700-7564722 AGTTTTGAAAAAAAGACAGGTGG - Intergenic
1186603387 X:11063310-11063332 TTATTGGAAGAAAAGGCAGGAGG + Intergenic
1187203273 X:17156709-17156731 AAGGCTGAAGGAAAGCCAGGGGG + Intergenic
1187786436 X:22892765-22892787 AGGGTTGAAAAAAGGCCAGGGGG + Intergenic
1188199388 X:27280475-27280497 ATGTTTGAGGTAAGGCCTGGTGG + Intergenic
1188938112 X:36202466-36202488 ATGTTTGAAGCAAAGCAACCAGG - Intergenic
1188958420 X:36462140-36462162 ATGTGTCAAGAAAAGCTAGAAGG + Intergenic
1189558334 X:42167684-42167706 ATGTTTGAAGAAGGGCAAGAAGG + Intergenic
1189560968 X:42191232-42191254 ATGTTTGAAGAATAGCAAGGAGG + Intergenic
1189605376 X:42672195-42672217 TTGCTTGAAGAAAAGCAAGGAGG + Intergenic
1190310014 X:49110571-49110593 ATGTGTGAGGAACAGCCGGGAGG - Intergenic
1190855188 X:54287320-54287342 ATGTTTGGAAAACAGCCAGGAGG - Intronic
1191571929 X:62637308-62637330 CTTTTTGAAGAAAATGCAGGTGG + Intergenic
1191674620 X:63781857-63781879 TTGTTTAAAGAACAGCAAGGAGG - Intronic
1192077509 X:68015395-68015417 ATGTTTGAGGAAAAGGAAGAAGG + Intergenic
1192499383 X:71639500-71639522 ATGGTTGGAGCAAAGCCTGGAGG - Intergenic
1194206184 X:91014607-91014629 ATGTTTGAGGAAGGGCCTGGTGG - Intergenic
1195945444 X:110205619-110205641 CTGTTTGAAGTACAGCCAGGTGG + Intronic
1196020492 X:110985940-110985962 GAGATTGAAGAGAAGCCAGGGGG - Intronic
1196021635 X:110997109-110997131 ATGTTTGAAGAACAGCAAGGGGG + Intronic
1196276502 X:113771986-113772008 TAGTTAGAAGAAAAGCCAGCTGG - Intergenic
1196706558 X:118722322-118722344 TTGTGTGAAGAACAGCCAGGTGG + Intergenic
1197025716 X:121747198-121747220 ATGTTTTAAGAAATGCCATTAGG - Intergenic
1197311137 X:124907092-124907114 ATGTTTCTAGAAAATACAGGGGG + Intronic
1197362151 X:125517990-125518012 ATATTTGAAGGAATGCCATGTGG + Intergenic
1197390791 X:125861312-125861334 ATGTCTGAAGATATGCCTGGGGG - Intergenic
1197966517 X:132068893-132068915 ATGTTTGAGGAACAACCATGAGG - Intergenic
1198229836 X:134678329-134678351 ATGTTTGAGAAAAAGCAAGGAGG - Intronic
1198308077 X:135402203-135402225 ATTTTTGGAGAAAAGGAAGGGGG + Intergenic
1199059334 X:143335686-143335708 ATGTTTGAGGAACAGCAAGGAGG - Intergenic
1199482108 X:148309102-148309124 ATATTTGGAGAAAAACCAGGAGG + Intergenic
1200687617 Y:6270842-6270864 ATGTTTGAAAAGAAGACATGAGG - Intergenic
1201047654 Y:9903867-9903889 ATGTTTGAAAAGAAGACATGAGG + Intergenic
1201507597 Y:14720689-14720711 ATTTATGAAGATAAGCAAGGAGG - Intronic
1201765496 Y:17570377-17570399 ATAAATGAAGGAAAGCCAGGCGG + Intergenic
1201783979 Y:17753217-17753239 AGGTTTCACGAAAAGCCAAGAGG + Intergenic
1201817574 Y:18152770-18152792 AGGTTTCACGAAAAGCCAAGAGG - Intergenic
1201836056 Y:18335612-18335634 ATAAATGAAGGAAAGCCAGGCGG - Intergenic
1202097814 Y:21272090-21272112 GTGTTGGAAGAAGAGCCTGGTGG - Intergenic