ID: 1101145855

View in Genome Browser
Species Human (GRCh38)
Location 12:101839802-101839824
Sequence TTACTGCTCTTTGTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101145855_1101145862 26 Left 1101145855 12:101839802-101839824 CCCTGCTCCACAAAGAGCAGTAA No data
Right 1101145862 12:101839851-101839873 ATTTTTAAAAGGACGGAGGAAGG No data
1101145855_1101145863 27 Left 1101145855 12:101839802-101839824 CCCTGCTCCACAAAGAGCAGTAA No data
Right 1101145863 12:101839852-101839874 TTTTTAAAAGGACGGAGGAAGGG No data
1101145855_1101145860 19 Left 1101145855 12:101839802-101839824 CCCTGCTCCACAAAGAGCAGTAA No data
Right 1101145860 12:101839844-101839866 AATAAATATTTTTAAAAGGACGG No data
1101145855_1101145861 22 Left 1101145855 12:101839802-101839824 CCCTGCTCCACAAAGAGCAGTAA No data
Right 1101145861 12:101839847-101839869 AAATATTTTTAAAAGGACGGAGG No data
1101145855_1101145864 30 Left 1101145855 12:101839802-101839824 CCCTGCTCCACAAAGAGCAGTAA No data
Right 1101145864 12:101839855-101839877 TTAAAAGGACGGAGGAAGGGAGG No data
1101145855_1101145859 15 Left 1101145855 12:101839802-101839824 CCCTGCTCCACAAAGAGCAGTAA No data
Right 1101145859 12:101839840-101839862 AATAAATAAATATTTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101145855 Original CRISPR TTACTGCTCTTTGTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr