ID: 1101145863

View in Genome Browser
Species Human (GRCh38)
Location 12:101839852-101839874
Sequence TTTTTAAAAGGACGGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101145857_1101145863 20 Left 1101145857 12:101839809-101839831 CCACAAAGAGCAGTAAAAAAATT No data
Right 1101145863 12:101839852-101839874 TTTTTAAAAGGACGGAGGAAGGG No data
1101145855_1101145863 27 Left 1101145855 12:101839802-101839824 CCCTGCTCCACAAAGAGCAGTAA No data
Right 1101145863 12:101839852-101839874 TTTTTAAAAGGACGGAGGAAGGG No data
1101145858_1101145863 -8 Left 1101145858 12:101839837-101839859 CCAAATAAATAAATATTTTTAAA No data
Right 1101145863 12:101839852-101839874 TTTTTAAAAGGACGGAGGAAGGG No data
1101145856_1101145863 26 Left 1101145856 12:101839803-101839825 CCTGCTCCACAAAGAGCAGTAAA No data
Right 1101145863 12:101839852-101839874 TTTTTAAAAGGACGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101145863 Original CRISPR TTTTTAAAAGGACGGAGGAA GGG Intergenic
No off target data available for this crispr