ID: 1101157394

View in Genome Browser
Species Human (GRCh38)
Location 12:101940635-101940657
Sequence ACGTGGGAGGCTCTGTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101157394 Original CRISPR ACGTGGGAGGCTCTGTGTAG GGG (reversed) Intronic
900212455 1:1462799-1462821 ACGTGGGAGCTTCTGTTGAGGGG + Intronic
900526977 1:3134204-3134226 CTGTGGGAGCCTCTGTGTAGAGG - Intronic
900582119 1:3414479-3414501 GGGTGGGCGGCTCTGTGGAGCGG + Intronic
900964876 1:5950956-5950978 CCGTGGGAGGCTGTCTGCAGTGG - Intronic
902751465 1:18514591-18514613 ACATGGGAGGCTCTGTGAACTGG + Intergenic
903125135 1:21242627-21242649 AAGTGGGAGGGTCTGAGCAGGGG - Intronic
904708700 1:32412170-32412192 AAGTGGGAGGCCATGTGTGGTGG + Intergenic
905215333 1:36402318-36402340 ACGTGGGAGGCTGTGGCTGGAGG + Intergenic
905244606 1:36603803-36603825 GCGTGGGAGGGTGGGTGTAGGGG + Intergenic
905299378 1:36976123-36976145 ACATGGGAGGGTGTGTGTAGTGG + Intronic
905908047 1:41632872-41632894 CAGTGGGAGGTGCTGTGTAGGGG + Intronic
907754681 1:57300103-57300125 ACATGGAAGGCTCTGTGCAGGGG - Intronic
907850374 1:58249840-58249862 ACTTGGGCGGCTCTGTGCGGCGG + Intronic
907882175 1:58560869-58560891 ACGGGGGAGGCTGTGTGTGGAGG + Intergenic
908899950 1:68945236-68945258 ACCTGGGATGCTGTGTGTAATGG - Intergenic
910448239 1:87320394-87320416 ATGTGAGAGGCTCTATGGAGAGG - Intergenic
913385624 1:118255485-118255507 TTTTGGGAGGCTATGTGTAGTGG - Intergenic
915475445 1:156150248-156150270 ACCTGGGAAGCTCTGGGTAAGGG + Intronic
920139155 1:203795487-203795509 ACGGGGGAGGCGCTGGGTCGGGG - Intergenic
920193463 1:204210712-204210734 ACGTGAGAGGCTGGGTGTGGTGG - Intronic
922750734 1:228068975-228068997 GTGTGGGGGGCACTGTGTAGGGG + Intergenic
924654590 1:245962067-245962089 ACGTGGGAGGCTGTGTCATGTGG - Intronic
1063190631 10:3690873-3690895 ATGAGGGAAGCTTTGTGTAGAGG - Intergenic
1064011300 10:11738640-11738662 ACTTGGGAGGCTGTGTGAGGAGG - Intergenic
1064534225 10:16342195-16342217 ACTTGGGAGGCTGTGGCTAGTGG + Intergenic
1064971322 10:21070039-21070061 AAGTGTGAGGCTTTGTGTGGAGG - Intronic
1065287938 10:24203079-24203101 ACTTGGGAGGCTGAGGGTAGAGG + Intronic
1066796215 10:39124346-39124368 ATGTTGGAGGCTGGGTGTAGTGG + Intergenic
1068903466 10:62297074-62297096 AAGTGGGTGGCTGTGTGCAGTGG + Intergenic
1071508480 10:86246795-86246817 CTGGGGGAGGCCCTGTGTAGGGG - Intronic
1074414939 10:113259824-113259846 ACGTGTGAGTTTCTGTGAAGAGG - Intergenic
1076850287 10:133089049-133089071 GGGTGGGAGGCTCTGTGGAGTGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077555330 11:3223294-3223316 GCGTGGGAGGCTGGGTGGAGTGG - Intergenic
1077974860 11:7237515-7237537 ACATGGAAGGCTCTGTGAAAAGG + Intergenic
1078326763 11:10387573-10387595 CCGTGAGATGCTCTGTGTGGCGG - Intronic
1079029745 11:16977648-16977670 GGGTGGGAGGCTCTGAGTTGGGG - Intronic
1079133379 11:17762375-17762397 AGGTGAGAGGCTCTGTGTGGAGG + Intronic
1085394507 11:76200527-76200549 AAGTGGGAGGCTCTGTCAACCGG - Intronic
1085706480 11:78790864-78790886 GCCTGGGAAACTCTGTGTAGAGG - Intronic
1088786007 11:113182491-113182513 ACGTGGGAGGCACTCTGCAAAGG - Intronic
1089027924 11:115291094-115291116 ATGGAGGAGGCTCTGTGGAGTGG + Intronic
1093109560 12:15132991-15133013 ATGGGGGAGGCTGTGTGTTGGGG - Intronic
1098918612 12:76282448-76282470 AGGTGGGAGTCTGTGGGTAGGGG + Intergenic
1101157394 12:101940635-101940657 ACGTGGGAGGCTCTGTGTAGGGG - Intronic
1101157415 12:101940866-101940888 ACGTGGGAGGCTCTGCGTAGGGG - Intronic
1104036372 12:125100122-125100144 ACGTGGGAGGCTGAGTGGGGAGG - Intronic
1108181305 13:47842363-47842385 ACGTGGTTGGTTCTGGGTAGCGG - Intergenic
1112133305 13:96548099-96548121 AGGTGGGAGGCACGGTGTGGGGG - Intronic
1112235003 13:97627807-97627829 CAGTGAGAGGCTCTGGGTAGAGG - Intergenic
1113276115 13:108732515-108732537 ATGTGGCAGGGTCTGTGTATTGG + Intronic
1115649711 14:35394297-35394319 GCGATGGAGGCTCTGTGCAGGGG + Intergenic
1119685439 14:76627359-76627381 AAGTGGGAGGCTGGGTGTGGTGG - Intergenic
1121168724 14:91835957-91835979 AGGTGGGCGGCTCTGCCTAGGGG - Intronic
1124976634 15:34533089-34533111 AGGTAGGAGGCTCTGGGTGGAGG - Intronic
1125405169 15:39345296-39345318 ACGTGAGAGGCTCTTTGTTATGG - Intergenic
1128290759 15:66476705-66476727 CCATGGCAGGCTCTGTGCAGGGG + Intronic
1131131781 15:89904935-89904957 AAGTGAGATGCTCTGTCTAGAGG - Intronic
1132691070 16:1182192-1182214 AGGTGGGAGGCTCTGCGGGGTGG + Intronic
1134459921 16:14421977-14421999 ACTTGGGAGGCTGAGTGAAGAGG - Intergenic
1137436307 16:48456527-48456549 AAGTGGCTGGCTGTGTGTAGTGG - Intergenic
1137564383 16:49524361-49524383 ACATGGGGGCCTCTGTGTGGGGG - Intronic
1139168031 16:64594184-64594206 ACATGGGAAGTTCTGTGTAAAGG + Intergenic
1140477921 16:75248283-75248305 ATGTGCGAGGCTCTGTGCTGGGG - Intronic
1141098406 16:81179337-81179359 ACGTGGGAGACTCTAGGCAGAGG - Intergenic
1142285078 16:89168393-89168415 ATGTGGCTGGCTCTGGGTAGTGG - Intergenic
1142406392 16:89892549-89892571 GCCTGGGAGGCTCCGTGTTGAGG - Intronic
1143401978 17:6651964-6651986 CCGTGGACGTCTCTGTGTAGCGG - Exonic
1143780716 17:9227906-9227928 ATGTGTGATGCTGTGTGTAGTGG - Intronic
1144698199 17:17320127-17320149 ACGTGGGAGGCTGGGCGTGGTGG - Intronic
1145367130 17:22273766-22273788 ATTTGGGAGGCTCTGTTTAAAGG + Intergenic
1146375447 17:32290890-32290912 ACGTGGGAGGCTGTGGCAAGAGG + Intronic
1147042013 17:37726619-37726641 ACCTGGGAGGGGCTGTGAAGGGG + Intronic
1147311226 17:39597122-39597144 AAGTGTGAGGGTCCGTGTAGAGG - Intergenic
1151558475 17:74859028-74859050 GGGTGGGGAGCTCTGTGTAGTGG + Intronic
1153711629 18:7806002-7806024 ACTTGAGAAGATCTGTGTAGTGG + Intronic
1154276572 18:12966506-12966528 ACTTGGGAGGCTGTGTGTGGTGG - Intronic
1156498250 18:37540272-37540294 ACCTGGGAGGCTCTGGGCTGGGG - Intronic
1160879841 19:1314389-1314411 AGGGGGGAGGCTGTGTGCAGAGG + Intergenic
1161478705 19:4500013-4500035 AGGGGGGTGGCTCTGTGCAGCGG + Intronic
1161723427 19:5915690-5915712 AGGTGGGAGGCTGTGTGTGGAGG + Exonic
1161739469 19:6011787-6011809 ACACGGGTGGCTCTGTGCAGAGG + Intronic
1162873101 19:13600498-13600520 ACGTGGAAGGCTGGGTGCAGTGG + Intronic
1163672659 19:18637638-18637660 CTGTGGGAGGCTCTGGGTGGGGG + Intronic
1164753035 19:30670145-30670167 ACGTGGGAGGCTTAGTGCAATGG + Intronic
1166551583 19:43669150-43669172 ATGTGGGGGGCTCTGGGTCGAGG - Intronic
1166831811 19:45643793-45643815 ACCTGGGAGGCGCTGAGTGGGGG - Intronic
925092234 2:1164786-1164808 TGTTGGCAGGCTCTGTGTAGAGG + Intronic
926158345 2:10470511-10470533 ACGTGTGGGGCTCTGTGCAGTGG + Intergenic
927269672 2:21192156-21192178 AGGTGTGAGACACTGTGTAGAGG + Intergenic
929734821 2:44536613-44536635 ACGTTGGAGGCCAGGTGTAGTGG - Intronic
929738404 2:44576037-44576059 AGGTGGGAGGCTGGGTGCAGTGG + Intronic
930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG + Intronic
930709848 2:54540408-54540430 ACGTGTGAGTCACTGTGTAATGG - Intronic
931223452 2:60309014-60309036 ACCTGTGAGGCTCTGTGTGCAGG - Intergenic
939600916 2:144189228-144189250 ACTTGGGAGGCTCAGACTAGGGG - Intronic
941911381 2:170768686-170768708 ATGTGCGAGGCTCTGTGTCAGGG + Intergenic
943162691 2:184275613-184275635 AAGTGGTAGCCTCTGTGCAGTGG - Intergenic
1170241178 20:14168481-14168503 ACATGGAAACCTCTGTGTAGGGG - Intronic
1172188389 20:33046226-33046248 TGGTGGGAGGGTCTGTGCAGAGG + Intergenic
1172732683 20:37101058-37101080 ACTTGGGAGGCTCAGTGGGGAGG + Intergenic
1175999509 20:62825675-62825697 GCCTTGGAGGCTCTGTGAAGGGG - Intronic
1177080109 21:16628499-16628521 ATGTGCTAGGCTCTGTGTAGGGG + Intergenic
1182623262 22:31629347-31629369 AGGTGTGAGGGTGTGTGTAGGGG + Intronic
1182712257 22:32330344-32330366 ATGTTGGGGGCTCTGTGTTGGGG + Intergenic
1183691275 22:39389842-39389864 ACTTGGGAGGCTGAGTGGAGAGG + Intergenic
1183990828 22:41596084-41596106 AAGGGGCAGCCTCTGTGTAGTGG + Intergenic
1184368130 22:44065441-44065463 AGGTGGGAGGCTGGGCGTAGTGG - Intronic
1184437935 22:44490874-44490896 GCGTGGGGGGCTCTGTGTAGGGG - Intergenic
1184480584 22:44744599-44744621 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480608 22:44744726-44744748 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480632 22:44744853-44744875 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480692 22:44745195-44745217 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184649179 22:45911824-45911846 CCCTGGGAGGCTCTCTGGAGCGG + Intergenic
952730529 3:36633531-36633553 GTGAGGGAGGCTCTGTGTGGTGG - Intergenic
954143874 3:48624490-48624512 AGGTGCCAGGCTCTGTGCAGGGG - Intergenic
954215596 3:49122689-49122711 ACGTGGGAGGCTCACGGTTGAGG + Exonic
959629743 3:108494163-108494185 ACGTGAGTGGCTCTGTACAGGGG + Intronic
959717983 3:109454432-109454454 TAGTGGGAGGGTGTGTGTAGGGG + Intergenic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
964758277 3:160108888-160108910 ACATTGGAGGCTATGTGTTGTGG - Intergenic
970217604 4:13776312-13776334 ACAGTGGAGACTCTGTGTAGGGG + Intergenic
970428941 4:15970680-15970702 ATGTAGGAGGATGTGTGTAGCGG - Intronic
971347098 4:25821478-25821500 ATGTGGAAGGCACTGTGCAGAGG + Intronic
971569740 4:28196027-28196049 ACTTGGGAGGCTGAGTGAAGTGG + Intergenic
973796739 4:54434839-54434861 AGGTGTAAGGCTCTGTGTTGAGG - Intergenic
974610973 4:64214876-64214898 ACTTGGGAGGCTGAGTTTAGAGG + Intergenic
984052200 4:174878009-174878031 ATGTGGGAGGCCCTATGGAGGGG + Intronic
984505256 4:180609630-180609652 AGGTGGGAGTCTCTGTGAAGTGG - Intergenic
984537167 4:180990779-180990801 ATGTTGAAAGCTCTGTGTAGGGG + Intergenic
990350563 5:54911555-54911577 AGGTGAGAGGGTCTGTGGAGGGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
999074554 5:148781731-148781753 AGGAGGGAGGGTCTGTGTTGTGG - Intergenic
999747539 5:154603931-154603953 ACATCTGAGGCTCTGGGTAGAGG + Intergenic
1000527727 5:162379528-162379550 ACTTGGGAGTCTCTATGAAGGGG - Intergenic
1002088478 5:176790841-176790863 GCCTGGGTGGCTCTGTGGAGTGG + Intergenic
1003336456 6:5177527-5177549 ACGTGGGAGACTGGGTCTAGAGG - Intronic
1006146222 6:31961385-31961407 AGGTTGGTGGTTCTGTGTAGTGG + Exonic
1006929557 6:37679584-37679606 GCATGGGAGGCTCTGTGTACAGG - Intronic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1007867845 6:44993052-44993074 ACTTGGGAGGCTCAGGCTAGAGG + Intronic
1011048011 6:83108286-83108308 ACTTGGGAGGCTGAGAGTAGAGG - Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1023844662 7:44113919-44113941 GCGTGGGAGGCACAGTGTGGGGG - Exonic
1024479372 7:49848279-49848301 CCGTGGGAGGCTCTGAGTGGAGG - Intronic
1030140034 7:106294762-106294784 ACGTGGGAGGCCAACTGTAGGGG - Intergenic
1030763522 7:113380316-113380338 ACATGGGGGGCTCGGTGCAGTGG + Intergenic
1032441664 7:131946798-131946820 GCGTGAGATGCTCTGTGTAGGGG + Intergenic
1032784215 7:135187753-135187775 ATGTGGGATGCTCAGTGAAGAGG - Intronic
1038477954 8:27881788-27881810 ATGGGGGAGGCTGTGTGTAGAGG - Intronic
1041053451 8:53959525-53959547 ATCTGGGACGCTCTGAGTAGTGG + Intergenic
1041787481 8:61650538-61650560 TCATGGGGAGCTCTGTGTAGAGG - Intronic
1046800662 8:118423069-118423091 ACTCGGGAGGCTGTGTGTGGAGG + Intronic
1048379605 8:133853634-133853656 ACGTGGGTGGCCAGGTGTAGTGG - Intergenic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1051068386 9:13132446-13132468 CCTTGGGAGGTTCTGAGTAGGGG + Intronic
1051523837 9:18020429-18020451 GTGGGGGAAGCTCTGTGTAGAGG + Intergenic
1053432016 9:38048523-38048545 ACGTGGGAGGCTGAGTCTGGAGG + Intronic
1057574500 9:96231334-96231356 ACCTGGGAGGCTCAGGCTAGAGG - Intergenic
1057828813 9:98391824-98391846 ACGTGCGGGGCTCTGAGCAGAGG + Intronic
1061257735 9:129462364-129462386 ATGTGCAAGGCTCTGTGTGGAGG - Intergenic
1062555222 9:137110772-137110794 GGGTGGGAGGCTCTGGGGAGCGG + Exonic
1185723974 X:2404721-2404743 GCGGGGGGAGCTCTGTGTAGGGG - Intronic
1189056619 X:37705859-37705881 ACTTGGGAGGCTCAGTGGGGAGG - Intronic
1191976860 X:66882237-66882259 ATGTGGGGAGCTCTGGGTAGTGG - Intergenic
1194382658 X:93214598-93214620 AGGTGGGAGGCTGGGTGCAGTGG + Intergenic
1196275325 X:113760114-113760136 ACTTGGGAGGCTCAGGGAAGAGG - Intergenic
1199700277 X:150370719-150370741 ACCAGGGAGGCTCTGTGAAGGGG - Intronic
1199810215 X:151341558-151341580 ACTTCGGAGGCCCTGTCTAGTGG - Intergenic