ID: 1101144625

View in Genome Browser
Species Human (GRCh38)
Location 12:101829841-101829863
Sequence CAGTACCTGGCACTGTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 2, 1: 1, 2: 5, 3: 39, 4: 374}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101144621_1101144625 10 Left 1101144621 12:101829808-101829830 CCATTAAACAAACACTTGCACTG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1101144625 12:101829841-101829863 CAGTACCTGGCACTGTGCTTGGG 0: 2
1: 1
2: 5
3: 39
4: 374
1101144620_1101144625 23 Left 1101144620 12:101829795-101829817 CCATATAATTTAGCCATTAAACA 0: 1
1: 0
2: 3
3: 33
4: 381
Right 1101144625 12:101829841-101829863 CAGTACCTGGCACTGTGCTTGGG 0: 2
1: 1
2: 5
3: 39
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101144625 Original CRISPR CAGTACCTGGCACTGTGCTT GGG Intronic
900376778 1:2358407-2358429 CAGTACCTGACCCTCTGCTGTGG - Intronic
900671625 1:3857985-3858007 CAGTACCTGGCACTCTACCCGGG - Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900747567 1:4371564-4371586 CAGAACCTGGCACCAGGCTTTGG + Intergenic
902235038 1:15051732-15051754 CAGGCCCTGGCACAGTTCTTTGG - Intronic
902235650 1:15055765-15055787 CAGGCCCTGGCACAGTTCTTTGG + Intronic
903862585 1:26373831-26373853 CTGTGTCTGGCACTGTGCTAGGG + Intronic
903974367 1:27139497-27139519 CAGTGCCTGGCTTTGTGCTCAGG - Intronic
904288960 1:29471487-29471509 GGGTGCCTGGCACTGTGCTGGGG - Intergenic
904330467 1:29755077-29755099 GTGTACCAGGCACTGTGCTGTGG - Intergenic
904512815 1:31027782-31027804 CAGAACCTAGCACAGTGCCTGGG + Intronic
904715933 1:32467642-32467664 CAGTATCTGGCAGAGTGCTTTGG - Intronic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
904993558 1:34613422-34613444 CAGTACCTAGCACAGCGCTGGGG + Intergenic
905011552 1:34750547-34750569 CAGCACCTGCCACTCTGCCTGGG - Intronic
905854370 1:41298278-41298300 CAGGGCCTGGCAGTGGGCTTAGG + Intergenic
905918776 1:41705040-41705062 CAGAACCTCGCACAGTGCCTGGG - Intronic
905939411 1:41851184-41851206 CAGCACCTAGAACAGTGCTTGGG + Intronic
906553015 1:46682098-46682120 GAGTACCAGGTACTGTGCTAGGG + Intronic
906665053 1:47615582-47615604 CAGGAACTGACATTGTGCTTTGG - Intergenic
906719444 1:47994910-47994932 CTGTACCTGGCACTGCTCTGAGG - Intronic
906733154 1:48100531-48100553 TAGTACCAGGCCCTGTGCTAGGG - Intergenic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
908001314 1:59683144-59683166 CTGAGCCTGGCACTGTGCTAAGG + Intronic
908203563 1:61822120-61822142 CAGTACCTGGCACTAAACATGGG - Intronic
910308659 1:85797746-85797768 CAGCACCTGGAACAGTGCCTGGG + Intronic
912467926 1:109886699-109886721 CAGAACCTGGGACTGTGATGAGG - Intergenic
912626465 1:111208776-111208798 GTATGCCTGGCACTGTGCTTAGG - Intronic
912859116 1:113197374-113197396 CAGTGCCAGGCACTTTGCTAAGG - Intergenic
913594028 1:120356239-120356261 TAGTACCAGGCCCTGTGCTGAGG + Intergenic
913705300 1:121415713-121415735 CACAACCTAGCACTGTACTTAGG - Intergenic
914093228 1:144522751-144522773 TAGTACCAGGCCCTGTGCTGAGG - Intergenic
914305296 1:146411137-146411159 TAGTACCAGGCCCTGTGCTGAGG + Intergenic
914317409 1:146526918-146526940 CAGTGTCTGGCACAATGCTTGGG + Intergenic
914496947 1:148206442-148206464 CAGTGTCTGGCACAATGCTTGGG - Intergenic
914596761 1:149161675-149161697 TAGTACCAGGCCCTGTGCTGAGG - Intergenic
916518554 1:165543004-165543026 AGGTGCCAGGCACTGTGCTTAGG + Intergenic
916598572 1:166270680-166270702 CAGCACCTGGCACAGTACATGGG + Intergenic
916746356 1:167687714-167687736 CCCTTCCTGGCACTGTGCATTGG - Intronic
918444675 1:184605391-184605413 CAGAACCTAGCACAGGGCTTGGG + Intronic
919046248 1:192456237-192456259 CAATACCGTGCACAGTGCTTGGG - Intergenic
919107446 1:193171200-193171222 CAGTACCTGGCAGAGTTCTTGGG + Intronic
920258817 1:204674897-204674919 CAGTTCTTAGCACAGTGCTTGGG + Intronic
920275304 1:204800007-204800029 CTGTGCCTGGCTCTGGGCTTGGG + Intergenic
920804539 1:209220119-209220141 CAGTGCCTGGGGCTGTGCGTAGG + Intergenic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
922500644 1:226094765-226094787 ATGCACCTAGCACTGTGCTTAGG - Intergenic
922951848 1:229564447-229564469 CAGTTCCTGGCACTTTGTTATGG + Intergenic
923292574 1:232560690-232560712 CAGTACATGGCCCAGGGCTTTGG - Intronic
923320638 1:232829620-232829642 CTGTTCCTAGCACTGTGTTTAGG + Intergenic
923371900 1:233322823-233322845 CAGTACCTGACATGCTGCTTAGG + Intergenic
923497879 1:234540743-234540765 GAGTGCCAGGCACTGTGCTGGGG - Intergenic
923717202 1:236435069-236435091 CAGCACTAGGTACTGTGCTTAGG + Intronic
924453686 1:244200894-244200916 CTGTCCCTGTCACTGTGGTTGGG - Intergenic
924551582 1:245083045-245083067 CAGTACCTGGCCTGGTGGTTGGG - Intronic
924606001 1:245536006-245536028 GTGTTCCAGGCACTGTGCTTGGG + Intronic
1065686903 10:28294634-28294656 CATTTCCTGGCACTGTGCTGGGG - Intronic
1066354259 10:34666499-34666521 AAGTATCTGGCAATGTGCTCGGG - Intronic
1067177442 10:43960039-43960061 AAGAACCTGGCACGGTGCTCTGG + Intergenic
1068934278 10:62621019-62621041 ACGTGCCTGGCACTGTGCTGGGG + Intronic
1069060753 10:63892109-63892131 CAGTGCCAAGCACAGTGCTTGGG + Intergenic
1069883745 10:71610396-71610418 CTGCACCTGGCCCTGTGCTATGG - Intronic
1070108119 10:73455967-73455989 CAGAGCCTGGCACTGTGCCCTGG + Intronic
1070390486 10:75966406-75966428 AAGCACCTAGCACCGTGCTTAGG + Intronic
1070682315 10:78457131-78457153 CAGTTTCTGGCACTGTGATGGGG - Intergenic
1070749264 10:78954376-78954398 CAGGGCCTGGCACAGTGCTCAGG - Intergenic
1073481862 10:103791095-103791117 CAGTCCTTGGCACTGTTCATTGG - Intronic
1074574294 10:114654061-114654083 CAGCTCCTGGCAGGGTGCTTGGG - Intronic
1074678281 10:115877866-115877888 TAGTGCCTAGCACGGTGCTTAGG - Intronic
1076618699 10:131773128-131773150 CAGTTCCTTGCTCTGTGATTTGG + Intergenic
1076943327 10:133625188-133625210 CAGGACCTGGCAGTGTGGCTGGG + Exonic
1077128377 11:955605-955627 CAGCACCTGGGACAGTGCTTGGG + Intronic
1077269699 11:1669943-1669965 CAGACCCTGGCTCTGTGCTTCGG - Intergenic
1079377167 11:19903769-19903791 CATTCTCAGGCACTGTGCTTGGG + Intronic
1079565780 11:21880252-21880274 CAGTACTTGCCACAGGGCTTGGG + Intergenic
1080127605 11:28755475-28755497 GTGTACCAGGCACTGTGCTATGG - Intergenic
1082224287 11:49684198-49684220 CAGTACCTAGCACAGTGCTTGGG + Intergenic
1083244141 11:61412734-61412756 GTGTGCCTGGCACTGTGCTAAGG - Intronic
1085279263 11:75319654-75319676 TAGCACCTTGCACTGTGCCTGGG - Intronic
1085445216 11:76596907-76596929 CAGTGTGTGGCACTGTGCTATGG + Intergenic
1085959854 11:81448774-81448796 CATTACCTAGAACTGTGCTGAGG + Intergenic
1087142924 11:94783605-94783627 CAGGATCTAGAACTGTGCTTGGG - Intronic
1087814217 11:102640864-102640886 CAGTTCCTGGAACATTGCTTAGG + Intergenic
1087939280 11:104075755-104075777 CAATACCTGGCAGTGAGCATGGG - Intronic
1087958410 11:104318538-104318560 AAGTGCCGGGCACTGTGCTAAGG + Intergenic
1089693931 11:120204706-120204728 GTGTACCTGGCACTGGGCTATGG - Intergenic
1089713082 11:120331120-120331142 CAGAACCTGGCAGTGGTCTTGGG - Intronic
1090062658 11:123477332-123477354 AAGTACCCAGCACTGTGCTAGGG - Intergenic
1090259828 11:125311350-125311372 CAGTATCTAGTACTGTGCCTTGG - Intronic
1090417297 11:126549375-126549397 CAGTGCCGGGCCCTGTGCTCTGG - Intronic
1091454295 12:594495-594517 CAGCACCTGGCCCAGTTCTTTGG - Intronic
1094252772 12:28384554-28384576 CAGTACCTAGAACAGTGTTTAGG + Intronic
1095680428 12:44968317-44968339 CAGTACCTGGCACTGTGCTTGGG - Intergenic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1098000527 12:65937391-65937413 CAGAACCTGGGGTTGTGCTTGGG - Intronic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1099981870 12:89613459-89613481 GAATGCCAGGCACTGTGCTTAGG + Intronic
1101144625 12:101829841-101829863 CAGTACCTGGCACTGTGCTTGGG + Intronic
1101194929 12:102372061-102372083 CAGCACCTAGCACAGTGCCTGGG - Intergenic
1102540920 12:113618531-113618553 CTGTGCCTGGCACTGTCCTCAGG + Intergenic
1102786560 12:115609868-115609890 CAGCACCAGGCACTATGCTGAGG + Intergenic
1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG + Intronic
1103650767 12:122430542-122430564 CAGTACCTCGAATAGTGCTTGGG - Intergenic
1104753147 12:131252492-131252514 CAGTACCTGGCACCTGGCTCAGG + Intergenic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105579649 13:21683313-21683335 CAGTTCCTAGCACAGTGCCTGGG + Intronic
1106247721 13:27963163-27963185 CAGTGCCTGGCTCTGTCCCTGGG - Exonic
1106465530 13:30011059-30011081 CAGCACTTAGCACTGTGCTTGGG + Intergenic
1106611206 13:31282919-31282941 CAACACCTGGCACAGTGCCTAGG - Intronic
1111647876 13:91054656-91054678 ATGTACCTGGCTCAGTGCTTTGG + Intergenic
1111710678 13:91809140-91809162 CTGTACCTGTGAATGTGCTTTGG + Intronic
1111931705 13:94519307-94519329 CAGCACCTAGAACAGTGCTTGGG + Intergenic
1111991011 13:95117274-95117296 AAGTACCTGGCGTTGTGCCTGGG - Intronic
1112342523 13:98564465-98564487 CAGGAACAGGCACTGAGCTTTGG + Intronic
1112439164 13:99413376-99413398 CAGTAGCTGGCACAGCACTTGGG - Intergenic
1112806727 13:103171066-103171088 CATCACCTGGCACAGTGTTTTGG + Intergenic
1115916310 14:38319144-38319166 CTGTACATGACACTGGGCTTTGG - Intergenic
1117273871 14:54172607-54172629 GGGTACCTGGCACTGTGCTCTGG - Intergenic
1117636401 14:57748916-57748938 AAGTACCTAGCACAGTGCCTAGG - Intronic
1117769647 14:59119976-59119998 CAGTACCTGTGTCTGGGCTTTGG + Intergenic
1119535906 14:75402178-75402200 CAGAACCTGGAAGTGGGCTTGGG - Intergenic
1120984562 14:90322650-90322672 CAGTACCTAGACCTGTGCCTGGG - Intronic
1121269669 14:92629672-92629694 AGGTACCTGGCACTGTGCTAAGG + Intronic
1121295044 14:92813729-92813751 GAATACCAGGCACTGTGCTGGGG - Intronic
1121544115 14:94751096-94751118 CAGTACCTGCCACTGTCTTGGGG + Intergenic
1121564967 14:94902365-94902387 AAGTGCCTGGCATGGTGCTTGGG + Intergenic
1121572361 14:94956603-94956625 CTGTCCCTGGCACTGAGCTCAGG + Intergenic
1121816087 14:96929582-96929604 CAGTTTCTGGCTCTTTGCTTGGG + Intronic
1122161739 14:99789608-99789630 CAGTGCCAGGCCCTATGCTTGGG - Intronic
1122191469 14:100047379-100047401 TAGAACCAGGCTCTGTGCTTGGG - Intronic
1122374792 14:101250639-101250661 CAGCACCTAGCACAGAGCTTGGG - Intergenic
1122455197 14:101844825-101844847 CAGTACCTGCCTTTGTTCTTTGG + Intronic
1123439553 15:20280803-20280825 CAGTCCCAGGCTCAGTGCTTTGG - Intergenic
1123703400 15:22932717-22932739 CAGCATCTGGAACTGTGCTGAGG + Intronic
1123708292 15:22966567-22966589 CAGTCGCTGGTACTGTGTTTTGG + Intronic
1123753352 15:23375895-23375917 CTGTACCTGTGAATGTGCTTTGG - Intergenic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124792285 15:32739778-32739800 GACTACATGGCACTGTGCTGGGG - Exonic
1125106695 15:35979929-35979951 CAGTACTTGGCACTGGGATAAGG - Intergenic
1125259330 15:37804518-37804540 CAGTGCCTGGCTCTGTTCTAGGG + Intergenic
1126354053 15:47776044-47776066 CAGGACAAGGCACTGTGCTCTGG + Intergenic
1126444017 15:48721645-48721667 CTGAGCCTGGCACTGGGCTTTGG + Intronic
1126911079 15:53417753-53417775 CAGTACCTAGCACTGTGCTTGGG - Intergenic
1128216325 15:65936746-65936768 CAGTACCTGGCACAGAGTATGGG + Intronic
1128536132 15:68491979-68492001 CTGTGCCTGTCACTGGGCTTGGG - Intergenic
1128698950 15:69789948-69789970 CACTCCCTGGCAGTGGGCTTTGG - Intergenic
1128945070 15:71814257-71814279 CGGGGCCTGGCACTGTGCCTGGG - Intronic
1129109206 15:73327926-73327948 CTGTCCCAGGCACTGTCCTTTGG - Intronic
1129652503 15:77501126-77501148 CCAAACCTGGCACTGTGCCTGGG + Intergenic
1129658891 15:77542185-77542207 CAGTCCCTGGCTCTTTGCCTGGG - Intergenic
1129940592 15:79493746-79493768 CAGTAACTGGCACAGTGTCTGGG + Intergenic
1130543032 15:84835512-84835534 CAGTGCCTGACACTGTGGTGTGG - Intronic
1131083299 15:89554786-89554808 GAGTCCCTGGCATTGTGCTGAGG - Intergenic
1131224000 15:90608701-90608723 CTGTGCCGGGCACTGTGCTAGGG - Intronic
1131249196 15:90819627-90819649 CAGGCCCTGGCACTATGCCTGGG + Intergenic
1131455903 15:92582361-92582383 CATTAGCTGGCACTGTGCCTGGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132617796 16:850962-850984 CAGTACCTGGCCGTGTGTGTGGG + Intergenic
1133804440 16:9114003-9114025 AAGTGCCAGGCACTGTGCTTAGG + Intronic
1134167495 16:11941982-11942004 TAAAACCTGGCACTCTGCTTGGG - Exonic
1134493204 16:14711730-14711752 TAAAACCTGGCACTCTGCTTGGG + Exonic
1134498585 16:14750854-14750876 TAAAACCTGGCACTCTGCTTGGG + Exonic
1134525139 16:14937484-14937506 TAAAACCTGGCACTCTGCTTGGG + Exonic
1134547755 16:15123435-15123457 TAAAACCTGGCACTCTGCTTGGG - Intronic
1134581989 16:15378231-15378253 TAAAACCTGGCACTCTGCTTGGG - Exonic
1134657191 16:15955867-15955889 CAGCACCTAGAACTGTGCCTGGG + Intronic
1134712727 16:16335971-16335993 TAAAACCTGGCACTCTGCTTGGG + Intergenic
1134720591 16:16379286-16379308 TACAACCTGGCACTCTGCTTGGG + Exonic
1134946836 16:18332599-18332621 TACAACCTGGCACTCTGCTTGGG - Exonic
1134954100 16:18372722-18372744 TAAAACCTGGCACTCTGCTTGGG - Intergenic
1135312925 16:21419634-21419656 TAAAACCTGGCACTCTGCTTGGG - Intronic
1135329761 16:21551302-21551324 CTGCACCTGGCACTGTGCCATGG - Intergenic
1135365848 16:21851914-21851936 TAAAACCTGGCACTCTGCTTGGG - Intronic
1135445966 16:22519248-22519270 TAAAACCTGGCACTCTGCTTGGG + Intronic
1135861739 16:26062352-26062374 CAGTGCTTGGCACTGTGATTGGG + Intronic
1136152081 16:28357365-28357387 TAAAACCTGGCACTCTGCTTGGG - Intronic
1136168334 16:28471233-28471255 TAAAACCTGGCACTCTGCTTGGG - Intergenic
1136194667 16:28643818-28643840 TAAAACCTGGCACTCTGCTTGGG + Intronic
1136210999 16:28757917-28757939 TAAAACCTGGCACTCTGCTTGGG + Intronic
1136255720 16:29037875-29037897 TAAAACCTGGCACTCTGCTTGGG + Intergenic
1136309590 16:29398361-29398383 TAAAACCTGGCACTCTGCTTGGG - Intronic
1136323038 16:29500142-29500164 TAAAACCTGGCACTCTGCTTGGG - Intronic
1136340101 16:29637272-29637294 CTGCACCTGGCACTGTGCCATGG - Intergenic
1136437722 16:30240110-30240132 TAAAACCTGGCACTCTGCTTGGG - Intronic
1136845614 16:33573595-33573617 CAGTCCCAGGCTCAGTGCTTTGG + Intergenic
1137480278 16:48846850-48846872 CACTACCTGGCAGTGGGGTTTGG + Intergenic
1138373686 16:56547717-56547739 CAGAACCTGGCAGAATGCTTGGG - Intergenic
1139695486 16:68671319-68671341 CAGTACCTGGCACTTTGTTATGG - Intronic
1139857275 16:69990741-69990763 TAAAACCTGGCACTCTGCTTGGG - Intergenic
1140365399 16:74377180-74377202 TAAAACCTGGCACTCTGCTTGGG + Intergenic
1140998549 16:80285725-80285747 CAGGAACTGGCACTGAGGTTAGG - Intergenic
1141525409 16:84607804-84607826 CAGTACTTGGCAAAGGGCTTGGG + Intronic
1141767946 16:86071079-86071101 CTTGACCGGGCACTGTGCTTTGG - Intergenic
1141869030 16:86771987-86772009 CAGCACCTGGCTGTGTGCTGTGG + Intergenic
1142006597 16:87692297-87692319 CAGGGCCTGGAACAGTGCTTAGG - Intronic
1142042779 16:87905843-87905865 CTGCACCTGGCACTGTGCCATGG - Intronic
1203107322 16_KI270728v1_random:1422248-1422270 CAGTCCCAGGCTCAGTGCTTTGG + Intergenic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1143388850 17:6548272-6548294 CAATTCCTGGCACTGTGCTTTGG - Intronic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1143658812 17:8312473-8312495 CAGCTCCTGGCACTGTGCGGAGG + Exonic
1144736078 17:17556158-17556180 CAGGACCTGGCCCTGTTCTCTGG - Intronic
1145846775 17:28045300-28045322 CAGCGCCTAGCACAGTGCTTTGG + Intronic
1145875640 17:28316962-28316984 CAGTAACTGGCACTTGGCTGAGG + Intergenic
1145911172 17:28544021-28544043 TAGTTCCTGGCACTGTCCCTAGG - Intronic
1145925406 17:28643288-28643310 CACTATGTGGCATTGTGCTTTGG - Exonic
1145989996 17:29073626-29073648 CAGCACCAGGCACTGCACTTGGG + Exonic
1146484226 17:33230349-33230371 CATTACCTGTCACTGAGCATTGG - Intronic
1148067149 17:44880008-44880030 CAGTTCCTGGCAAGGTGCTATGG + Intronic
1148486784 17:47995867-47995889 CAGCACCTGGCACAGTAGTTAGG - Intergenic
1149927730 17:60718190-60718212 CAGTACCTGGCCCAGGGATTGGG + Intronic
1150597172 17:66616508-66616530 CAGTGCCTAGCACGGTGCCTGGG - Intronic
1151711424 17:75809146-75809168 CACTACCTAGATCTGTGCTTGGG - Intronic
1152242337 17:79167223-79167245 CTGTGCCTGGCACTGTACCTGGG - Intronic
1152938983 17:83155875-83155897 CAGTCCCTGGCACCGTGCGCAGG + Intergenic
1152992578 18:376806-376828 CCGTGCCTGACACTGTGCTAGGG - Intronic
1154118724 18:11633990-11634012 TAAAACCTGGCACTCTGCTTGGG - Intergenic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1156822785 18:41392801-41392823 CAGGTCCAGGCACTTTGCTTTGG + Intergenic
1157183838 18:45521317-45521339 CAGTTTCTGGCATTGTGCTAAGG + Intronic
1157800980 18:50621042-50621064 CATTACTGGGCACTGTGCTCAGG + Intronic
1158803699 18:60944680-60944702 GAGTACTTGGGACTGTGCTGGGG + Intergenic
1160052200 18:75444284-75444306 ATGTATCTGGCACTGTTCTTTGG - Intergenic
1160794942 19:940936-940958 CAGCCCCTGGCACTGTGCCCCGG + Intronic
1160986132 19:1839794-1839816 CAGTGCCTGGCATAGTGCCTGGG + Intronic
1161436911 19:4268926-4268948 CCCCACCTGTCACTGTGCTTAGG + Exonic
1161634821 19:5381216-5381238 AGGTACCTGGCCCTGTGCTCAGG + Intergenic
1163103871 19:15112418-15112440 CAGAACTTGGCCGTGTGCTTCGG + Exonic
1163545957 19:17941712-17941734 CAGGCCCTGGCAGTGTCCTTAGG + Intronic
1165086147 19:33348890-33348912 CAGCACCAGGCACAGTGCTGCGG - Intergenic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
1167057824 19:47123792-47123814 CAGTAGCTTGCCCTGTGTTTAGG + Intronic
925314734 2:2912746-2912768 CAGAACATCGCACTGTGCTGTGG + Intergenic
925639773 2:5976203-5976225 CAGAACCAGGCACTTTGCTAAGG - Intergenic
927462160 2:23308677-23308699 AAGTACCAAGCACTGTGCTTAGG - Intergenic
927827958 2:26322658-26322680 CAGTGCCTAGCACCGTGCATTGG + Intronic
928302202 2:30135723-30135745 CAGGAACTGTCAGTGTGCTTGGG - Intergenic
930224631 2:48779647-48779669 CAGTACCCAGCACCGTGCCTAGG + Intergenic
930489781 2:52054119-52054141 AAGTGCCTGGCAGTGTGCTTAGG - Intergenic
931790897 2:65663328-65663350 CAGTACGTGGCTCTGTTCTTTGG + Intergenic
932402940 2:71494656-71494678 CTGTGCCTAGCACTGTGCCTTGG + Intronic
932432590 2:71684887-71684909 CTGTGGCTGGGACTGTGCTTAGG + Intronic
932947904 2:76258705-76258727 CATGACCTGGCACTGTACTTTGG + Intergenic
933920898 2:87043674-87043696 CAGTGCCTGGCTTTGTGCCTTGG - Intergenic
934002099 2:87726225-87726247 CAGTGCCTGGCTTTGTGCCTTGG + Intergenic
935217702 2:100987898-100987920 CAGTGCCTGACACTGAGCTTGGG + Intronic
936362395 2:111815331-111815353 CAGTGCCTGGCTTTGTGCCTTGG - Intronic
938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG + Intronic
939409068 2:141800568-141800590 CTGTACCTGACACTCTGCTCAGG + Intronic
941012962 2:160322087-160322109 AAGTACCTGGCACAGTGTCTAGG - Intronic
941133441 2:161683281-161683303 AGGTACCTGGTACTGTGCTAAGG - Intronic
944480567 2:200153380-200153402 CAGTACCTGGCACCTTGAATGGG + Intergenic
944976285 2:205055082-205055104 AAGTGCCAGGCACTGTGCCTGGG - Intronic
945308014 2:208278048-208278070 AATTACATGACACTGTGCTTTGG + Intronic
945975365 2:216266314-216266336 CAATACCTGGTACTGTGCCTGGG + Intronic
947353756 2:229271685-229271707 CTGTGCCTGGCGCTGTGCTAGGG + Intergenic
947849241 2:233271692-233271714 AAGTACTTGCAACTGTGCTTAGG - Intronic
948084985 2:235239886-235239908 CAGCACCTGGAGCTGTGCTTGGG + Intergenic
948440020 2:237980764-237980786 CAGTACCTGGCACTGGGGCTGGG - Intronic
1171210549 20:23313261-23313283 CAATACCTGGCCCTGGGCCTGGG - Intergenic
1171308491 20:24126290-24126312 AAGTACCTGGCACTTTGGTGGGG + Intergenic
1172206523 20:33166649-33166671 CAGAGCCTGGCACTGGGCTTGGG - Intronic
1172422533 20:34829389-34829411 CAATACCTAGTATTGTGCTTAGG - Intergenic
1173442212 20:43087831-43087853 GAGTACCCTGCCCTGTGCTTGGG - Intronic
1173579612 20:44137687-44137709 CAGTACCTGGCACGGTGCCTGGG - Intronic
1175393721 20:58644185-58644207 CGGGACCTGCCACTGTGGTTAGG + Intergenic
1177384016 21:20385351-20385373 AATTTCCTGGAACTGTGCTTTGG + Intergenic
1178111936 21:29377423-29377445 CATTTCCTGGCAGTGTGCTCAGG - Intronic
1178431277 21:32520634-32520656 GACTGCCTGGCACTGGGCTTTGG - Intergenic
1178808800 21:35862036-35862058 CAGTGCCTAGCAATGTGCTTGGG - Intronic
1178817384 21:35944219-35944241 CAGTGCCGGGCACTGTGATAAGG - Intronic
1181766126 22:25093395-25093417 GAGTGCCTAGCACTGTGCTCAGG + Intronic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1182091734 22:27600442-27600464 GAGTGCCAGGCACTGTGCTAGGG + Intergenic
1182114337 22:27746694-27746716 CTGTGCCTGGCACTGTGCTCAGG + Intergenic
1184696054 22:46139718-46139740 CAGTCCCAGGCTCAGTGCTTTGG - Intergenic
1184988837 22:48154031-48154053 CACTCCCTGGCTTTGTGCTTTGG + Intergenic
949544383 3:5060076-5060098 CAGTCCATGGCACTTTGCTGTGG + Intergenic
949909156 3:8886597-8886619 TAGCACCTAGCACTGTGCCTGGG - Intronic
949951197 3:9230131-9230153 GAGTGCCAGGCACTGTGCTAAGG + Intronic
950121482 3:10484968-10484990 CAGTGCCAGGCACTGTGCCCAGG - Intronic
950257860 3:11520746-11520768 CAGTAACTGGCAATGTGTTTGGG + Intronic
951527730 3:23669937-23669959 CAGCACCTGGCAGAGTGCCTGGG + Intergenic
951712055 3:25593184-25593206 CAGCACCTGGCACAGTGCCTGGG + Intronic
951846188 3:27087199-27087221 CAGTCCCTGTGACTGTGCTTTGG - Intergenic
955693541 3:61613543-61613565 TTGTACCTGGCACTGTAATTGGG - Intronic
956055684 3:65296273-65296295 CAGTACCTGCCACAGAGTTTGGG - Intergenic
957035975 3:75293299-75293321 CAGTACCTACCACTGAGCTGAGG - Intergenic
957573184 3:81975342-81975364 CTGTGCCAGGCACTGCGCTTGGG + Intergenic
957613810 3:82503525-82503547 CAGTCCCTGGCTCAGTGGTTTGG + Intergenic
958883487 3:99699469-99699491 CAGAACCTAGCACTGCACTTTGG + Intronic
960615054 3:119588844-119588866 CAGAACCTAGCACAGTGCTTGGG + Exonic
961387229 3:126529607-126529629 AAGCACCCGGCACTGTGCTGGGG + Intronic
961646676 3:128396479-128396501 CAGTGCCTGGCACAGGGCTTGGG - Intronic
961650183 3:128413315-128413337 CAGGCCCTGCCACTGTGCTGGGG + Intergenic
962206831 3:133441682-133441704 CTGTACCAGACACTGTGCTAGGG + Intronic
963095299 3:141532079-141532101 AAGTACTTAGTACTGTGCTTAGG - Intronic
965341122 3:167492566-167492588 GGGTATCAGGCACTGTGCTTAGG + Intronic
965781381 3:172289631-172289653 TAATACCTAGCACTGTCCTTGGG + Intronic
966097870 3:176228142-176228164 CAGTATCTTGAACTGTACTTGGG - Intergenic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
968218497 3:196915184-196915206 CACGTCCTGGCACTGTGCTGGGG + Intronic
968954118 4:3709572-3709594 CAGTGCCTGGCTCTGGGCTAGGG + Intergenic
969022080 4:4145536-4145558 AAGTACCTGTCACTGGGCATGGG + Intergenic
969217661 4:5735084-5735106 CAGTGCCTGGCAGTGTGCAGAGG - Intronic
971253539 4:24993155-24993177 TAGCACCTGGCACTGGGCTAGGG + Intergenic
975815847 4:78216093-78216115 CACCACTTGGCACAGTGCTTGGG + Intronic
976385222 4:84449112-84449134 GAGTTTTTGGCACTGTGCTTAGG + Intergenic
977422620 4:96821963-96821985 CAGTGGGTGGCACTGTGCTGAGG - Intergenic
977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG + Intergenic
980431753 4:132708811-132708833 TAGTACCTGGTAATGTGCTATGG + Intergenic
981821345 4:148890566-148890588 CAGCACCTGGCACTGTGCCTGGG + Intergenic
984494512 4:180478549-180478571 CAGTGCCTGGGACTATGCCTGGG + Intergenic
984606172 4:181788284-181788306 AAGTACCTAGCACTGTGCTGGGG + Intergenic
985333925 4:188871222-188871244 CACTGCCTGGGACAGTGCTTGGG + Intergenic
985446683 4:190025650-190025672 CAGGACCTGGCAGTGTGGCTGGG + Exonic
986422342 5:7597880-7597902 GTGTACCTTGCCCTGTGCTTGGG + Intronic
986987566 5:13516400-13516422 CAGTGCCTGGAACAGTGCCTGGG - Intergenic
989113865 5:37932664-37932686 CAGTGCCTGGCACTATGCCGGGG - Intergenic
989973469 5:50553168-50553190 CACAACCTAGCACTGTACTTAGG + Intergenic
990801725 5:59611608-59611630 GTGTACCAGGCACTGTGCTAGGG - Intronic
991423142 5:66462162-66462184 CAATGCCAGGCACTGTGCTAGGG + Intergenic
991514281 5:67416576-67416598 CAGTGCCTGCCACTGGCCTTGGG + Intergenic
992137301 5:73760055-73760077 CAGAGCCTGGCACTGTGGGTTGG + Intronic
992738829 5:79752159-79752181 CAGTACCTAGCACAATGCCTGGG + Intronic
993014640 5:82521618-82521640 CAGTACCTATTACTGTGGTTAGG + Intergenic
993521721 5:88911058-88911080 CAGTACCTGGCACCTTCCTACGG - Intergenic
993690898 5:90997896-90997918 CAGTACCTGGCACAGAGCAGGGG + Intronic
995700727 5:114932135-114932157 CAGTCCCAGGAACTGTGTTTTGG + Intergenic
996086184 5:119307904-119307926 CAGTAGCTAGTACTGTCCTTTGG + Intronic
997735839 5:136212203-136212225 GTGTACCAGGCACTGTGCTCGGG - Intergenic
997928599 5:138053661-138053683 CAGTGCCTGGCACTTTTTTTGGG - Intergenic
998430153 5:142063673-142063695 CAGTGCCAGGCACTGAGCCTGGG + Intergenic
998818987 5:146041453-146041475 CAGTGCCTAGCACGGTGCCTAGG + Intronic
1000414817 5:160973141-160973163 CAGTACCAGGCACTCTGGTAAGG + Intergenic
1001226307 5:169947368-169947390 CAGTGCCTGGCACTCAGCCTAGG - Intronic
1001422956 5:171600914-171600936 AAGCACCTGGCACAGTGCCTGGG + Intergenic
1001601002 5:172928349-172928371 CAGTGCCAGGGACTGAGCTTGGG - Intronic
1001962539 5:175888423-175888445 ATGTGCCTGGCACTGTGCTAGGG - Intergenic
1002325184 5:178399947-178399969 GGGTTCCTGGCACTGTGCTGGGG + Intronic
1003011904 6:2434391-2434413 CAGGACCTGGCACTGGGCTCGGG + Intergenic
1003830777 6:10008778-10008800 AAATACTTGGCACTGTGCCTGGG - Intronic
1004316250 6:14590628-14590650 CAGAAGCTGCCACTGTCCTTTGG - Intergenic
1005486162 6:26301909-26301931 CAGTACCTAGCACAGTGGCTGGG - Intergenic
1005973288 6:30778281-30778303 CTGTGCCTGACATTGTGCTTGGG + Intergenic
1007018927 6:38499199-38499221 CAATACTTGGCAGTGTGCTGAGG - Intronic
1007537443 6:42605617-42605639 CAGTACCTAGCACATTGCATAGG + Intronic
1008004534 6:46396478-46396500 CATTCGCTGGCACTGTGCTAGGG + Intronic
1008013649 6:46493177-46493199 GTGTGCCAGGCACTGTGCTTAGG - Intergenic
1009645889 6:66400654-66400676 AAGTACCTTTCTCTGTGCTTAGG + Intergenic
1013006291 6:106077277-106077299 CACCACCAGGCACTGTGCTAAGG + Intergenic
1013034005 6:106362334-106362356 CAGTACATGGCACTTAGCTAAGG - Intergenic
1013118788 6:107123234-107123256 AAGTGCCTAGCACTGTGCCTGGG + Intergenic
1013715047 6:112950033-112950055 CAGGACCTGAGACTTTGCTTGGG - Intergenic
1013789496 6:113820822-113820844 CAGTGCCTCGGACTGTGCTAAGG + Intergenic
1013872564 6:114783736-114783758 CTGTGCCTGGCCCTGAGCTTTGG + Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1018703598 6:166447258-166447280 CAGTTCCTGGAACTGTAATTGGG - Intronic
1022283032 7:28929794-28929816 GTGCACCTGGCACTGTGCCTGGG - Intergenic
1022972099 7:35527890-35527912 CTGTGCCTGGCACTCTGCTAAGG + Intergenic
1023024358 7:36037278-36037300 CAGTATTTGTCACTGTGCCTGGG - Intergenic
1023272761 7:38483050-38483072 CATTATATGGCACTGTGCTAGGG - Intronic
1024579179 7:50788037-50788059 CAGCACCAGGCACTGTCCCTGGG + Intronic
1026094177 7:67328629-67328651 CAGTACCTGGCACCTTCCTAGGG + Intergenic
1028896929 7:96052074-96052096 CATTACCTGGCATAGTGCTTGGG + Intronic
1028995320 7:97093666-97093688 ATGTACCAGGCACTGTGCTCAGG - Intergenic
1029104761 7:98166003-98166025 CAGTGCCCGGCCCTGTGCTGGGG + Intronic
1029405379 7:100371750-100371772 CAGAACCTGGGACTGAGCCTGGG - Intronic
1033288529 7:140062335-140062357 GAGTACCTGGCACAGTGCGAGGG - Intronic
1033904389 7:146183931-146183953 CAGTAGCTGGCTCTTTACTTTGG + Intronic
1034517896 7:151595215-151595237 CACTATCGGGCACTGTGCTGAGG - Intronic
1035938726 8:3872335-3872357 CAGCACCTGGCACTTTGCCGGGG - Intronic
1036182313 8:6596213-6596235 CACGAACTGGCACTGTGCCTTGG + Intronic
1036638647 8:10568405-10568427 CAGTGGCTGGCACTCTGCTAGGG - Intergenic
1037956965 8:23067924-23067946 CAGCGCCTGGAACTGCGCTTGGG - Intronic
1038316076 8:26485449-26485471 AAGTTCCTGGCACTGAGCTTTGG + Intronic
1042504047 8:69540653-69540675 CTGTAACTAGCACTGTGCATTGG + Intronic
1043340824 8:79236908-79236930 CTGTGCCTGGCACTGTGCTAGGG + Intergenic
1043750216 8:83925730-83925752 CAGTGCCTGGCTCTGTGCTGTGG - Intergenic
1045648405 8:104321270-104321292 CTGTGCCTGGCTCTGGGCTTGGG + Intergenic
1047494480 8:125399752-125399774 CAGTGCCTAGCACAGTGCCTGGG + Intergenic
1047784721 8:128142602-128142624 TTGTGCCAGGCACTGTGCTTAGG - Intergenic
1047991033 8:130287204-130287226 TAGTTCCAGGCACTGTGCTTTGG - Intronic
1048269415 8:133016780-133016802 CAGTACTTGGCACTGAGCCTGGG + Intronic
1049343573 8:142126769-142126791 CAGTTCGTGGCACTTTGCTGTGG - Intergenic
1051806355 9:20996962-20996984 CAGCATCAGGCACTGTGCTATGG - Intergenic
1052578910 9:30328742-30328764 CTGTATGTGGCACCGTGCTTCGG + Intergenic
1053174099 9:35909918-35909940 CAGCCCCTGGCCCTGTGCTGGGG - Intergenic
1054740077 9:68797101-68797123 ATGTACCTGGCACTGTCCTAGGG + Intronic
1057865290 9:98675342-98675364 CAGGACTTGTCACTGTGGTTAGG - Intronic
1058000189 9:99856944-99856966 CAGTGCCAGGCACTGTGCCAAGG + Intronic
1058002143 9:99876700-99876722 CAGTGCTTTGCACTGTGCCTAGG - Intergenic
1058474942 9:105323536-105323558 CGATACCAGGCACTGTGCTAAGG - Intronic
1059484961 9:114619804-114619826 AAGCACCAGGCACTATGCTTGGG - Intronic
1059646080 9:116269405-116269427 CAGTTTCTGGCACAGTGCCTAGG - Intronic
1060355782 9:122905523-122905545 CAGTACCTCCCACAGTGCTCCGG - Intergenic
1060424480 9:123493155-123493177 TAGTACCTGACACAGTGCCTGGG - Intronic
1060995726 9:127874096-127874118 CAGTTCCTGGCACTGTGCCTTGG - Intronic
1061038159 9:128124835-128124857 AAATGCCTGGCACAGTGCTTGGG - Intronic
1061277580 9:129578359-129578381 CTGTCCCTGGCACAGTGCCTGGG - Intergenic
1061570889 9:131476846-131476868 CGGCACCTGGCACTGTGCACAGG - Intronic
1061755036 9:132806338-132806360 CAGTAACCGGTACAGTGCTTGGG - Intronic
1062181533 9:135193690-135193712 CAGTCCCTGTCACTGTGGTGGGG - Intergenic
1062413197 9:136434879-136434901 CTGTGCCTGGCCCTGAGCTTGGG - Intronic
1186794175 X:13028637-13028659 CAGTGCCTAGCACCGTGCCTGGG - Intergenic
1188022023 X:25169656-25169678 GTGTACCAGGCATTGTGCTTAGG - Intergenic
1188519935 X:31027215-31027237 GGCTACCTGGCACTGTGCCTGGG + Intergenic
1189064885 X:37796919-37796941 CAGTTCCTGGCTATGTGGTTAGG + Intronic
1189142969 X:38626051-38626073 CAGTGCTTGGCATTGTGCCTGGG + Intronic
1191666025 X:63703596-63703618 ATGTACCAGGCACTGTGCTGGGG + Intronic
1192220435 X:69194155-69194177 CAGTCCTTGGCAGTGTGCTGTGG - Intergenic
1192462251 X:71326993-71327015 CTGTACCAGGCACTGGGCTAGGG - Intergenic
1194959535 X:100219216-100219238 CAGTGCCTAGCACAGTGCCTAGG + Intergenic
1195594281 X:106670680-106670702 CTGTACCAAGCACTGTGCCTGGG + Intronic
1197461083 X:126741992-126742014 TACTATCAGGCACTGTGCTTAGG + Intergenic
1198666867 X:139034145-139034167 CAGCACCTAGCACAGTGCCTGGG - Intronic
1198675405 X:139125689-139125711 CAGTGCCTGGCCCTGTGTTAGGG + Intronic
1199710164 X:150463291-150463313 CAGAACCTGGGAATGTGTTTGGG + Intronic
1200152123 X:153956379-153956401 CGGTGCCTGTCACTGTGCCTAGG + Exonic