ID: 1101145858

View in Genome Browser
Species Human (GRCh38)
Location 12:101839837-101839859
Sequence TTTAAAAATATTTATTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101145858_1101145864 -5 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145864 12:101839855-101839877 TTAAAAGGACGGAGGAAGGGAGG No data
1101145858_1101145870 20 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145870 12:101839880-101839902 AGCAAATATGGAAAGAGTTGGGG No data
1101145858_1101145873 25 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145873 12:101839885-101839907 ATATGGAAAGAGTTGGGGCGGGG No data
1101145858_1101145865 -4 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145865 12:101839856-101839878 TAAAAGGACGGAGGAAGGGAGGG No data
1101145858_1101145875 27 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145875 12:101839887-101839909 ATGGAAAGAGTTGGGGCGGGGGG No data
1101145858_1101145866 -3 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145866 12:101839857-101839879 AAAAGGACGGAGGAAGGGAGGGG No data
1101145858_1101145868 18 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145868 12:101839878-101839900 GGAGCAAATATGGAAAGAGTTGG No data
1101145858_1101145872 24 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145872 12:101839884-101839906 AATATGGAAAGAGTTGGGGCGGG No data
1101145858_1101145874 26 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145874 12:101839886-101839908 TATGGAAAGAGTTGGGGCGGGGG No data
1101145858_1101145862 -9 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145862 12:101839851-101839873 ATTTTTAAAAGGACGGAGGAAGG No data
1101145858_1101145863 -8 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145863 12:101839852-101839874 TTTTTAAAAGGACGGAGGAAGGG No data
1101145858_1101145869 19 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145869 12:101839879-101839901 GAGCAAATATGGAAAGAGTTGGG No data
1101145858_1101145867 8 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145867 12:101839868-101839890 GGAAGGGAGGGGAGCAAATATGG No data
1101145858_1101145871 23 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145871 12:101839883-101839905 AAATATGGAAAGAGTTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101145858 Original CRISPR TTTAAAAATATTTATTTATT TGG (reversed) Intergenic
No off target data available for this crispr