ID: 1101140201

View in Genome Browser
Species Human (GRCh38)
Location 12:101787974-101787996
Sequence AAGTGTTTTTAAAAGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 548}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101140201 Original CRISPR AAGTGTTTTTAAAAGTCTGA TGG Intronic
900034951 1:399950-399972 AAGGGTTTTTAAAGGTGGGAAGG + Intergenic
900056568 1:635702-635724 AAGGGTTTTTAAAGGTGGGAAGG + Intergenic
901427072 1:9188986-9189008 AAATCTTCTGAAAAGTCTGATGG + Intergenic
903172124 1:21560855-21560877 AAGGGTGTTTAAAAGGATGAGGG + Intronic
904929265 1:34073395-34073417 AACAATTTTTAAAGGTCTGATGG + Intronic
905610170 1:39343813-39343835 AAGTTTATTTAAAAGTTTTAGGG + Intronic
906232514 1:44176910-44176932 ATGTTTTCTTAAAAGTCTAAAGG - Intergenic
908080067 1:60567628-60567650 AAGGCTTTTTAAAAATCTGTAGG + Intergenic
908150790 1:61299953-61299975 AAGAGTTTTCAAATATCTGAGGG + Intronic
908761804 1:67519607-67519629 AAGTGTTTGCCAAAGTCTAATGG + Intergenic
909095343 1:71279869-71279891 CTGTGTTTTTAAAATTCTGTAGG - Intergenic
909962425 1:81863058-81863080 AAGGGTTTTTAAAAATTTTATGG + Intronic
911416924 1:97586619-97586641 AACTATTTTCAAAATTCTGAAGG - Intronic
911455600 1:98118874-98118896 AATATTTTTTAAAAGGCTGAGGG - Intergenic
912621806 1:111168199-111168221 CAATGTTTTTAAAAGTCATAAGG - Intronic
912893420 1:113559414-113559436 AAGTCTATTTTAAAGTCTGTTGG - Intronic
913458139 1:119055156-119055178 AATTGTTTTTAAAAGTCACATGG + Intronic
915775778 1:158484432-158484454 AAGTCTTTTTAAGAATCTTAAGG - Intergenic
916629486 1:166596295-166596317 AATTGCTGTTAAAAATCTGAAGG + Intergenic
916833587 1:168518439-168518461 AGGAGTTTTTAAAAATCAGAAGG + Intergenic
917157780 1:172023455-172023477 CAATGTTTTTGAAATTCTGAGGG - Intronic
917326629 1:173839588-173839610 AAGTGGTTTAAAAAGACTGCAGG - Intronic
918168101 1:181969925-181969947 AAGTATTTTTAAAATGCTGAAGG + Intergenic
918921931 1:190723774-190723796 AATTGTTTTTAAAATTTTTATGG + Intergenic
919014655 1:192017247-192017269 GAGTGTTAATAAAAGTATGATGG + Intergenic
919341855 1:196319746-196319768 ACTTGTTTTTATAATTCTGAGGG - Intronic
920786479 1:209047157-209047179 AAGTGCTTTAAAATTTCTGAAGG + Intergenic
921312774 1:213861119-213861141 AATTTATTTTAAAAGGCTGAGGG + Intergenic
921916350 1:220614944-220614966 AGATTTTTTTAAAAGTCTAAAGG - Intronic
922052550 1:222007870-222007892 AAATGTTTTTAAAAGTGGAATGG - Intergenic
922257478 1:223905507-223905529 AAGGGTTTTTAAAGGTGGGAAGG + Intergenic
922280190 1:224115707-224115729 CACTGTTTGTAAAAATCTGAAGG - Intronic
922569027 1:226622077-226622099 AACTGTTTTTAAAATTCACATGG - Intergenic
922656587 1:227389874-227389896 AAATTTTTTTAAAAGTTTGCTGG - Intergenic
923276449 1:232400902-232400924 AATTATTTTTAAAAGACTGGAGG - Intronic
924338674 1:243008287-243008309 AAGGGTTTTTAAAGGTGGGAAGG + Intergenic
924486672 1:244490983-244491005 AATAATTTTTAAAAGTATGAAGG + Intronic
1063684487 10:8223725-8223747 AAATGTTTGTGAAACTCTGATGG + Intergenic
1064405676 10:15059899-15059921 AAGTGTTTTTAGCAATTTGATGG + Intronic
1064670212 10:17706289-17706311 AATTTTTTTCAAAAGTGTGATGG - Intronic
1064950665 10:20846069-20846091 CAGTGTTTTAAAAAGGCTAATGG - Intronic
1065104666 10:22370855-22370877 AAGTTTTTTTTTAAGTCAGAGGG + Intronic
1065239354 10:23689945-23689967 AAGTGTTTTTGAAGAACTGAAGG + Intergenic
1065392353 10:25195863-25195885 CAATGTGTTTAAAATTCTGAGGG - Intronic
1065604835 10:27407219-27407241 AAATGTTTTTAAAAGTCACCAGG + Intronic
1066024944 10:31346986-31347008 AAGTGTTTTTAAGAGACTAAAGG - Intronic
1066092824 10:32042663-32042685 AAGTATATTTAAAAGGGTGAGGG - Intronic
1066337861 10:34498257-34498279 TAATTCTTTTAAAAGTCTGAGGG + Intronic
1066565944 10:36722224-36722246 TAGTGTTTTTAAAAATCAGAGGG - Intergenic
1067964951 10:50901004-50901026 AAGTTTTTTTAAAAATCTAAGGG + Intergenic
1068253560 10:54476718-54476740 AAAGGTTTCTAGAAGTCTGAAGG - Intronic
1068574509 10:58670040-58670062 AAGTTTTTTTAACATTCTAATGG + Intronic
1068758024 10:60677036-60677058 AACTTTTTTTAAGAATCTGAGGG + Intronic
1069030033 10:63586242-63586264 AAGTCTTTATAAAAGCCTTATGG + Intronic
1071057463 10:81528264-81528286 AAGAGTTTTTAAAAACTTGAGGG - Intergenic
1071102293 10:82053287-82053309 AAGTGTTTATTAAAGGCAGAAGG + Intronic
1071118163 10:82247984-82248006 AAGAGTATGTAAAATTCTGATGG - Intronic
1071327334 10:84530180-84530202 AATCGTTTTTAACAGGCTGATGG + Intergenic
1071677831 10:87672828-87672850 ACATTTTTTTAAAAGACTGATGG + Intronic
1072109367 10:92303757-92303779 ATGTGATTTTAAAATTATGATGG - Intronic
1072404144 10:95133768-95133790 AATTATTTTTAAATGACTGAAGG + Intergenic
1073182617 10:101594213-101594235 AAATGCTTTTAAAAGTATCATGG + Intronic
1073387417 10:103137607-103137629 AAGTGTCTTTATACGTCTTAAGG + Intronic
1073615868 10:104994417-104994439 AAGTTGTTTAAAAAATCTGAAGG - Intronic
1075052417 10:119192536-119192558 AAGTCTTTTTAAAAGGGTGGAGG - Intergenic
1075349489 10:121710927-121710949 AAGTGATTTTCAAAGTTGGAGGG + Intergenic
1075496565 10:122924637-122924659 CAGTGTATTTAAAATGCTGAAGG + Intergenic
1075575584 10:123575109-123575131 AAGTTTCTTTAAAAGTATTAGGG + Intergenic
1076609760 10:131716215-131716237 AGGTGTTTGTAATAGTCTCAGGG + Intergenic
1078084684 11:8226589-8226611 ATGTGTTTTTAAATGTCTGGGGG - Intronic
1079857210 11:25621007-25621029 AAGTATTTTTGAAAGTGTAATGG + Intergenic
1080679759 11:34463445-34463467 AAGTGTTTTTAGGATTCTCAGGG - Intronic
1080828499 11:35868508-35868530 CAGTGCTTTTAAAATTCAGAAGG + Intergenic
1080970278 11:37266064-37266086 AAGTTTTTAAAAAACTCTGAGGG - Intergenic
1082217878 11:49596726-49596748 AAATATTTTTCAAAGCCTGAAGG - Intergenic
1083248240 11:61446945-61446967 AAGTGTTTTTAAAAGCTCTAGGG + Exonic
1086013819 11:82139422-82139444 AAGTTTTTTTATATGTCTGTTGG + Intergenic
1086138078 11:83462816-83462838 AATTTTTTTTAAAAGGCTCAAGG + Intronic
1086263702 11:84972782-84972804 AGCTGTTTTTAAATGTTTGAGGG - Intronic
1086301837 11:85434767-85434789 AACTGTTTGGAATAGTCTGAGGG - Intronic
1086577744 11:88360056-88360078 AAATGTTTTTAAATGTTTTATGG - Intergenic
1086631690 11:89027413-89027435 AAATATTTTTCAAAGCCTGAAGG + Intronic
1086694575 11:89828256-89828278 AAGTGTTGTTAAGAGTCTGCAGG + Intergenic
1086711571 11:90016243-90016265 AAGTGTTGTTAAGAGTCTGCAGG - Intergenic
1086807459 11:91262580-91262602 AATGGTCTTTAAAATTCTGAAGG + Intergenic
1086865724 11:91977746-91977768 AATTGTTTTTCACAGTCTGAAGG - Intergenic
1086957383 11:92947883-92947905 AATTATTTTTAAAAGTCTGTTGG + Intergenic
1087426208 11:97990248-97990270 AAGAGTTTTTTAAAGTTTAAAGG + Intergenic
1087557074 11:99734445-99734467 AAGTGTTTTTATCACTCAGAGGG + Intronic
1087833107 11:102841218-102841240 GGGTGTTTTTAAAAATATGAAGG - Intronic
1088589169 11:111388017-111388039 AAGTATTTTTAGAAGTATCATGG - Intronic
1089548836 11:119254050-119254072 AAGTGTTATCAAAAGTCAGCTGG + Intronic
1091528268 12:1328442-1328464 ACGTGTTTTCAAAAGTATTAAGG - Intronic
1092726832 12:11495059-11495081 AAGAGTTTGTAAAAATGTGAAGG + Intronic
1093041042 12:14379718-14379740 CAGTGTCTTTAAAATTCTGAAGG - Intronic
1093708301 12:22299895-22299917 ATGTTTTCTTAAAGGTCTGAAGG + Intronic
1094862138 12:34479645-34479667 AAGTGTTTGTAGTACTCTGATGG - Intergenic
1095146399 12:38733694-38733716 ATGTGTTATTTAAAGTCTGAGGG + Intronic
1095539653 12:43294691-43294713 CATAGTTTTTAAAAGCCTGAAGG + Intergenic
1095616333 12:44194283-44194305 AAGTGTTAATAAAAGTCAAATGG + Intronic
1095645840 12:44545203-44545225 AAGATTTTTGAAAAGTCTTAAGG - Intronic
1096737899 12:53670337-53670359 AATGGTTTTTCAAAGTATGATGG - Intronic
1097101035 12:56589648-56589670 ATGTGTTTTAAAAAGTATGCAGG + Exonic
1097131456 12:56813703-56813725 AATAGTTTTTTAAAGTCTCAGGG + Intergenic
1097379384 12:58876862-58876884 CAGATTTTTTAAAAGGCTGAAGG + Intronic
1097915764 12:65018880-65018902 AAGCTTTGTTAAAAGTCAGAAGG + Intergenic
1098018112 12:66127744-66127766 AAGTGTTTCAAAAAGTTTCAAGG + Intronic
1098165437 12:67692686-67692708 AAGTGTTTTTAAAAATTTAGGGG - Intergenic
1098283455 12:68884567-68884589 AAGTGTTTTAACAAGTCAGCAGG + Intronic
1098776938 12:74632241-74632263 AAGTGTTTGTAATGGTCTGGGGG + Intergenic
1098930857 12:76411505-76411527 AAGTGTTTTTAAAATACTTTAGG - Intronic
1099505434 12:83470491-83470513 GAGTGATTTTAAAAGACTGGTGG + Intergenic
1099866909 12:88294114-88294136 AAGCATTTTTAAATGTCTGTTGG + Intergenic
1100197494 12:92263778-92263800 AATTGTTTTCAAAATTCTAATGG + Intergenic
1101140201 12:101787974-101787996 AAGTGTTTTTAAAAGTCTGATGG + Intronic
1101384377 12:104243328-104243350 ATGTGTTTCTGAAAGTCTGTAGG - Intronic
1101457484 12:104850875-104850897 AAATGTGTTTAAAAGTCACATGG + Intronic
1102833518 12:116031080-116031102 AATTATTTTTAAAACTCTTAGGG + Intronic
1103069716 12:117931116-117931138 AAATGTTTTTAGATGTCTGTGGG - Intronic
1103335359 12:120185345-120185367 GAGTGTTTCTGAAAGTCTGAAGG + Intronic
1105801687 13:23909311-23909333 AGTTGTTTTTAAAAATCTAATGG - Intergenic
1106048732 13:26169845-26169867 AAGAGTTTTTAAGAGTCAGGTGG - Intronic
1106143556 13:27032250-27032272 ATCTATTTTTAAAAGTCTGCTGG - Intergenic
1106198504 13:27515089-27515111 AAGTGATTTTAATAGTGTCATGG - Intergenic
1106569261 13:30912113-30912135 TAGTGTGTGTAAAACTCTGATGG - Intronic
1106592082 13:31106615-31106637 AAGAGTTTTAAAAAGTCTCCTGG + Intergenic
1106677795 13:31979447-31979469 CAGTGGATTTAAAGGTCTGAAGG - Intergenic
1106732751 13:32558905-32558927 AATTGATTTTAAAATTCTTATGG - Intergenic
1107526115 13:41233350-41233372 ATATGGTTTTAAAAGTCTAATGG - Intronic
1107724665 13:43286530-43286552 AAATGATTTTAATAGTCTGCAGG + Intronic
1107871120 13:44747458-44747480 AAGAGTATGTGAAAGTCTGAGGG - Intergenic
1108153472 13:47560937-47560959 AAGTGTTATTAGAATTCTAAGGG - Intergenic
1108198811 13:48022145-48022167 ACGTGTTTATAGTAGTCTGATGG - Intergenic
1108274921 13:48798162-48798184 AAATGCTTTCAAAATTCTGAAGG + Intergenic
1108716739 13:53086990-53087012 AAGTGTTCTTAAAATTCATATGG + Intergenic
1109018609 13:57054524-57054546 AAGTGGTTTTAAAAGTGTTTTGG - Intergenic
1109408648 13:61935909-61935931 AAGTTTATTTAAAAGTTTGAAGG + Intergenic
1109730113 13:66401636-66401658 AAGTGGTATAAAAAGTCTGAAGG - Intronic
1109755876 13:66759681-66759703 AAATGTTTTTATAAGCCTCATGG - Intronic
1109832238 13:67805533-67805555 AAATGAATTTAAAAGTTTGATGG + Intergenic
1110050619 13:70893555-70893577 AAATTTTATTAAAAATCTGATGG - Intergenic
1110843104 13:80165124-80165146 AATTGTTTTAAAGTGTCTGATGG - Intergenic
1111556491 13:89887886-89887908 AAGTGATTTTGAATCTCTGAGGG - Intergenic
1112076533 13:95919848-95919870 AAGTGATTTTAAAATTCATATGG + Intronic
1112563896 13:100536069-100536091 AAATGTCTTTAAAGTTCTGAGGG - Intronic
1112906897 13:104433738-104433760 AAGTCTTTTTAAAAATTGGATGG - Intergenic
1113242884 13:108359424-108359446 AACTGTTTTTATAACTATGAAGG + Intergenic
1114381696 14:22212258-22212280 AAGTTTTTTAAAAATTCTGCAGG - Intergenic
1114833242 14:26171336-26171358 AAGTGTTTTCAAAAATTGGATGG - Intergenic
1115187616 14:30708461-30708483 TAGTGTATTTAAGACTCTGAGGG + Intronic
1115273841 14:31584426-31584448 AACTGTTTTTAAAAAACTGCTGG - Intronic
1115890814 14:38026521-38026543 AAGTGTTTGTAATAGTCTCAGGG - Intronic
1116104090 14:40476844-40476866 AATAGTTTTTAAATGTCCGAGGG + Intergenic
1116397911 14:44469261-44469283 AAATATTTTTAAAATGCTGAAGG - Intergenic
1116553205 14:46268985-46269007 AACTGTTTTTAAAAGTGATATGG + Intergenic
1117023436 14:51595493-51595515 AAGTATTGTTAACAGTGTGAAGG + Intronic
1117160100 14:52980971-52980993 AAGTGTTTTAATAAGTAGGATGG - Intergenic
1117731725 14:58729142-58729164 AACTGATTTTAAAAGTTTGGAGG + Intergenic
1117844728 14:59898970-59898992 AATAATTTTTAAAAGTATGAAGG + Intergenic
1117872270 14:60213595-60213617 AAGCTATTGTAAAAGTCTGATGG - Intergenic
1118481606 14:66173140-66173162 AAGTGTTATTAAAATAGTGAGGG + Intergenic
1118914444 14:70090605-70090627 AAGTTTTTCCAAAAGACTGAAGG - Intronic
1119169026 14:72518788-72518810 AAGTGTTTTACAAAATCTGAAGG + Intronic
1119312402 14:73659895-73659917 ATTTGTTTTTAAAAGTTAGAAGG - Intronic
1119627324 14:76190305-76190327 AATTGTTATTACAAGTGTGAAGG - Intronic
1119918790 14:78427025-78427047 AAATGTTTTTAAAAGCCCCAAGG + Intronic
1120827972 14:88972276-88972298 AAGTGTTTTGAAAGGGCAGATGG - Intergenic
1121364668 14:93297968-93297990 AAGTGTTTCTAAAGGTAAGACGG + Intronic
1124460761 15:29889388-29889410 ATGTAGTTTTAAATGTCTGAGGG + Intronic
1126761815 15:51976639-51976661 AATTGTCTTTAAAATCCTGAAGG + Intronic
1126804580 15:52333690-52333712 CATTTTTTTTAAAAGTCTGTTGG + Intronic
1127109647 15:55653912-55653934 AAGAATTCTTAAAAGCCTGATGG - Intronic
1127692733 15:61413910-61413932 CAGTGCTTTCAAAATTCTGAAGG + Intergenic
1128670560 15:69571807-69571829 AAATATTTTTAAAAGACTAAAGG - Intergenic
1128907078 15:71476817-71476839 AAGTTTCTTGAAGAGTCTGAGGG - Intronic
1128928855 15:71684821-71684843 GAGTTTTTATAAAAATCTGAAGG - Intronic
1129682353 15:77664914-77664936 CTGTGTGTTTACAAGTCTGAAGG - Intronic
1129688659 15:77700816-77700838 CAGTGTTTTTAACACTGTGAGGG - Intronic
1131199675 15:90386315-90386337 AAGTATCTTTAATAGTCTGAAGG + Intergenic
1132056507 15:98654505-98654527 TGGTGTTTTTAAAAGCGTGAGGG + Intronic
1133461716 16:5991915-5991937 AAATTTTTTTAAAACTGTGATGG - Intergenic
1134009127 16:10838349-10838371 ATCTATTTTTAAAAATCTGAGGG + Intergenic
1134463703 16:14453032-14453054 AACTGATTTTAAAAGTCAAAAGG + Intronic
1135262650 16:20994657-20994679 AAGTGGTTGTCAAAGTCTGGAGG - Intronic
1135573423 16:23566691-23566713 ATTATTTTTTAAAAGTCTGATGG - Intronic
1135648654 16:24186412-24186434 AAGTGATTTTTCAACTCTGATGG + Intronic
1135967359 16:27047191-27047213 TAGTGTTATTAAAAGTCACAAGG - Intergenic
1138269941 16:55688567-55688589 CAGTGTTTTTCAAACTCTCATGG + Intronic
1138851062 16:60630376-60630398 ATGTGTTTATAAAAGTTTTATGG - Intergenic
1139010497 16:62626587-62626609 CAGTGTTTTTAAAAGCCTGGGGG + Intergenic
1139104384 16:63809580-63809602 AAGTGGTTTTAAAAATCAGTTGG - Intergenic
1140156471 16:72432798-72432820 AATTGATTTTAAAAAGCTGAAGG - Intergenic
1140225156 16:73071069-73071091 AGGTGTTTTTAAAAGAGTGAGGG - Intergenic
1141909469 16:87048651-87048673 AATTGTTTTTAAAAATCCAATGG - Intergenic
1142578421 17:924955-924977 AAGAGATTTTACAAGTCAGATGG + Intronic
1142975271 17:3639703-3639725 AAATGTTTTTTTAAGTCTTAAGG + Intronic
1143072972 17:4312960-4312982 AATTTTTTCTAAAAGTTTGACGG + Intronic
1143332162 17:6145616-6145638 AATTGTTTTTTAAAGTCTGTAGG - Intergenic
1144197846 17:12912756-12912778 CAGTGCCTTTAAAATTCTGAAGG + Intronic
1144277253 17:13684200-13684222 AAGTGTATTTAAAAGACACAGGG + Intergenic
1144403710 17:14932140-14932162 ATGCGTTTTTAAAAATCTCAAGG - Intergenic
1145825164 17:27871396-27871418 AAGGGTTTTTAAAGGTGAGAAGG - Intronic
1146384991 17:32363034-32363056 AAGTTTTTTTAGACGTCTGTGGG + Intronic
1146707764 17:35014086-35014108 ATGTGTTTTCAAAAGCCTCAAGG - Intronic
1147030000 17:37625823-37625845 AAGTCTTTTTTAAAGACTGAAGG - Intronic
1148093250 17:45035159-45035181 GAGTGTTTTTAAAATACTGGAGG - Intronic
1148171758 17:45526750-45526772 ACATGGTTTTAAATGTCTGAAGG - Intergenic
1148943200 17:51233899-51233921 AAGAATTTTTAGAAATCTGAAGG - Intronic
1149192291 17:54077525-54077547 AGGTGTTTTACTAAGTCTGAAGG - Intergenic
1149761423 17:59234074-59234096 AAGTGTTTTAAAGAGTGTAATGG - Intronic
1149767280 17:59289793-59289815 AAGTGTTTTTCAAAGACTGCTGG - Intergenic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1150462356 17:65363217-65363239 AATTTTTTTTAAAAGTCACAGGG - Intergenic
1151060152 17:71082347-71082369 AAATGTTTTTAAAAATTTTATGG + Intergenic
1151124879 17:71833641-71833663 AAGTTTTTGTTAAAGTTTGAAGG - Intergenic
1151291067 17:73150362-73150384 AAATATCTTTAAAATTCTGAGGG + Intergenic
1152486595 17:80598493-80598515 AAAGGTTTTTAAAAATGTGAAGG + Intronic
1152770425 17:82164615-82164637 ATGAGTTTTTAAATGTCTGTGGG - Intronic
1153182362 18:2449196-2449218 AAGTGTGTTTAATAATCTCAGGG + Intergenic
1153346856 18:4035501-4035523 AAGGATTTTTAAAAATCTGCAGG + Intronic
1153924343 18:9822341-9822363 AAGTTTTTCTAAAAGTTTTATGG - Intronic
1154463519 18:14620145-14620167 AAGTGTTTTTATATTTTTGAAGG - Intergenic
1155016499 18:21846166-21846188 AAATGATTTTAAAATTCTTATGG - Intronic
1155218849 18:23666550-23666572 AAATGTTTTTAAAAATTAGACGG - Intergenic
1155341014 18:24814214-24814236 AAGAGTTTTTAAAAGGAAGAAGG - Intergenic
1155460188 18:26071074-26071096 AAATGGTTGGAAAAGTCTGAAGG + Intronic
1157165807 18:45357451-45357473 AAGTGTTTTAAAAAGTTAGCTGG + Intronic
1157370782 18:47109450-47109472 AAGAGCTTTTACAAGTCAGAAGG + Intronic
1158160249 18:54473466-54473488 AAGCATTTTTAAATGTTTGAGGG - Intergenic
1158255013 18:55536821-55536843 AAGTACTTTTAAAAGTATGATGG - Intronic
1158307569 18:56123641-56123663 AACTGTTTTAAAAACTGTGATGG + Intergenic
1158372771 18:56828579-56828601 AAATATTTTTTAAAATCTGAAGG + Intronic
1158754880 18:60310375-60310397 ATGTGTTTTTAAATGTCTTCAGG - Intergenic
1159194670 18:65097316-65097338 AATTGTTCTTATAAGTCTCAAGG + Intergenic
1159345564 18:67199112-67199134 ATATGTTTTTCAAAGTCTGAAGG - Intergenic
1159454192 18:68639579-68639601 AAACATTTTTAAAATTCTGAAGG + Intergenic
1159572903 18:70140280-70140302 AAGTATTTTTAATAGTTTGAAGG - Intronic
1160276968 18:77445894-77445916 AAGTGTTTTCAGAACTCTGAAGG - Intergenic
1161363288 19:3863593-3863615 ATGTGTTTTTTAATGTCTAAAGG + Intronic
1161363656 19:3866636-3866658 AAGTGATTTTCCACGTCTGATGG + Intronic
1163431183 19:17268735-17268757 AAATGTTTTTAAAACTCCAAGGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165123053 19:33574972-33574994 CAATGCTTTTAAAATTCTGAGGG + Intergenic
1165461168 19:35945112-35945134 CATGGTTTTTAAAACTCTGATGG + Exonic
1165612816 19:37171465-37171487 AAAAGTTTTTAAAATTTTGAGGG - Intronic
1166430718 19:42724567-42724589 AAGAGTTTTTGCAAGGCTGATGG - Intronic
1166443738 19:42839920-42839942 AAGAGTTTTTGCAAGGCTGATGG - Intronic
1166480709 19:43170682-43170704 AAGAGTTTTTGCAAGGCTGAGGG - Intronic
1166602414 19:44109161-44109183 AAGTGTTTTCAACAGTATTAAGG + Exonic
926468961 2:13228687-13228709 AATTTTTTTTGAAATTCTGATGG + Intergenic
927135799 2:20095509-20095531 CAGTGTTTTCAAAATTCTAAAGG - Intergenic
927264491 2:21129685-21129707 AAGTTTTTTTTAAACTTTGATGG + Intronic
927821867 2:26273262-26273284 AATTTTTTTTAATAGTCTTAAGG + Intronic
928054695 2:28040957-28040979 AAGAGTTTTTAAAAGAATGTGGG + Intronic
928304328 2:30154099-30154121 TATTGTATTTAAAAGTCTTAAGG + Intronic
928745397 2:34407968-34407990 AAGTATTTTTAAAAATATTAAGG + Intergenic
928791649 2:34963519-34963541 GAGTGTTTTTCAAATTCAGATGG - Intergenic
929334174 2:40720493-40720515 CAGTGTTTTCAACATTCTGAGGG + Intergenic
929648418 2:43653382-43653404 AAATGTCTTCAAAATTCTGAAGG + Intronic
929959042 2:46482575-46482597 AAGTATTTTGAAAAGTCTAAAGG + Intronic
930163407 2:48180504-48180526 AAATTTTTTTAAAAGTATGATGG + Intergenic
930857472 2:56034131-56034153 CTGTATTTTTAAAAATCTGAAGG - Intergenic
930961320 2:57265627-57265649 AAGTTTTTTTGTAAGTCTCATGG + Intergenic
931263812 2:60642801-60642823 AAGAGTTTTTAAAGCTCTGCAGG + Intergenic
931541262 2:63331687-63331709 AATTGTTTTTCAAAGCCTGAAGG - Intronic
931586624 2:63836905-63836927 AAGTGGTTTTAAAAGTCATTAGG - Intergenic
931863417 2:66381735-66381757 TAGTGTTTATTAATGTCTGAAGG - Intergenic
932280589 2:70488627-70488649 AAGTGTTTTCAAAAAAATGAGGG - Intronic
933137428 2:78755282-78755304 AAATGTTTTTAAAACTCTTAGGG - Intergenic
933514582 2:83284247-83284269 AAATCTTTTTAAAAGCCTGTTGG + Intergenic
934547535 2:95230766-95230788 ATGTGTTTTTAAAGCTCTGGGGG + Intronic
934887749 2:98039651-98039673 AAGTGTATTAAAAAGTTTTAGGG - Intergenic
935248518 2:101240035-101240057 AATTATTTTTAAAAGTCTGTTGG - Intronic
935551115 2:104455718-104455740 AAGTGATTTTAGAAGTCACATGG + Intergenic
935650265 2:105375872-105375894 AAGTATTTTCAGAAATCTGAGGG + Intronic
935972356 2:108542565-108542587 AATTGTTTTTCCAAGTCTCAAGG + Intronic
935980198 2:108618955-108618977 CAGCCTTTTTAAAAGTCAGAGGG + Intronic
936724743 2:115299821-115299843 AAGTGATTTTAAAATTTAGATGG - Intronic
937159735 2:119748723-119748745 CTGTATTTTTAAAAGACTGAAGG - Intergenic
937171203 2:119871268-119871290 AAGTGTTTTTGGAAGGCAGATGG + Intronic
937432893 2:121854627-121854649 AAGAATTTTAAAAAGTCAGATGG - Intergenic
937693373 2:124780990-124781012 AAGAGTTTTTAAAAGCCTGTGGG + Intronic
940542084 2:155033057-155033079 CATTGTTTTTAAAACACTGATGG - Intergenic
940990289 2:160089110-160089132 AACTGTTTTTAAATGACTGAAGG + Intergenic
941028855 2:160489224-160489246 AAGTGGTATTGAAAGGCTGAAGG - Intronic
942610531 2:177737782-177737804 AATTATTGTTGAAAGTCTGATGG + Intronic
943283428 2:185966025-185966047 AATTGTATTTAAATGGCTGAAGG - Intergenic
943411461 2:187554814-187554836 TATTTTTTTTAAAAGTCTGAGGG + Intronic
943539873 2:189199454-189199476 AAGAGCTTTCAAAAGTATGATGG - Intergenic
943652223 2:190469507-190469529 AAGCATTTTGAAAAGGCTGAGGG + Intronic
943696107 2:190934029-190934051 AAGTGATTGTAAAATTCTGTAGG + Intronic
943962145 2:194279492-194279514 CAGTGTTTTTAAAATAATGATGG + Intergenic
943984547 2:194603385-194603407 AATCGTTTTTAAATGGCTGACGG - Intergenic
944032605 2:195254758-195254780 AAATGATTTTAAAAGACTCAAGG + Intergenic
944053287 2:195495906-195495928 AATTTTTTTTCAAAGTGTGATGG - Intergenic
944928853 2:204495170-204495192 GAGTGTTTTTAAAACTTTTATGG - Intergenic
945205476 2:207327087-207327109 AACACTTTTTAAAAGCCTGAGGG + Intergenic
945456006 2:210053161-210053183 AAGTTTATTTAAAGGCCTGAAGG + Intronic
945485144 2:210386601-210386623 AAATGTTTGTAAAATTCTGAAGG + Intergenic
945505219 2:210631533-210631555 CAGAGTGTGTAAAAGTCTGATGG + Intronic
945535833 2:211016955-211016977 AAGTATTTTTAAATGTCAAATGG + Intergenic
945598546 2:211828245-211828267 ATGTGTTTTGAAAATTCTAAAGG - Intronic
945773344 2:214073690-214073712 AAGTGATTCTAAAATTCTTATGG + Intronic
946304401 2:218847472-218847494 AAGTGTTTTTAAATGCCTCTTGG - Intergenic
946319751 2:218945488-218945510 AAAGGTTTTTAAAAGTTTTAAGG - Intergenic
946623386 2:221583743-221583765 AACTGTGCTTAAAAGTTTGATGG + Intergenic
947092307 2:226525568-226525590 AAGTTTTTTTACCAGTTTGATGG - Intergenic
947253608 2:228136717-228136739 AAGTGTTTCTCAAACTCTAATGG - Intronic
1168930242 20:1616925-1616947 GAGTATTTTTATAGGTCTGATGG - Intronic
1170452857 20:16503464-16503486 AAATGTTTTGAAAATACTGATGG - Intronic
1171208715 20:23300848-23300870 TATTGTTTTTAAATGGCTGAAGG + Intergenic
1171421793 20:25022655-25022677 AAGAGTTTTTAAAAATCTTTGGG + Intronic
1172899365 20:38323064-38323086 AAATTTTTTTAAAAATCAGAAGG - Intronic
1173333865 20:42097747-42097769 ATAGGTTTTTAAAAATCTGAAGG + Intronic
1173514388 20:43654822-43654844 AACAATTTTTTAAAGTCTGATGG - Intergenic
1176728441 21:10465060-10465082 AGCTGTTTTTAAAAAGCTGATGG - Intergenic
1176811005 21:13538227-13538249 AAGTGTTTTTATATTTTTGAAGG + Intergenic
1177660875 21:24082332-24082354 AAGAGTTTTTAAAAGCCCAAGGG - Intergenic
1178250618 21:31000130-31000152 AAGAGTTTTCAAAAGCCTGCAGG + Intergenic
1178357105 21:31918697-31918719 AAATGTCTTTAAAAGACGGAGGG - Intronic
1179651901 21:42816506-42816528 AATTGTTTTTCCAAGTGTGAGGG - Intergenic
1180849184 22:19004453-19004475 AGGTATTTTTCAAAGTCAGAAGG + Intergenic
1181910801 22:26236689-26236711 AAGTGTTTTGAAAACTCTAATGG + Intronic
1182263246 22:29091432-29091454 AAATTTTTTTTAAAGTGTGAAGG - Intronic
1183105555 22:35612615-35612637 AACTGATTTTAAAATCCTGATGG + Intronic
1183769449 22:39911461-39911483 AAAGGTTTCCAAAAGTCTGACGG - Intronic
1184107700 22:42377943-42377965 AAATGTTGTTAAAAGAATGAAGG + Intergenic
1184278404 22:43423531-43423553 AAGTGTCTTTAGAGGTCTGTGGG + Intronic
1184547725 22:45183148-45183170 AAGTGTTATAAAAAGTTTCATGG + Intronic
1184627571 22:45748916-45748938 AATTTTTTTTAAAAGACTAAAGG + Intronic
949967459 3:9370096-9370118 AAGTATATTTAAAAGTTTAAGGG - Intronic
950554486 3:13686914-13686936 CAGCGTTATGAAAAGTCTGAGGG - Intergenic
950832570 3:15889802-15889824 AAGTGTATTTTAAAGTATAATGG + Intergenic
950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG + Intronic
951725478 3:25753248-25753270 AATTTTTTTTGAAAATCTGAGGG + Intronic
951771330 3:26260671-26260693 AAGTGTTTTTATATGTGGGATGG - Intergenic
951820500 3:26804940-26804962 ATGGGTTCTTAAAAGTCTGGTGG + Intergenic
951997288 3:28745186-28745208 AAGTGTTTTTATGATGCTGATGG - Intergenic
952100959 3:30012288-30012310 ATGTGTCTTTACAAGGCTGAAGG + Intergenic
952802351 3:37307796-37307818 ACGTGTTTTTAAATTACTGATGG - Intronic
954860615 3:53686781-53686803 ATGTTTTATTGAAAGTCTGAAGG + Intronic
955013453 3:55044132-55044154 AAATATTTTGAAAAGTCTGCTGG + Intronic
955250262 3:57274809-57274831 AAGTGTTTTCAAATGAATGATGG - Intronic
955736866 3:62047847-62047869 ATCTGTTTTTAAAAGGCTGGGGG - Intronic
955824528 3:62931409-62931431 AGGACTTTTTAAAACTCTGATGG + Intergenic
956056922 3:65309446-65309468 ATGTGTTTTTAAAGGTTTGCAGG + Intergenic
957006943 3:74959962-74959984 AAGTGTTTTTAAAAAATTGTTGG + Intergenic
957197373 3:77086825-77086847 AAGGATTTTTAAAAGACAGATGG - Intronic
957479903 3:80778825-80778847 AAGTATTTTTAAATTTCAGATGG + Intergenic
957517687 3:81277298-81277320 AAGGGATTTTAAAAGACTGAAGG + Intergenic
957666513 3:83237195-83237217 AAGTGTTTTCAAAAATCTGAAGG + Intergenic
958046584 3:88291768-88291790 AAGTGTTTGTAAAAGTACAATGG - Intergenic
958432209 3:94055134-94055156 AAATGTTTTTAAAATGCTTAAGG - Intronic
958686553 3:97405590-97405612 AATTGTTTCTAAAATTCAGATGG + Intronic
959167165 3:102794774-102794796 AGCTGCTTTTAAAAGTCTAAGGG + Intergenic
959179408 3:102959603-102959625 AAGTTTTTTGAAAAATCTGCCGG + Intergenic
959844457 3:111017403-111017425 TATTGTTTTTAAAATTCAGACGG - Intergenic
959974840 3:112447176-112447198 AAGAATTTTTAAAACTCTGGTGG + Intergenic
960127752 3:114018955-114018977 ATTTGTTTTTAAAAGTGTGAGGG - Intronic
961472296 3:127123364-127123386 AAGCATTTTTATAAGTCTGCAGG - Intergenic
961761233 3:129169651-129169673 ATCAGTTTTTAAAAGTCAGATGG - Intronic
961797935 3:129423322-129423344 AAGTGTTCTAAAAAATCAGAAGG + Intronic
961944890 3:130675634-130675656 AAGTGTTTTGAAAAGTCTAATGG + Exonic
962464607 3:135645937-135645959 AAGTGTTTATAATATTCTGATGG + Intergenic
962771044 3:138610309-138610331 AAGGGATTTTAAAAGATTGATGG + Intronic
963158551 3:142126350-142126372 CAGTTTTTTTAAAAGCCAGAAGG + Intronic
963182505 3:142373681-142373703 CAGTGGTTTCAAAATTCTGAGGG + Intronic
963182884 3:142378963-142378985 CAGTGGTTTCAAAATTCTGAGGG + Intronic
963227608 3:142878131-142878153 TAGTGTTTTCAAAAATGTGAAGG - Intronic
963322601 3:143825485-143825507 AATTACTTTTAAAAGTCTTATGG + Intronic
963690010 3:148487604-148487626 AAGTATTAGTACAAGTCTGAAGG - Intergenic
964266469 3:154902574-154902596 CAGTGATTTTAACAGTCTTAGGG - Intergenic
964280448 3:155058515-155058537 AATTGTTTTAAAAAGTATAAGGG - Intronic
964308566 3:155367772-155367794 CAGTCTTTTTAAAAGTCTATTGG - Intergenic
964309229 3:155374692-155374714 CAGTGGTTTTAATAGGCTGAAGG - Intergenic
964648783 3:158988376-158988398 AAGTGTTTATAGTATTCTGATGG + Intronic
964685277 3:159388562-159388584 AAGTGATTTTAAAATTCTGTGGG + Intronic
965001887 3:162964596-162964618 TAGTCTTTTGAAAATTCTGAAGG - Intergenic
965773345 3:172203832-172203854 AATCATTTGTAAAAGTCTGAAGG - Intronic
965788877 3:172366257-172366279 AAATGTTTTTAACATTCTAAAGG + Intronic
965893587 3:173545540-173545562 TGGTTTTTTTAAAAATCTGAGGG + Intronic
966529864 3:180964946-180964968 AGGTGATTTTAGAAGTTTGAGGG + Intronic
967087283 3:186107597-186107619 TAATTTTTTTAAAAGCCTGAAGG + Intronic
967295645 3:187962227-187962249 AAGTGTTTAAAGAAGTATGAAGG + Intergenic
968032182 3:195509734-195509756 AAGTTTTTTAAAAAGTATGATGG + Intergenic
968043330 3:195607359-195607381 ATGTTTTCTTAAAAGTCTAAAGG + Intergenic
970228840 4:13888190-13888212 AAGAGATTTTAAAAGACTGGAGG - Intergenic
970466464 4:16328487-16328509 AAGTATTTTTAAAGTTCTAAAGG + Intergenic
971387967 4:26158907-26158929 AAGTCTTCTTAAAAGTCACAAGG - Intergenic
971529500 4:27667417-27667439 AAATGTTTTTAAAATTATAAAGG - Intergenic
971607895 4:28682350-28682372 AAAAGGTTTTAAAATTCTGAGGG + Intergenic
972157075 4:36177171-36177193 AAATGTTTTGATGAGTCTGATGG - Intronic
974136014 4:57819429-57819451 ATCTGTTTTTAAAGGTCTGATGG - Intergenic
974629467 4:64465015-64465037 ATATATTTTTAAAAGACTGAAGG - Intergenic
974688026 4:65257126-65257148 AACTATTTTTAAAAGTCTAAAGG + Intergenic
975269695 4:72417362-72417384 AAGTGTTTTCAAAAGACCCATGG - Intronic
976015310 4:80545451-80545473 AGATGTTTGTAATAGTCTGAGGG - Intronic
977131379 4:93243236-93243258 AAGTAATTTTAAAAGTATTATGG + Intronic
977402905 4:96556385-96556407 TAGAGTTTTAAAAAGTCTGCAGG + Intergenic
977643867 4:99389571-99389593 AATTTTTATTAAAATTCTGATGG + Intergenic
977923538 4:102672423-102672445 AAATGTTTTTCCAAGACTGAAGG - Intronic
978374800 4:108063468-108063490 TAGTGCTTTAAAAAATCTGATGG - Intronic
979181419 4:117733293-117733315 AAGTCTCTTAAAGAGTCTGAAGG + Intergenic
979238446 4:118426952-118426974 AAGGGTTTTTAAAGGTGGGAAGG - Intergenic
979695083 4:123603799-123603821 AAGTTTGTTTAAAAGTTTTAGGG - Intergenic
979899094 4:126195051-126195073 ATGTGTTTTTATATGTCTAAAGG + Intergenic
980775791 4:137434522-137434544 AAGTATTTTTGAAAATCTAATGG - Intergenic
981208655 4:142074377-142074399 AAGAGTTTTTAACCATCTGATGG - Intronic
981520782 4:145660317-145660339 AAGTATTTTTGGAAGTCTCAGGG + Intergenic
982473680 4:155824944-155824966 AAGTGTATTTAAAAGTTGGGAGG - Intergenic
983025948 4:162738383-162738405 GACTGTTTTTAAAGGTCTTATGG - Intergenic
983284132 4:165717558-165717580 AAATGTTTTTAAAAGCATCATGG - Intergenic
984103870 4:175520066-175520088 AGATGTTTATAAAAGTATGAGGG + Intergenic
984597104 4:181682650-181682672 AAGGTCATTTAAAAGTCTGATGG - Intergenic
984774488 4:183468746-183468768 TGGTGTTTTTTAAAGTCTGATGG + Intergenic
984861621 4:184245487-184245509 AAAACTTTTTAAAAGTCTAATGG + Intergenic
986361925 5:6987130-6987152 AAGTTTTTTAAAAAGAATGATGG - Intergenic
987084139 5:14453528-14453550 AAGTGTTTATAAATGTAGGATGG - Intronic
987274764 5:16350717-16350739 TAGTATGTTTATAAGTCTGATGG - Intergenic
988119677 5:26944484-26944506 TAATGTTTTTAAAAGTTTGGGGG - Intronic
988372927 5:30395800-30395822 AAGTATTTTTAAAAAAATGATGG - Intergenic
988589225 5:32534563-32534585 AAGTGATTTTAAAACCATGAAGG - Intronic
989975258 5:50578262-50578284 AAGTGTTTGTTAAAGACTTATGG + Intergenic
990079507 5:51896276-51896298 AAGTGTTCATAAAAGTCTTCTGG - Intergenic
990294690 5:54388956-54388978 ATGTGTTTTTAAAATTCTTTTGG - Intergenic
990379346 5:55206867-55206889 AATCGTTTTTAAATGGCTGAAGG - Intergenic
990402491 5:55452879-55452901 AATTATTTTTAAAAATCAGAAGG + Intronic
990536277 5:56726119-56726141 AAGTGTTTTTGAAAAACTGATGG - Intergenic
990588608 5:57238601-57238623 ATGTGTTTTTAGAAGTCCTATGG + Intronic
990915887 5:60905570-60905592 AACTTTCTTTAAAAGTCAGATGG + Intronic
990933408 5:61119202-61119224 AAGTCCTTTTAAAAGCCTTAAGG + Intronic
991123102 5:63039172-63039194 AAGCATTTTTAAAAATCAGAAGG - Intergenic
991217178 5:64168971-64168993 GAGTATTTTTAAAAGTCTGTTGG + Intronic
991380115 5:66012460-66012482 CATTGTTTTCAAAAGTTTGAAGG - Intronic
991650071 5:68843520-68843542 AGTTTTTTTTAAAAGTCTGTAGG + Intergenic
991918729 5:71632063-71632085 AAGCATTTTTATATGTCTGATGG + Intronic
992017043 5:72585900-72585922 AAGTTTTTTTAAAAGTTTTGTGG - Intergenic
992193620 5:74317955-74317977 AAGTCTTTAAAAAAGACTGAAGG - Intergenic
992548148 5:77835696-77835718 AAGTTTCTTTAAAAGTATTATGG + Intronic
992567609 5:78014562-78014584 AAATGTTTTTTAAGGTCTGCAGG + Intronic
992974805 5:82103751-82103773 AAGTGTTTTAAAAAGCTTGGTGG + Intronic
993762778 5:91817535-91817557 AAGTGATTACAAAAGTGTGATGG + Intergenic
993782062 5:92078515-92078537 AAGTATATTTAAAATTCTAAAGG + Intergenic
994142011 5:96352242-96352264 AAGTGAATTCAAAAGTCTGATGG + Intergenic
994408342 5:99374636-99374658 AAGTGTTTTTAGAAGTTTGTTGG + Intergenic
994965843 5:106669759-106669781 TAATGTTTTGAAAACTCTGAAGG - Intergenic
995730616 5:115237197-115237219 CAGTGTTTTGAAAACACTGACGG + Intronic
996877248 5:128253130-128253152 AAGTGTTTTTAAAGTTTTGAAGG + Intergenic
997137399 5:131341381-131341403 TAGTGTCTTTAAAATCCTGAGGG + Intronic
998570677 5:143253927-143253949 AATCGTTTTTAAATGGCTGAAGG + Intergenic
998918366 5:147040856-147040878 AGGTATTTTTAAATGGCTGAGGG - Intronic
999881118 5:155865018-155865040 AATAGGTTTTAAAAGTCTAAAGG - Intergenic
1001127634 5:169034643-169034665 GAGTGTTTCTAAAAGTCATAAGG + Intronic
1002738868 5:181418921-181418943 AAGGGTTTTTAAAGGTGGGAAGG - Intergenic
1003044885 6:2724587-2724609 AACTGATCATAAAAGTCTGAAGG - Intronic
1003586787 6:7397441-7397463 AAGTATTTTTAAAAATTTAAGGG + Intronic
1004104000 6:12646264-12646286 CAATGTGTTTAAAAGTGTGATGG - Intergenic
1004181301 6:13382646-13382668 ATTTTTTTTTAAAAGTCTGTGGG - Intronic
1004246331 6:13980171-13980193 AAGGCCTTTTAAAAGTGTGATGG - Exonic
1005256403 6:24007973-24007995 AATTGTTCTTATAAGTCTTATGG + Intergenic
1006420705 6:33932044-33932066 AATTGTCTTTAAAAGAATGAGGG + Intergenic
1008057499 6:46960303-46960325 AAGTTTTTTAAAAAGCCAGAGGG + Intergenic
1008113010 6:47513864-47513886 AAATTTTTTTTAAAGTCTGATGG - Intronic
1008634055 6:53391890-53391912 AAATATCTTTAAAAGTCTAAGGG + Intergenic
1008889291 6:56467419-56467441 AGTGGTTTTTAAAAGTTTGATGG - Intronic
1009408996 6:63343804-63343826 AACTGCTTTTAAAAGGCTCATGG - Intergenic
1009633953 6:66239422-66239444 AAGTATTTTTAAAATTTTAACGG + Intergenic
1010379903 6:75212330-75212352 AAGAATTGTTAAAAGTCTGTGGG + Intergenic
1010433718 6:75807133-75807155 CAATGTTTTTAAAATTCTGGAGG - Intronic
1010878734 6:81141457-81141479 AAGGGTTTTTAAATTTCTGTGGG - Intergenic
1011882626 6:92049634-92049656 AACTATTTTTAAAACTCTAAAGG - Intergenic
1012004620 6:93697020-93697042 AACTATTTTTAAAACTCTAAGGG - Intergenic
1012012410 6:93806010-93806032 AAATGTTATTAAAAGTCATAAGG - Intergenic
1012393752 6:98772057-98772079 AAGTGTGTCTGACAGTCTGAGGG - Intergenic
1012523145 6:100144749-100144771 AAGTTCTTTTAAAAATCAGAAGG + Intergenic
1012945590 6:105462217-105462239 TAGTCTTTTTAAAAGTCCCATGG + Intergenic
1013517221 6:110899566-110899588 AATTTTTTTTAAAAGCCTGATGG + Intergenic
1014262928 6:119240538-119240560 AAGTGTTTTTTATTCTCTGAAGG - Intronic
1014316160 6:119867475-119867497 AAGTGTATTTAAAATGCAGAAGG + Intergenic
1014405384 6:121044279-121044301 AATTATTTTTAAAAGTCTGTCGG - Intergenic
1014739755 6:125135048-125135070 ATAAGTTTTTAAAAGACTGAAGG - Intronic
1014803831 6:125807197-125807219 AGCTGTTTTTAAACATCTGAAGG - Intronic
1015139012 6:129908896-129908918 AACATTTTTTAAAAGTTTGATGG + Intergenic
1015484259 6:133750265-133750287 AAGTGTTTGGAAAATTATGAAGG + Intergenic
1015502596 6:133949900-133949922 CAGTGTTTTTCAAAGTCTCTAGG + Intergenic
1015596039 6:134868257-134868279 ATGTGTTTTTAAAAGATTGTAGG + Intergenic
1015867918 6:137746294-137746316 AAATGTTTTTAGAAGTCAGAAGG + Intergenic
1016093605 6:140009122-140009144 AATGATTTTTAAAAGTCTGCAGG - Intergenic
1016594332 6:145782420-145782442 AAGTAATTTTAAAAGAGTGAAGG + Intergenic
1016732172 6:147438843-147438865 AACTGTTTTTAAAGGACTGCTGG + Intergenic
1017178183 6:151524724-151524746 AAGTATTTTTAATGGTCTGAAGG - Intronic
1017557577 6:155588520-155588542 AAGAGTTTATAGATGTCTGATGG - Intergenic
1017694513 6:157001099-157001121 AAATGTGTTTCAAATTCTGAAGG - Intronic
1019053725 6:169205000-169205022 AATTGCTTTCAAAATTCTGATGG - Intergenic
1019243976 6:170694473-170694495 AAGGGTTTTTAAAGGTGGGAAGG - Intergenic
1019877015 7:3822466-3822488 AAGTGATTTGAAAAGTATGTGGG + Intronic
1020273478 7:6611147-6611169 AAGTGTCTTTAACATTCTGAGGG + Intergenic
1020893370 7:13908224-13908246 AAGAGTATTTAAAAGTCGAAGGG + Intronic
1020921913 7:14276444-14276466 AAATGTTTTTAAAAATATGATGG - Intronic
1021213684 7:17888633-17888655 CAGTGTTTTGAAAATTGTGAAGG - Intronic
1022668122 7:32430071-32430093 AAGTGATTTTAAAAGTTACAAGG - Intergenic
1022965905 7:35471349-35471371 GATTGTTTATAAAATTCTGAAGG + Intergenic
1023105063 7:36755841-36755863 AAGTGTTTCTAAAGTTCTCATGG + Intergenic
1023122651 7:36925216-36925238 TAGTGTTTTTAAAAATCTACTGG - Intronic
1023713512 7:43019845-43019867 AAGGGTTTTTAAAGGTGGGAAGG + Intergenic
1024286826 7:47765106-47765128 AAGGGTTTTTAAAGGTGGGAAGG + Intronic
1024502484 7:50126120-50126142 AAATGTTTTTAAAAGCCCAAAGG + Intronic
1024776775 7:52797073-52797095 CAATGCTTTTAAAATTCTGAGGG - Intergenic
1025729339 7:64096330-64096352 AAGTGTTTTTAAAAATTAGCTGG + Intronic
1027472612 7:78591929-78591951 AACTTTTTTAAAAAATCTGATGG + Intronic
1027556122 7:79666813-79666835 AAATGTTATGCAAAGTCTGAGGG + Intergenic
1029903089 7:104062592-104062614 ATGTTTTTTCAAAATTCTGATGG - Intergenic
1030429246 7:109421014-109421036 AAGTGATTCTAAAACTGTGAAGG - Intergenic
1030535826 7:110765863-110765885 AACAGTTTTTAAAAATCTAATGG - Intronic
1031097274 7:117435219-117435241 AAGTGTTTAGAAAAGTGTCAAGG - Intergenic
1031659613 7:124405454-124405476 AATTTTTTTTTAAAGCCTGAAGG + Intergenic
1031782308 7:125984268-125984290 AAGTGTCTTTATTAGTGTGATGG + Intergenic
1032415725 7:131733949-131733971 AATTGTTTTTAAAAGGCTACTGG - Intergenic
1032434121 7:131886166-131886188 AAGTGTTTTTCAGATTCTGGAGG + Intergenic
1032616997 7:133483708-133483730 CAGTTTTTGTAAAAGTCTGATGG + Intronic
1033223812 7:139545450-139545472 AAGAGTTTGTGAAAGTCTTATGG + Intergenic
1033387200 7:140889354-140889376 AAGTGAGTTTAAAATTATGAAGG - Intronic
1033830995 7:145252438-145252460 GAGTGTTTTAAACATTCTGATGG + Intergenic
1034601647 7:152262899-152262921 AGCTGTTTTTAAAAAGCTGATGG + Intronic
1034783943 7:153907925-153907947 AAGTGTTTTTAGATATCTGGAGG + Intronic
1034945140 7:155257244-155257266 AAGTGTTTTCTAAATTCTCAAGG - Intergenic
1035504150 8:113687-113709 AAGGGTTTTTAAAGGTGGGAAGG + Intergenic
1035765760 8:2104297-2104319 AATTGTTTTTAAAAGTTTATTGG + Intronic
1036465823 8:8996077-8996099 TAATGTTTTTAAATGACTGAAGG + Intergenic
1036877406 8:12484881-12484903 AAGGGCCTTTAAAAGTCTTAGGG + Intergenic
1036909434 8:12742410-12742432 AAGTCTTTTTAAAAGCCACATGG + Intronic
1037413740 8:18625282-18625304 CAGTGTTTATAAAAATTTGATGG - Intronic
1038132759 8:24751438-24751460 AAGTGATTTCAAAGATCTGAGGG - Intergenic
1038943221 8:32328935-32328957 AAGGGTTTTAACAAGTCAGAAGG - Intronic
1039877246 8:41597292-41597314 AAGTGTTTGGAATAGCCTGAAGG + Intronic
1040067399 8:43158451-43158473 AGGTTTTTTTATAAGTATGAAGG + Intronic
1040615408 8:49031335-49031357 AATTGTTTTTATATTTCTGAAGG + Intergenic
1041276391 8:56163523-56163545 AAGTGTTATTTCAAGTCTGGGGG + Exonic
1041996264 8:64062395-64062417 AAGTGTTTTTGTAAGCCTCATGG + Intergenic
1042278273 8:67028179-67028201 AAGGGTTTTGAAAAGCCTGAGGG - Intronic
1042344722 8:67715816-67715838 AAGTGCCTTAGAAAGTCTGAAGG - Intronic
1043148919 8:76688501-76688523 AAGTCTTTTTAAAAGTGTCTAGG + Intronic
1043458588 8:80437038-80437060 AACTGTTTTTAAAAATATAAAGG - Intergenic
1043640817 8:82447969-82447991 AACTGTTTTTAAAATTCACATGG - Intergenic
1043698762 8:83256474-83256496 TAGTGCTTTTAAAAATCTTATGG + Intergenic
1043759659 8:84051793-84051815 AAGTGTTTACAAAAGTCTGTGGG - Intergenic
1043772972 8:84227927-84227949 AGGTGTCTTTTAAATTCTGATGG - Intronic
1044301287 8:90586538-90586560 AAGTGTTTTTAAAAATATTGTGG + Intergenic
1044995118 8:97831080-97831102 ATGTGTTTTTAAACGACTGTTGG + Intronic
1046110130 8:109712792-109712814 ACCTGTTTTTAACAATCTGATGG + Intergenic
1046262496 8:111787303-111787325 GAAGGTTCTTAAAAGTCTGAGGG + Intergenic
1046482974 8:114847628-114847650 AAATATTTTTCAAAGCCTGAGGG + Intergenic
1047657974 8:126999604-126999626 ATGTATTTTTAAAATTCTTAAGG - Intergenic
1047875140 8:129128171-129128193 AAGAATTTTTAAATTTCTGATGG + Intergenic
1048454678 8:134567037-134567059 AAAGGTTTACAAAAGTCTGAAGG - Intronic
1049923243 9:384607-384629 CAGTGTTTTTAAAAGACCCAGGG - Intronic
1049998789 9:1053843-1053865 AACTCTGTTTAAAAGGCTGAAGG - Intronic
1052029605 9:23613130-23613152 AAGTGTTTTTAAAAGTTGTCAGG - Intergenic
1052178514 9:25495693-25495715 AATTGTTCTTAAACGTCTCATGG - Intergenic
1053332413 9:37226397-37226419 AAGTTTTTTTTAAAGCCTGCTGG - Intronic
1055972095 9:81921592-81921614 AATTGTTTTAAAATGACTGAAGG + Intergenic
1055973848 9:81936664-81936686 AATTGTTTTAAAATGACTGAAGG + Intergenic
1056220238 9:84444772-84444794 AACCATTTTTAAAAGTCAGAAGG - Intergenic
1056335783 9:85567234-85567256 AAGTGACTTTAAAAGTCTTTAGG + Intronic
1056911988 9:90709449-90709471 GAATGCTTTCAAAAGTCTGAGGG + Intergenic
1057711197 9:97446603-97446625 AAGAATTTTTAAGAGTCTGCAGG - Intronic
1058201739 9:102050854-102050876 AATTGTTTTTGAAAGACTGTCGG - Intergenic
1058227108 9:102378876-102378898 AATTGTTTTTAAGAGTCATAAGG - Intergenic
1058626990 9:106944332-106944354 ATATTGTTTTAAAAGTCTGATGG - Intronic
1058639727 9:107071284-107071306 AAATGTTTCTGAATGTCTGATGG + Intergenic
1058804038 9:108572919-108572941 ACGTGTTTTTAACATTTTGATGG - Intergenic
1058859602 9:109102618-109102640 TTGTGTTTTTAAAAGCCTAAAGG + Intronic
1058889336 9:109347403-109347425 AATTCTTTTTAAAACTCTGTTGG - Intergenic
1059564223 9:115366849-115366871 AGATATTTTTAGAAGTCTGAGGG + Intronic
1059815888 9:117914303-117914325 AATTGTTTGGAAAAGTTTGAGGG - Intergenic
1059868756 9:118546720-118546742 AATTTTTTTTTAAAATCTGAAGG + Intergenic
1059979038 9:119748816-119748838 AAGTGTTTTTGAAATTTTCATGG - Intergenic
1060877956 9:127096643-127096665 AAGTGTTTTTAAATGTTTTGGGG + Intronic
1203604165 Un_KI270748v1:43697-43719 AAGGGTTTTTAAAGGTGGGAAGG - Intergenic
1186029946 X:5357112-5357134 ATGTTTTTTTAAAAGTATCAGGG + Intergenic
1186732729 X:12427648-12427670 AAATAGTTTTAAAAGGCTGATGG + Intronic
1186958668 X:14711099-14711121 AAGTATTTTCAAAAGAATGAAGG - Intronic
1187252261 X:17609253-17609275 AAGTGTTTATAAAAAGCTGTGGG + Intronic
1187599439 X:20811470-20811492 AAATGTTTTTAAAAATCTGATGG - Intergenic
1187772246 X:22713052-22713074 AAATGATTTTAAAAGGGTGATGG + Intergenic
1188233632 X:27698718-27698740 CATTTTTTTTAAAAGTCAGACGG - Intronic
1189238343 X:39506210-39506232 CACTGTTTTTAAAACTATGAAGG + Intergenic
1189758623 X:44298130-44298152 AAGTATTTTAAAACCTCTGAAGG + Intronic
1189831065 X:44973543-44973565 CAATGTTTTCAAAATTCTGAAGG - Intronic
1190023078 X:46897112-46897134 AATCGTTTTTAAATGGCTGAAGG - Intronic
1190552881 X:51602940-51602962 AAGTGTTTTTTGATGTCAGAGGG + Intergenic
1190860389 X:54339052-54339074 ACTGGTTTTTAAAAGACTGAGGG - Intronic
1191158241 X:57298805-57298827 AGGTGTTTATAGTAGTCTGATGG - Intronic
1191160567 X:57325629-57325651 AGGTGTTTATAGTAGTCTGATGG + Intronic
1192747161 X:73950673-73950695 AAATGTTATTAAAAATCAGAAGG + Intergenic
1192857626 X:75030251-75030273 AAGTGTTTCAAAAAGTAGGAGGG - Intergenic
1194147873 X:90285314-90285336 AAGTTTTCTTAAAGGTCTAAAGG + Intergenic
1194451000 X:94044759-94044781 ATGTATTTTTAAAGGTCTAAAGG - Intergenic
1194504643 X:94717862-94717884 AAATATTTTTAAAAAACTGAGGG - Intergenic
1196035719 X:111141966-111141988 AAGTGTTGTTAAAATTGTGTTGG + Intronic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1196772933 X:119313368-119313390 ATGTTTTCTTAAAAGTCTAAAGG + Intergenic
1198005102 X:132485357-132485379 CATTGTTTTTAAAAGATTGATGG - Intronic
1198366401 X:135944401-135944423 AAGATTTTTTAATATTCTGAAGG + Intergenic
1198697731 X:139361203-139361225 AAGGTTTTTTAAAAGACTAAAGG + Intergenic
1199339126 X:146655672-146655694 AAATATTTTTAAAAGCATGAAGG - Intergenic
1200494256 Y:3862073-3862095 AAGTTTTCTTAAAGGTCTAAAGG + Intergenic
1201927527 Y:19304619-19304641 AAGTGTCATTCAAGGTCTGAGGG + Intergenic
1201954802 Y:19611322-19611344 ATATGTTATTAAAAGTCTAAAGG + Intergenic
1202280087 Y:23174865-23174887 ATGTGTTTTTGAAAATGTGAAGG - Intronic
1202280816 Y:23185710-23185732 ATGTGTTTTTGAAAATGTGAAGG - Intronic
1202436748 Y:24847197-24847219 ATGTGTTTTTGAAAATGTGAAGG + Intronic