ID: 1101155233

View in Genome Browser
Species Human (GRCh38)
Location 12:101921342-101921364
Sequence ATGCATCCCAATAATCAGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101155233_1101155236 -7 Left 1101155233 12:101921342-101921364 CCACCCTGATTATTGGGATGCAT 0: 1
1: 0
2: 0
3: 10
4: 93
Right 1101155236 12:101921358-101921380 GATGCATCTGCAGCACATCCAGG 0: 1
1: 0
2: 0
3: 77
4: 1542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101155233 Original CRISPR ATGCATCCCAATAATCAGGG TGG (reversed) Exonic
903915800 1:26763338-26763360 AAGCATCTCAATAATCTGAGTGG - Intronic
904123908 1:28222834-28222856 AGGCATCCCCATAGACAGGGAGG + Intronic
906500372 1:46337661-46337683 AAGAATCCCAACAATCTGGGAGG + Intergenic
907393122 1:54171577-54171599 ATGCATCCCAAGCTTCAGGAAGG - Intronic
908782554 1:67704535-67704557 TTTCATTCCAATCATCAGGGTGG + Exonic
911680246 1:100707145-100707167 ATGCATCCTGTTAATCAGGATGG + Intergenic
912272344 1:108224085-108224107 ATGCATGCCAAGAAACAGAGGGG + Intronic
912295877 1:108470236-108470258 ATGCATGCCAAGAAACAGAGGGG - Intronic
912650588 1:111435324-111435346 ATTGATCCCAATTACCAGGGGGG + Intergenic
913044189 1:115059484-115059506 ATGCATCCAAATCATCTGGATGG - Intronic
916147227 1:161750462-161750484 CTGCATTACAATAATCGGGGTGG - Intronic
917499297 1:175571602-175571624 ATGCATCCAGATTTTCAGGGCGG - Intronic
918128104 1:181601994-181602016 ATTCTTCCCAGTTATCAGGGTGG + Intronic
919609431 1:199726897-199726919 ATTAATCCCATTTATCAGGGTGG + Intergenic
1064070183 10:12222109-12222131 ATGCATCTCAATGATTAGAGAGG + Intronic
1068531298 10:58189639-58189661 ATCCATCCAAATAATAAAGGGGG + Intergenic
1071995079 10:91139966-91139988 ATTAATCCCATTAATAAGGGTGG - Intergenic
1077891324 11:6419911-6419933 ATGTATCCCACTATCCAGGGAGG - Intergenic
1081966126 11:47171099-47171121 ATGCACCGCAATTCTCAGGGAGG + Intronic
1086263894 11:84974802-84974824 ATGCATCACAGTTATCTGGGGGG - Intronic
1088162233 11:106886269-106886291 ATGCATTCCAATTAACAGGAAGG - Intronic
1092868467 12:12785005-12785027 ATGCATCAGAAAAATCAGTGGGG - Intronic
1096070845 12:48774754-48774776 ATAGATCCCAAGCATCAGGGTGG + Exonic
1098941546 12:76542465-76542487 ATGCATCACAATCATCTGGAGGG + Intronic
1101155233 12:101921342-101921364 ATGCATCCCAATAATCAGGGTGG - Exonic
1105791759 13:23807654-23807676 ATGCATAAAGATAATCAGGGAGG + Intronic
1113288921 13:108884360-108884382 ATGCATCCCAAGGATGAGGAAGG + Intronic
1114703449 14:24702569-24702591 AACCATCACAATAATCAAGGTGG + Intergenic
1119641695 14:76320077-76320099 ATTCATCCCAAAAATAAGTGGGG - Intronic
1129924162 15:79347559-79347581 GTGCATCCAAATAAGAAGGGAGG + Intronic
1131372244 15:91892283-91892305 ATGCATCCCATGAATGAGGAAGG - Intronic
1139330096 16:66181656-66181678 AAGAATCCCAGTAATCATGGGGG + Intergenic
1144754542 17:17671207-17671229 ATGCTTCCCAAGAACCCGGGGGG - Intergenic
1144805510 17:17964017-17964039 ATTCATCACCATAAACAGGGTGG + Intronic
1148643041 17:49202435-49202457 TTGCTTCCCAAGAATCAGAGAGG - Intergenic
1149063767 17:52456008-52456030 AGGCATCCCAATAAGAAGAGAGG + Intergenic
1153186444 18:2491445-2491467 ATGAATCCCATTCATGAGGGTGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1164142123 19:22480308-22480330 ATGTATTCCAACAATCAAGGTGG + Intronic
1164292051 19:23877842-23877864 ATTCATCCCAGTATTCCGGGAGG + Intergenic
929820987 2:45273375-45273397 ATGCAGCCCTACAATGAGGGAGG - Intergenic
932299093 2:70652587-70652609 ATGCATCTGAATACTCAGAGGGG + Intronic
940409890 2:153349276-153349298 ATGCCTCCAATTAGTCAGGGAGG + Intergenic
940613120 2:156015667-156015689 TTGCATCTCAGAAATCAGGGAGG - Intergenic
942328349 2:174794658-174794680 ATGCCTCCCAACACTCTGGGAGG - Intergenic
942766363 2:179461868-179461890 ATCCATGCCATTTATCAGGGAGG + Intronic
947458599 2:230282445-230282467 ATGGGTCCGAATAATCAGAGTGG - Intronic
1170260409 20:14399659-14399681 ATGCATCCCCAAAGTCAGGGAGG - Intronic
1172679357 20:36700434-36700456 ATGCATGCCAATCACCATGGAGG - Intronic
1172789953 20:37496218-37496240 ATGCATCTCTTTAATTAGGGAGG + Intronic
1175048058 20:56125947-56125969 ATGCACCCCAAGATTCGGGGGGG - Intergenic
1175059289 20:56227247-56227269 ATGCATCCCAGTGATGCGGGGGG - Intergenic
1177812976 21:25944668-25944690 ATTCATCTCCATACTCAGGGTGG + Intronic
950949775 3:16986199-16986221 AAGAAACCCAATACTCAGGGAGG - Intronic
951425670 3:22542420-22542442 ATGCAAGCCAATTATCAGGGAGG - Intergenic
953271721 3:41452043-41452065 AGGAATTCCAGTAATCAGGGAGG - Intronic
953276133 3:41500492-41500514 TTGCCTCCCACTAATCAGGTGGG - Intronic
958608283 3:96389067-96389089 ATGCATCCAAATAAAAAGAGAGG - Intergenic
960252641 3:115473286-115473308 ATTCCTCCCAATAACCTGGGTGG + Intergenic
961177501 3:124847990-124848012 ATGGATCCAGATTATCAGGGAGG - Intronic
962183264 3:133231023-133231045 ATGCATGTCAGTAATCAGGGTGG - Intronic
968250144 3:197202415-197202437 ATGTATCCCAACAATAAGGATGG + Intronic
970584469 4:17501924-17501946 ATGCAGCCCCACACTCAGGGAGG + Intronic
971231282 4:24801609-24801631 CTGCCTCCCAGTAACCAGGGTGG - Intergenic
972820368 4:42694933-42694955 ATGCATACAAAAAATGAGGGAGG - Intergenic
973113801 4:46429170-46429192 ATGAATCCCATTAACCAGGGAGG - Intronic
976083532 4:81383261-81383283 ATGCATTCCAATCAACAGTGAGG - Intergenic
977335561 4:95694048-95694070 ATTAATCCCAATCATGAGGGTGG + Intergenic
982266567 4:153543557-153543579 ATGCATGCCAACAATCAGACTGG - Intronic
983977904 4:173958230-173958252 ATGAAGCCACATAATCAGGGAGG + Intergenic
984442503 4:179791243-179791265 ATGTATCCCCATAATTAAGGGGG + Intergenic
989037330 5:37189314-37189336 ATTCATCCCAATAGTGAGAGAGG + Intronic
989630622 5:43478690-43478712 AAGCATCCCAATAATAATGTGGG + Intronic
991086819 5:62655496-62655518 ATGCATCACAATATTAAGGGTGG - Intergenic
993308205 5:86295907-86295929 ATGCATGCCAAGAAACAGAGGGG - Intergenic
994379512 5:99054678-99054700 ATGCATGCCTGTAATCCGGGGGG + Intergenic
995719660 5:115117443-115117465 ATGCATCCCACAGAGCAGGGCGG + Intergenic
998935525 5:147228750-147228772 GTGGATCCTAATAACCAGGGCGG - Intergenic
999795928 5:154989837-154989859 CTGCAACACAATTATCAGGGTGG - Intergenic
1000783780 5:165517181-165517203 ATAAATCAAAATAATCAGGGTGG + Intergenic
1001684508 5:173583493-173583515 ATGAAACCCAATAATCAGAGGGG + Intergenic
1008141374 6:47836330-47836352 ATCCATCTCAATGATCAAGGTGG + Intergenic
1013866279 6:114700576-114700598 ATGCATACCAAGAAACAGGAAGG - Intergenic
1015070810 6:129090274-129090296 TTGCTTCCCAATAATCTGGAGGG - Intronic
1019163405 6:170083846-170083868 ATGCATTGAAATAATCAGAGAGG + Intergenic
1026265068 7:68789101-68789123 AGGCATCAAAATCATCAGGGAGG + Intergenic
1028380533 7:90194419-90194441 ATGCACACCAAAAATAAGGGAGG - Intronic
1028884037 7:95911647-95911669 ATGCATCCCAATCACCTGGGGGG + Intronic
1036238927 8:7066829-7066851 ATTAATCCCAATAATCCGGAAGG + Intergenic
1036463380 8:8974037-8974059 CTGCATCCCAGGAAGCAGGGTGG - Intergenic
1039683362 8:39766974-39766996 ATCCATTGCAATATTCAGGGAGG + Exonic
1042276457 8:67009698-67009720 ATGCAATTGAATAATCAGGGTGG - Intronic
1043737481 8:83766865-83766887 ATGCATCCAAATAATAAGAGAGG + Intergenic
1044264308 8:90164336-90164358 AGGCATCCCAAAAATCCAGGAGG + Intergenic
1048249044 8:132843298-132843320 ATGCATCCCACTATTCAGTAAGG + Intronic
1050095317 9:2058639-2058661 ATGCATGCCAAAAATCTAGGGGG + Intronic
1052622382 9:30930258-30930280 ATTAACCCCAATAATGAGGGTGG + Intergenic
1052883805 9:33624032-33624054 AGGCATCCCAAGTATCAGAGCGG - Intergenic
1054706280 9:68465562-68465584 TTGCTTCACAATAATCAGGGAGG - Intronic
1054764530 9:69032501-69032523 ATGCCTCCCAATATGCAGAGTGG + Intergenic
1060761269 9:126251387-126251409 ATGCCTCTCAGTAATCTGGGAGG - Intergenic
1186432449 X:9516509-9516531 ATCCATCTCACTATTCAGGGTGG + Intronic
1194644362 X:96440583-96440605 ATGAATCCCCATAATCAAGGTGG + Intergenic
1198048277 X:132924441-132924463 ATACATACCAATAATCACTGTGG + Intronic