ID: 1101148262

View in Genome Browser
Species Human (GRCh38)
Location 12:101862214-101862236
Sequence CTACTTGGCTGGGGGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101148262_1101148273 -2 Left 1101148262 12:101862214-101862236 CCCCCCAGCCCCCAGCCAAGTAG No data
Right 1101148273 12:101862235-101862257 AGGTTTTTAAGAAAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101148262 Original CRISPR CTACTTGGCTGGGGGCTGGG GGG (reversed) Intergenic
No off target data available for this crispr