ID: 1101140304

View in Genome Browser
Species Human (GRCh38)
Location 12:101789098-101789120
Sequence GGGAAGAATCTGTCTTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101140298_1101140304 23 Left 1101140298 12:101789052-101789074 CCGTTTTCAAATGGAAACAAGTC 0: 1
1: 0
2: 0
3: 31
4: 357
Right 1101140304 12:101789098-101789120 GGGAAGAATCTGTCTTACTGTGG 0: 1
1: 0
2: 2
3: 13
4: 138
1101140303_1101140304 -6 Left 1101140303 12:101789081-101789103 CCTATTATATTTTTCAAGGGAAG 0: 1
1: 0
2: 1
3: 24
4: 347
Right 1101140304 12:101789098-101789120 GGGAAGAATCTGTCTTACTGTGG 0: 1
1: 0
2: 2
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101140304 Original CRISPR GGGAAGAATCTGTCTTACTG TGG Intronic
901427160 1:9189577-9189599 GGGAAGGATCTCTCAGACTGGGG - Intergenic
903494977 1:23759782-23759804 GTGAAGCCTCTGTCTCACTGAGG + Exonic
915129068 1:153684790-153684812 GGGGAAATTCTGCCTTACTGGGG - Intronic
917810042 1:178649560-178649582 TGGAAGATTCGTTCTTACTGTGG + Intergenic
918185406 1:182122305-182122327 GGGAAGAAGATGTCTGAGTGAGG - Intergenic
920746766 1:208636157-208636179 CGAAAGAGTCTGTCTTTCTGTGG + Intergenic
922070116 1:222183838-222183860 GGGAAGAATCAATCTTTCTGAGG - Intergenic
922221333 1:223610707-223610729 GGTAAGACTCTGTCCTACTAGGG + Intronic
922887300 1:229029991-229030013 CAGAAGAATCTGTCTTAGTCAGG - Intergenic
924456074 1:244219764-244219786 GGGAAGCATCACTCCTACTGGGG + Intergenic
1066112948 10:32213271-32213293 GGGGAGAATCTATCTTCTTGAGG + Intergenic
1066538711 10:36420827-36420849 GGGCAGAATCTCTCCTACAGTGG + Intergenic
1066621825 10:37363468-37363490 GGGAAGAATCTGAATTACATTGG - Intronic
1070450533 10:76553017-76553039 AGGAAGAATCTGTTTTAAAGAGG - Intronic
1070986196 10:80692199-80692221 GAGAAGCATCTCTCTTACTTTGG + Intergenic
1074164924 10:110866836-110866858 GAGGAGAATTTGTCTTTCTGGGG - Intergenic
1077370828 11:2180878-2180900 AGGAGGCATCTGTCTTCCTGAGG - Intergenic
1079146120 11:17853580-17853602 GGGAAGGCTCTGTCTCCCTGAGG - Intronic
1086050790 11:82588095-82588117 GGCCAGAATCTGTCTGACTAGGG - Intergenic
1087158782 11:94929215-94929237 GGGGAGGATTTGTCTTAATGAGG + Intergenic
1088574002 11:111252180-111252202 GGGGAGTATCTGACTGACTGAGG - Intergenic
1088855377 11:113745973-113745995 GGGAAAACTCTGTCTTAAAGGGG + Intronic
1089639076 11:119835273-119835295 GGGAAGGGTATGTGTTACTGTGG + Intergenic
1090094671 11:123730778-123730800 GGCCAGAGTCTGTCTTACAGAGG - Exonic
1091334013 11:134753241-134753263 GGAAAGACTCTGGCTTACTGTGG - Intergenic
1091539156 12:1443390-1443412 AGGAGGAATCAGTGTTACTGTGG + Intronic
1099766466 12:86993269-86993291 GGGAAAAATCTGACCTAGTGGGG - Intergenic
1101140304 12:101789098-101789120 GGGAAGAATCTGTCTTACTGTGG + Intronic
1102718924 12:114999679-114999701 GGGAAGAGTCCGTCCTACTCTGG - Intergenic
1104572233 12:129935337-129935359 AGGAAGAACCTGTCTTTCTGTGG + Intergenic
1106778610 13:33032903-33032925 GGAAAGATTCTTTCTTGCTGAGG - Intronic
1107172645 13:37361054-37361076 GAAGAGAATCTGTCTGACTGAGG + Intergenic
1108897387 13:55350349-55350371 GGTAAGAAACTGTATTAATGAGG - Intergenic
1117691693 14:58313908-58313930 GGGAAGATTCACTCTCACTGTGG - Intronic
1117926434 14:60784492-60784514 GGCAAGACTCTGTCTTGCGGGGG - Intronic
1118135027 14:63014755-63014777 GGGAAAAACCTGTCTTGCTTAGG + Intronic
1119576196 14:75724739-75724761 GTAAAAAATCTGTCTTATTGAGG - Intronic
1119919010 14:78428758-78428780 GGACAGATTCTGTCTTACTGCGG + Intronic
1120074836 14:80144233-80144255 GTGAAGCATCTGGATTACTGGGG - Intergenic
1120932284 14:89860911-89860933 GAGAAGAATTTGTGTTACTGGGG - Intronic
1121014647 14:90541266-90541288 GGGATGAATCTGCCACACTGAGG - Exonic
1124890056 15:33724556-33724578 AGGAAGAGTCTGCCTTCCTGGGG - Intronic
1125794462 15:42394186-42394208 GGGAATCTTCTGTCTTGCTGAGG - Intronic
1126353198 15:47766673-47766695 TGGAAGATTCTGTCTTACCATGG - Exonic
1126464986 15:48953775-48953797 AGGTAGAATCTGTCCTAATGTGG + Intronic
1127569054 15:60223092-60223114 GGAAAGACTCAGTCTTACTATGG - Intergenic
1128415155 15:67437917-67437939 GAGAATAATCAGTGTTACTGAGG + Intronic
1130298309 15:82662632-82662654 GGGCAGAGTCAGTCTTTCTGTGG - Intronic
1134616174 16:15652575-15652597 GGAAAGAATTTTTCCTACTGTGG - Intronic
1135801555 16:25501903-25501925 GGCAAGAATGTGACTTATTGAGG + Intergenic
1141322406 16:83024107-83024129 GGCATGAATTTGTCTAACTGAGG + Intronic
1141341090 16:83204321-83204343 GGTAATAATCTGTTTTACAGAGG - Intronic
1141460851 16:84178071-84178093 TGGAAGATTCTGTTTTCCTGTGG - Exonic
1143213548 17:5207431-5207453 GGGAAGAATGTTTCATACAGAGG + Intergenic
1146608762 17:34286146-34286168 GGAATGGCTCTGTCTTACTGTGG + Intronic
1146778192 17:35641162-35641184 TGGAATCATCTGTCGTACTGGGG - Intronic
1148913735 17:50957249-50957271 GGGAGGAATGTGTCTTAATTAGG - Intergenic
1150216665 17:63475304-63475326 GGGAGGAAGCAGTCTTTCTGTGG - Intergenic
1150226183 17:63525756-63525778 GGGAAGAATCTGGCTTAGTGTGG + Intronic
1152229807 17:79108822-79108844 GGGAAGAAGCTGTGGTACGGGGG - Intronic
1155493084 18:26418715-26418737 GGGAAGATTCTGTCCTGCTGCGG + Intergenic
1156720268 18:40061562-40061584 GGAAAGTGTCTGTCCTACTGGGG - Intergenic
1156750499 18:40447765-40447787 GGGCAGAAGGAGTCTTACTGGGG + Intergenic
1164187357 19:22882083-22882105 AGGAAGAAGCTGTCTTGTTGAGG - Intergenic
1167724208 19:51199812-51199834 GCGGAGAATCTGAGTTACTGGGG + Intergenic
925365590 2:3309734-3309756 GGGAAGCATCTGTCGTTTTGGGG - Intronic
929783196 2:44971093-44971115 GGGGAGAATCTGACTTTCTGGGG - Intergenic
931106343 2:59060714-59060736 TTTAAAAATCTGTCTTACTGGGG + Intergenic
931718898 2:65052955-65052977 GAGAAGATTCTGTCTTCCAGAGG - Intergenic
933358573 2:81247614-81247636 GGAAAGAATTTGTCTTCCTGAGG + Intergenic
933767491 2:85719994-85720016 TGGAAGAAGCCGTCTCACTGGGG + Intergenic
934981049 2:98841643-98841665 GTGTAGAATCTGTTTTACTGGGG + Intronic
939854185 2:147337526-147337548 GGGAAGACTGTGTCTATCTGTGG + Intergenic
940185494 2:150980523-150980545 GAGAAGGAGCTGTCTTTCTGAGG - Intergenic
941986394 2:171515724-171515746 AGGAAGAAACTCTCTTACTAAGG - Intergenic
943222097 2:185122894-185122916 GGGAAGAATCAGTCTTTCTTTGG - Intergenic
1174367946 20:50067726-50067748 GGGAAGAATGTGTCCTGCAGAGG - Intergenic
1175782621 20:61693155-61693177 GGGAAGCATCTGATATACTGTGG - Intronic
1178160057 21:29901947-29901969 GGGATGAAGCTGACTTATTGTGG - Intronic
1178254314 21:31037617-31037639 GGGCAGTATTTGTCTTTCTGTGG - Intergenic
1178432333 21:32527540-32527562 GGTGAGATTCTATCTTACTGTGG - Intergenic
1179798159 21:43797781-43797803 GGGATGAATCTGTCTCAGAGTGG + Intronic
1182437268 22:30338771-30338793 GGGTAGATGCTGGCTTACTGTGG + Exonic
1184187376 22:42873715-42873737 GGGAAGAATCTGGGTTGCTGTGG + Intronic
949135504 3:560159-560181 GGGAAGAAATTGTCTTTCTGTGG - Intergenic
954198241 3:49008596-49008618 TGGAAGAATCTGTCATTTTGGGG + Intronic
954337708 3:49929469-49929491 GGGAAGACTGTGTCTCCCTGCGG - Intronic
960827856 3:121811403-121811425 GTGAACAGTCTGTCTTGCTGGGG - Intronic
961449711 3:126997087-126997109 GGCAAGACTCTTCCTTACTGTGG + Intronic
962445386 3:135459309-135459331 GGGAACAATCTGTCTAAGGGAGG - Intergenic
964556942 3:157950070-157950092 GGAAAGACTCTGTCTTACATTGG + Intergenic
964716549 3:159728543-159728565 GGGAAGAATCTGTCTCACATTGG + Intronic
965754938 3:172016140-172016162 GGGTAGAACCTGGCTAACTGTGG - Intergenic
966210851 3:177451963-177451985 GGGAAGAATCATTTTTACAGAGG - Intergenic
966427248 3:179792567-179792589 GAGAAGGAGGTGTCTTACTGAGG + Intergenic
967060196 3:185865433-185865455 GGAGAGATTCTGTCTTACTCAGG + Intergenic
970136053 4:12925235-12925257 GGGCAGAATCTGATTTACTAAGG + Intergenic
970197989 4:13572189-13572211 GGAAAGGATCTGACTTACTAGGG + Intronic
970303296 4:14703806-14703828 TGGAAGAATCTGACACACTGAGG - Intergenic
971259397 4:25042720-25042742 GAGCAGAATCTGTTTTGCTGGGG + Intergenic
972389847 4:38604328-38604350 GGGAAGAAGCTGTTTCAATGAGG - Intergenic
974530918 4:63107142-63107164 AGGGAGAATCTGTGTTCCTGGGG + Intergenic
978126336 4:105140164-105140186 GGGAATAATTTAACTTACTGGGG + Intergenic
979160888 4:117459730-117459752 TGGAAGAAGCTGACTTGCTGAGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984846799 4:184115267-184115289 AGGAAGCAACTGTCTTCCTGGGG - Intronic
985522314 5:381161-381183 AGGAAGAATCAGCCTTAATGTGG - Intronic
986700005 5:10397500-10397522 GGAAAGTATCTGTCTGTCTGGGG - Intronic
988774952 5:34469231-34469253 TGAAAGATTCTGTCTCACTGGGG - Intergenic
994426243 5:99591299-99591321 GGGGAGAATCTGTGTTTCTAAGG - Intergenic
995632918 5:114153458-114153480 GGGAGGTATCTGTGATACTGTGG - Intergenic
997676704 5:135718422-135718444 GGGAAGAATCTCTCTCTTTGAGG + Intergenic
998227566 5:140338759-140338781 GGGAAGAATGTGTCCTAGTCTGG - Intronic
998620006 5:143783205-143783227 GGGAAGAATCTGTCTTTTCCAGG - Intergenic
999267982 5:150279387-150279409 GGGAGGAAACAGGCTTACTGAGG - Intronic
999390643 5:151187054-151187076 GGGAAGCATCTGACTCAATGTGG - Intronic
1003673239 6:8179538-8179560 GGGAAGATTCTGCTCTACTGGGG + Intergenic
1005282479 6:24288890-24288912 GTGAAGAAGCTTTCTGACTGTGG + Exonic
1005853279 6:29839110-29839132 GGGAAGATGCTCTCTCACTGTGG - Intergenic
1006590501 6:35151907-35151929 GGAAATATTCTGTTTTACTGTGG - Intergenic
1007953918 6:45899096-45899118 GGGAAGAATGTGTGTTGATGAGG + Exonic
1008229300 6:48964498-48964520 TGGAAAAATCTGTATTACTTGGG + Intergenic
1010094408 6:72023984-72024006 GAGAAGACTGTGTCTTAATGAGG + Intronic
1011031223 6:82925556-82925578 GGGAAGTATCTGTCTTTCTGAGG + Intronic
1011880819 6:92023645-92023667 GAGAAGAATTTCACTTACTGAGG + Intergenic
1013400505 6:109791390-109791412 GAGAAGAAGCTGTATTACAGCGG + Exonic
1013408656 6:109865141-109865163 GGGAAGATGTTGTCTTCCTGGGG - Intergenic
1015867759 6:137744373-137744395 GCAGAGAATCTTTCTTACTGTGG - Intergenic
1017367402 6:153660305-153660327 GGCAAAATTCTGTCTTACAGTGG - Intergenic
1020392072 7:7668986-7669008 GGGAAGAAACTGGAGTACTGGGG + Intronic
1020405635 7:7830595-7830617 GGTAAGAATCAGTATGACTGTGG - Intronic
1035103965 7:156426364-156426386 TGGAGCAATGTGTCTTACTGAGG + Intergenic
1041327953 8:56689181-56689203 GGGAAGACTCTTTCTCAGTGGGG + Intergenic
1042080384 8:65045335-65045357 GGGAAGTGTCTGTTTTGCTGGGG + Intergenic
1042859265 8:73295973-73295995 AAGAAGTGTCTGTCTTACTGTGG + Intronic
1045402953 8:101836733-101836755 GGTAAAAAATTGTCTTACTGAGG - Intronic
1047724147 8:127669839-127669861 GGGAAGACTGTGCCTGACTGTGG - Intergenic
1048023572 8:130563463-130563485 GGTAATATTCTCTCTTACTGTGG + Intergenic
1052000139 9:23268860-23268882 GGGAAGAATGTGAATCACTGGGG - Intergenic
1052406488 9:28067560-28067582 GGGAAGAAACTATCTTCCAGAGG - Intronic
1052616999 9:30854371-30854393 GGGAAGAAACTGTGGCACTGGGG - Intergenic
1055530849 9:77181884-77181906 TAGAAGACTCTGTCTTACAGGGG + Intronic
1055886862 9:81073587-81073609 GGGAAGAATATGAATAACTGTGG - Intergenic
1058726086 9:107805542-107805564 GGGGAGAATCAGTCTTCCTCTGG + Intergenic
1059017514 9:110535609-110535631 AGGAAGAATCAGTATTACTATGG - Intronic
1059356575 9:113704172-113704194 GGGAAGAAGGTGTCTTGCTTTGG + Intergenic
1059728179 9:117029434-117029456 GGGAAGAAGGTGTCTTAAGGAGG - Intronic
1060519251 9:124284698-124284720 GGGAAGAATGTGTGTGTCTGGGG + Intronic
1061750040 9:132770880-132770902 GGGAAGCATCTCCCTGACTGGGG - Intronic
1203698303 Un_GL000214v1:116262-116284 GGGAAGATACTGTCTTCCTTGGG - Intergenic
1186226284 X:7402367-7402389 GGGAAGAATTTGTTATAATGTGG - Intergenic
1187423885 X:19160202-19160224 AGAAAGAACCTGTCTGACTGGGG + Intergenic
1192594394 X:72391206-72391228 TGTAGGAATCTGTGTTACTGAGG + Intronic
1194602119 X:95934938-95934960 AAGAAGAATCAGTCTGACTGGGG - Intergenic