ID: 1101145860

View in Genome Browser
Species Human (GRCh38)
Location 12:101839844-101839866
Sequence AATAAATATTTTTAAAAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101145854_1101145860 30 Left 1101145854 12:101839791-101839813 CCATGGGGTAGCCCTGCTCCACA No data
Right 1101145860 12:101839844-101839866 AATAAATATTTTTAAAAGGACGG No data
1101145857_1101145860 12 Left 1101145857 12:101839809-101839831 CCACAAAGAGCAGTAAAAAAATT No data
Right 1101145860 12:101839844-101839866 AATAAATATTTTTAAAAGGACGG No data
1101145855_1101145860 19 Left 1101145855 12:101839802-101839824 CCCTGCTCCACAAAGAGCAGTAA No data
Right 1101145860 12:101839844-101839866 AATAAATATTTTTAAAAGGACGG No data
1101145856_1101145860 18 Left 1101145856 12:101839803-101839825 CCTGCTCCACAAAGAGCAGTAAA No data
Right 1101145860 12:101839844-101839866 AATAAATATTTTTAAAAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101145860 Original CRISPR AATAAATATTTTTAAAAGGA CGG Intergenic
No off target data available for this crispr