ID: 1101164094

View in Genome Browser
Species Human (GRCh38)
Location 12:102010235-102010257
Sequence CCCAGTTCCCAGATGGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101164086_1101164094 0 Left 1101164086 12:102010212-102010234 CCGCCTCAGACTTTCCTGGAAGT 0: 1
1: 0
2: 2
3: 32
4: 230
Right 1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG 0: 1
1: 0
2: 2
3: 21
4: 188
1101164087_1101164094 -3 Left 1101164087 12:102010215-102010237 CCTCAGACTTTCCTGGAAGTCCC 0: 1
1: 0
2: 4
3: 25
4: 234
Right 1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG 0: 1
1: 0
2: 2
3: 21
4: 188
1101164083_1101164094 5 Left 1101164083 12:102010207-102010229 CCCTGCCGCCTCAGACTTTCCTG 0: 1
1: 0
2: 2
3: 19
4: 199
Right 1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG 0: 1
1: 0
2: 2
3: 21
4: 188
1101164081_1101164094 10 Left 1101164081 12:102010202-102010224 CCCATCCCTGCCGCCTCAGACTT 0: 1
1: 0
2: 0
3: 29
4: 210
Right 1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG 0: 1
1: 0
2: 2
3: 21
4: 188
1101164084_1101164094 4 Left 1101164084 12:102010208-102010230 CCTGCCGCCTCAGACTTTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG 0: 1
1: 0
2: 2
3: 21
4: 188
1101164082_1101164094 9 Left 1101164082 12:102010203-102010225 CCATCCCTGCCGCCTCAGACTTT 0: 1
1: 0
2: 2
3: 32
4: 273
Right 1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG 0: 1
1: 0
2: 2
3: 21
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101164094 Original CRISPR CCCAGTTCCCAGATGGGGTA GGG Intronic
900393335 1:2443296-2443318 CCCAGTCCTCAAATGGGGAAGGG + Intronic
901100609 1:6715853-6715875 CTCACTTCCCAGACGGGGTGGGG + Intergenic
901181055 1:7342170-7342192 CCCAGGTCTCAGATGGCCTAGGG + Intronic
901714779 1:11144589-11144611 CCCAGGTCCTGGAAGGGGTAGGG + Intronic
902208475 1:14887356-14887378 CCATGTTCCCAGATGTGGCATGG + Intronic
902643659 1:17782880-17782902 GCCAGTTCCCAGATGTGGGATGG - Intronic
904238238 1:29127658-29127680 CCCAGTTCACATATGTGGTTTGG + Intergenic
904264503 1:29310630-29310652 AGCAGTTCCCTGGTGGGGTAGGG + Intronic
904455942 1:30648105-30648127 CCCATTTCCCAGATGGAGAACGG + Intergenic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
906313384 1:44769774-44769796 CCCAGTTCCTTGGTAGGGTAAGG + Intergenic
906650859 1:47511637-47511659 CCCAGTACCCTGATTGGGCAGGG + Intergenic
909623105 1:77687542-77687564 CTCACTTCCCAGATGGGGTGGGG - Intergenic
910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG + Intergenic
910983330 1:92980206-92980228 CCCAGTTGCCCGAAGGGCTAAGG - Intergenic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
915105711 1:153534074-153534096 CCCAGGTCCCAGGTGGAGTGGGG - Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
917738438 1:177940720-177940742 CCAGGTTTCCAGATGGGTTAGGG + Intronic
919933705 1:202237623-202237645 CCCACTTCCCAGAAAGTGTAGGG - Intronic
920421662 1:205838412-205838434 CCTGATTCCCAGATGGGGTCTGG + Intronic
921285826 1:213608282-213608304 CCCAGGTCCCAGCAGGGGGAAGG + Intergenic
922610188 1:226920739-226920761 GCCAGGTCCCAGATGGGGAGGGG + Intronic
923085718 1:230702270-230702292 CCCAGGTGCCACATGGGGTATGG + Intergenic
1067450229 10:46377543-46377565 GCCAGCTCTCACATGGGGTATGG - Intronic
1067587013 10:47482220-47482242 GCCAGCTCTCACATGGGGTATGG + Intronic
1067634073 10:47989987-47990009 GCCAGCTCTCACATGGGGTATGG + Intergenic
1068945394 10:62724147-62724169 CCGAAGTCCCAGAGGGGGTAAGG + Intergenic
1069788277 10:71003705-71003727 CCCAGTTTCCTGATGAGGCATGG - Intergenic
1069832927 10:71291918-71291940 CCCATCTCACAGATGGGGAAAGG + Intronic
1070658574 10:78288713-78288735 CCCATTTTACAGATGGGGAAGGG - Intergenic
1072116488 10:92374843-92374865 CTCACATCCCAGATGGGGTTAGG - Intergenic
1075050565 10:119180237-119180259 ACCAGTCCCCAGATGTGGAAAGG + Intergenic
1076643150 10:131932323-131932345 TCCATTTCCCTGCTGGGGTAGGG - Intronic
1076664313 10:132077372-132077394 CCAAGTTCTCAGATAGGGGAGGG - Intergenic
1077102331 11:827753-827775 CCCAGCTCCCCGGTGGGGGAAGG + Intronic
1077421382 11:2451718-2451740 CCCAGGTCCCAGAGCGGGCAGGG - Intronic
1077839672 11:5961030-5961052 CCCAATTCCCAGACGGGGGGCGG - Intergenic
1081814892 11:45933433-45933455 CCCAGTGCCCAGAAGAGGGAAGG - Intronic
1083632287 11:64101986-64102008 CCCAGCACCCAGATGGGGGGTGG - Intronic
1084608684 11:70187119-70187141 CCCAGTCCCCAGCTGGGGCTGGG - Intronic
1085263050 11:75219323-75219345 CCCAGTTCCAGCATGGGGCATGG - Intergenic
1088950479 11:114564640-114564662 CCCAGATCCCAGGTGGGATCTGG - Intergenic
1089419074 11:118317454-118317476 CCCAAGTCACAGATGGGGTGGGG + Intergenic
1090253156 11:125264862-125264884 CCCATTTCACAGATGGGGCCAGG - Intronic
1091380424 12:54636-54658 CCCAGTTCACAGATGAGGATAGG + Intergenic
1092534528 12:9375957-9375979 CCCAGTTCCCAGAGGCGGCGTGG - Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1099079079 12:78153207-78153229 CCCTTTGCCCAAATGGGGTATGG + Intronic
1099880261 12:88459209-88459231 GTCAGTCCCCAGGTGGGGTAAGG + Intergenic
1100225076 12:92548318-92548340 CCAGGTTACCAGATGGGGTGAGG + Intergenic
1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG + Intronic
1101607286 12:106257212-106257234 CCCAGCTCCCAGATGGGTCATGG + Intronic
1101652907 12:106693976-106693998 CCCATTTCACAGAAGGGGAACGG + Intronic
1102789898 12:115636106-115636128 CCCAGTTCCTGGCTGGGGTGGGG + Intergenic
1103242023 12:119421637-119421659 CCCATTTCACAGATGGGGATTGG + Intronic
1103501663 12:121407815-121407837 CCCAGTTACCATATCCGGTAGGG - Intronic
1103529485 12:121590773-121590795 CCCAGTTCACAGCTGGGGAGAGG + Intergenic
1104907006 12:132218967-132218989 CACAGGTCCCAGGTGGGGTCTGG - Intronic
1108429835 13:50342491-50342513 CCCAGTTCCCAGAGGAGGCCTGG - Intronic
1119602079 14:75982922-75982944 CCCATTTCCCAGATGGGTGAGGG + Intronic
1119668048 14:76498836-76498858 CCCAGGCCACAGATGGGGGAGGG - Intronic
1120465738 14:84854879-84854901 CCCAATTGCCAAATGGGATAAGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124701604 15:31918196-31918218 CTCAGTTCTCTGATGGGTTAAGG + Intergenic
1128280548 15:66390518-66390540 CCCAGTTCAGAGATGGAGTTGGG + Intronic
1128418163 15:67466047-67466069 CCCATTTCCCAGCTTGGTTAAGG + Intronic
1133268653 16:4599941-4599963 CCCAGGGCCCAGGTGAGGTATGG + Intronic
1134438140 16:14280640-14280662 CACAGTTCCCACATGTGGCAGGG + Intergenic
1137860507 16:51841875-51841897 CCATGTCCCCAGATGGGATATGG + Intergenic
1139600864 16:67986179-67986201 CACTGTGCCCAGATGGAGTAGGG - Intergenic
1141260859 16:82452486-82452508 CCGACCTCACAGATGGGGTAGGG + Intergenic
1141522521 16:84590483-84590505 CCCATTTCACAGATGGGAAATGG + Intronic
1141533255 16:84661305-84661327 CCCATTTCCCAGATGGGGCAAGG + Intronic
1141821695 16:86450691-86450713 CCCCGTTCACAGAAGAGGTAAGG - Intergenic
1141949704 16:87332680-87332702 CCCAGCTCCCGGAGGGGGTTTGG - Intronic
1141984862 16:87573132-87573154 CCCAGTGGCCAAGTGGGGTAAGG + Intergenic
1142384703 16:89756180-89756202 CCCAGTTTTCAAATGGGCTAAGG + Intronic
1142894866 17:2967632-2967654 CCAACTTCCGAGCTGGGGTACGG - Intronic
1146923604 17:36729543-36729565 CCCATTTCACAGATGGGAAAGGG - Intergenic
1147793600 17:43027709-43027731 CCCAGTTCCCAGGTGGGGGAGGG + Intronic
1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG + Intergenic
1148484561 17:47982300-47982322 CCCATTTCCCAGGAAGGGTAGGG + Intergenic
1148615858 17:48998781-48998803 CACAGCTCCCAGATGTGGGAAGG - Intronic
1148674154 17:49435303-49435325 CCCTGTCCCTAGATGGGGTGGGG - Intronic
1148685921 17:49501217-49501239 CCCAGTGGCCACATGGGGGAGGG + Intronic
1149671479 17:58416637-58416659 CCAAATTCCCTGAGGGGGTAGGG + Exonic
1151602910 17:75117439-75117461 CCAAATTCCCAGATGGCTTATGG + Intronic
1151674900 17:75592330-75592352 CCCAGTTCCCAGAGTAGGAAGGG + Intergenic
1152682076 17:81673677-81673699 CTCAGTTCCCAGATGGTGCTGGG - Exonic
1152891475 17:82883939-82883961 CCCAGCTCCCACATGGCGTCTGG + Intronic
1158249755 18:55474651-55474673 ATCAGTTCCCAGGTGGGGTTAGG - Intronic
1158277213 18:55781130-55781152 CCCTCTCCCCAGATGGGGCAGGG + Intergenic
1158883211 18:61800940-61800962 CCCAGTGCCAAGATGGGGTGAGG + Intergenic
1159564065 18:70027882-70027904 TCCATTTTCCAGATGTGGTATGG + Intronic
1160537441 18:79602680-79602702 CCCAGCTCCCAGATGGGTCTGGG + Intergenic
1160590858 18:79944021-79944043 CCCAGACTCCAGGTGGGGTAGGG + Intronic
1160682127 19:416713-416735 CCCTGCTCCCAGGTGGAGTAGGG + Exonic
1160851622 19:1195543-1195565 CCCAGGTCCCAGGTGGGGGCTGG - Intronic
1160851646 19:1195617-1195639 CCCAGGTCCCAGGTGGGGGCTGG - Intronic
1160852046 19:1197357-1197379 CCCAGGTCCCAGGTGGGGGCTGG - Intronic
1160852070 19:1197431-1197453 CCCAGGTCCCAGGTGGGGGCTGG - Intronic
1163892920 19:20032831-20032853 CCCAATTCCCAGGTGGGTTTAGG - Intronic
1165226243 19:34357314-34357336 CCCATTTCTCAGATGGGCCAAGG - Intergenic
1165746449 19:38232743-38232765 CCAAGTGTCCATATGGGGTAGGG - Intergenic
1166130600 19:40743600-40743622 CCCAATTTCCAGATGGGGAAAGG + Intronic
1167458072 19:49608938-49608960 CCCAGTTGACAGACGGGGGAAGG - Intronic
1167971146 19:53188162-53188184 CTCACTTCCCAGACGGGGTGGGG + Intronic
1168269235 19:55240805-55240827 GCCAGCGCCCAGATGGGGTGTGG - Intronic
926606559 2:14904240-14904262 CCCAGCTTGCAGATGGCGTATGG - Intergenic
927699140 2:25256986-25257008 CCAAGTTCCAAGTTGGGGAATGG + Intronic
931899569 2:66772543-66772565 CCCAGTTTGCAGAGGGGGAATGG + Intergenic
932759954 2:74432729-74432751 CCCAGTCCCCAGGTGGGCTGTGG + Intronic
933128715 2:78645285-78645307 CACAGTTCCCAGATCGACTACGG + Intergenic
933131297 2:78677012-78677034 CCCAGTCCCCAGGTGGGGCTTGG + Intergenic
933476074 2:82792480-82792502 CCCAGCTGCCAGTTTGGGTATGG + Intergenic
937249945 2:120517279-120517301 CCCATTTCACAGATGGGGGAAGG + Intergenic
937930566 2:127201770-127201792 CCCAGTGGCCAGGTGGGGCAGGG - Intronic
940239134 2:151544200-151544222 CCCAGTTCCCAGAGGGATTTTGG - Intronic
945219974 2:207473587-207473609 CCCATTTAACACATGGGGTAGGG + Intergenic
946043332 2:216801135-216801157 TCCAGATCCCAGTTGGGGTAAGG - Intergenic
946969982 2:225080700-225080722 TCCAGTTGACAGATGGGGTGTGG + Intergenic
948704553 2:239780761-239780783 CCCAGTGCCCAGATGAAGTGAGG + Intronic
948720661 2:239898087-239898109 CCCAGCTCACAGATGGAGCAAGG + Intronic
1169949391 20:11026682-11026704 CCCAGTGCCCAGCTGGTTTAGGG - Intergenic
1172626001 20:36347195-36347217 CCCAGCTCCCAGCTGGGGCCTGG + Intronic
1172882133 20:38208960-38208982 TCCATTTCACAGATGGGGAAAGG + Intergenic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173391686 20:42640836-42640858 TCAAATTCCCAGATGGAGTAAGG - Intronic
1173442640 20:43092000-43092022 CACAGTTCTGGGATGGGGTACGG + Intronic
1175218851 20:57405600-57405622 CACACTTCCCAGATGGGGTGGGG + Intronic
1175359393 20:58396375-58396397 TCCACTTCCCAGATGGGCAAAGG - Intronic
1176963200 21:15183100-15183122 CCAACTTCCAGGATGGGGTATGG - Intergenic
1178705005 21:34865760-34865782 GCCACTTCCCAGATGTGGTGAGG - Intronic
1180060345 21:45381797-45381819 CCCAGCACGCAGATGGGGAAAGG + Intergenic
1181658109 22:24318101-24318123 CTCACTTCCCAGACGGGGTGGGG + Intronic
1183417216 22:37689286-37689308 CCCAGTTCACTGATGGAGAAAGG - Intronic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184314876 22:43678512-43678534 CCCAGCTCTCAGGTGGGGTAGGG - Intronic
1184388308 22:44188637-44188659 CCCATTTCACAGATGAGGAAAGG + Intronic
1184670714 22:46011186-46011208 CCCAGGGCCCAGCTGGGATAGGG + Intergenic
950120360 3:10478197-10478219 CCCAGTTCAAAGATGGGCAAAGG - Intronic
950809897 3:15641227-15641249 CCTAATTCCCAGTTGGGGAATGG + Intronic
952101045 3:30013346-30013368 CCCATTTCCCAGATGGGGCTTGG + Intergenic
953677201 3:45012274-45012296 TCCAGTTAGCAAATGGGGTAAGG + Intronic
954025781 3:47781944-47781966 GCCAGTTCCCAGATGGGGCGGGG - Intronic
954370696 3:50168354-50168376 CCCAGGTCCCACATGGGGCTGGG - Intronic
954671684 3:52294416-52294438 CCCAGAGCCCAGGTGGGGAAGGG - Intergenic
954678287 3:52327475-52327497 ACCAGTTCCAAGTTGGAGTAGGG + Intronic
955422096 3:58748903-58748925 CCCACTTTACAGATGAGGTAAGG - Intronic
961320511 3:126070225-126070247 CCCAGTTCCCAACGGGGGTTGGG - Intronic
961323903 3:126098579-126098601 CCCAGCTCCCAGATGGACCACGG + Intronic
961383876 3:126513552-126513574 CCCACTTTACAGATGGGGAAAGG - Intronic
961541677 3:127604531-127604553 CCCAGTTCCTGGATGGGGTTTGG + Intronic
962282931 3:134065894-134065916 CCCACTTCACAGATGAGGAAAGG + Intronic
966257216 3:177930608-177930630 CCCTGTTCAAAGAAGGGGTAGGG - Intergenic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
971208644 4:24594432-24594454 CCCATTTCCAAGTTGGGATAAGG - Intergenic
973773119 4:54224574-54224596 CCCATCTCCCAGATTGGGTTAGG + Intronic
975695721 4:77011099-77011121 CTCAGTTCCTAGATGAGTTATGG + Intronic
985494233 5:195683-195705 CCCAGTGCCCAGATGCGCTGAGG - Intergenic
989977881 5:50607955-50607977 CCCACTTCCCAGACGGGGCGGGG - Intergenic
997203382 5:132026466-132026488 ACCAGTTCCCAGATGTTCTATGG + Intergenic
997539257 5:134648379-134648401 CCCAGCTCCCAGTGGTGGTACGG + Intronic
1001081507 5:168671121-168671143 CCTATTTCTCAGGTGGGGTAGGG + Intronic
1003126085 6:3356854-3356876 CCCATTTCCAAGATGGGAAATGG + Intronic
1003221993 6:4169039-4169061 GCCTGTCCCCAGATGGGGTCTGG + Intergenic
1004545013 6:16589149-16589171 CCCACTTCCCAGAAGGTGTCAGG - Intronic
1005243518 6:23856214-23856236 CTCACTTCCCAGATGGTGCAGGG - Intergenic
1005887132 6:30105873-30105895 CCCAGGAGCCAGGTGGGGTAAGG + Intronic
1007449624 6:41932954-41932976 CCCAGTCCCCAGCTGGGGCTTGG + Exonic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1012972175 6:105743187-105743209 CCCAGTTCAGAGATGGTGCATGG - Intergenic
1013301635 6:108809650-108809672 CCAAGATCCCAGATGGGAAATGG + Intergenic
1014286363 6:119503442-119503464 CTCAATTCCCACATGGGGAAAGG - Intergenic
1014955832 6:127614775-127614797 CCCTTTTCCCAGATGAAGTAGGG - Intergenic
1019164366 6:170088339-170088361 CCCAGCTCCCAGATGGTGCACGG + Intergenic
1020941088 7:14538303-14538325 CCCAGTTACAAAATGGGGAAAGG + Intronic
1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG + Intergenic
1024176624 7:46846939-46846961 CCCATTTCAAAGATGGGATAGGG - Intergenic
1024223467 7:47305519-47305541 CCCAGTTACCAGCTGGGGGGAGG - Intronic
1029625407 7:101717683-101717705 CCCAGGTCCCAGTGGGAGTATGG - Intergenic
1033284229 7:140026787-140026809 ACCTGTCCCCAGATGGGGTTGGG - Intronic
1033441012 7:141378860-141378882 CCCATTTCCCAGAGTGGGAAGGG - Intronic
1034441975 7:151090223-151090245 GGCAGTTCCCAGATGGGGGGGGG + Intronic
1035268616 7:157706378-157706400 CCCAGTTCCCACATCGTGGAGGG - Intronic
1041125681 8:54636041-54636063 CACAGTTCCCAGAAAGGTTAGGG - Intergenic
1042901825 8:73736603-73736625 TTCAGTTCCTAGATTGGGTAAGG - Intronic
1048583869 8:135755066-135755088 CCCAGTTCCTAGCCGGGGTCGGG - Intergenic
1049175710 8:141191425-141191447 CCCAGTGCCCACTTGGGGCAGGG - Intronic
1049251937 8:141593931-141593953 CCCAGTTCCCACAGGGGGAACGG + Intergenic
1051486337 9:17612376-17612398 GCAAGTTTCCAGATGTGGTAAGG - Intronic
1052530847 9:29682427-29682449 CCTAGATTCCAGATGGTGTATGG + Intergenic
1055882996 9:81024180-81024202 CCCAGTTTACAGATGGCCTATGG + Intergenic
1056507265 9:87269108-87269130 CACAGTGCCAAGATGGGGCAAGG + Intergenic
1056576099 9:87857253-87857275 CTCACTTCCCAGATGGTGTGGGG + Intergenic
1056576262 9:87857941-87857963 CTCACTTCCCAGATGGTGCAGGG + Intergenic
1056892503 9:90509003-90509025 CCCAGTTCAGATATGGAGTAGGG + Intergenic
1058039845 9:100291748-100291770 CCCAGGTTCTGGATGGGGTAAGG - Intronic
1058134155 9:101288666-101288688 ACAAGTTCCCAGATGGCGTAAGG - Intronic
1058599548 9:106654252-106654274 CCCAGCCCCCAAATGGAGTAAGG - Intergenic
1059707388 9:116837801-116837823 CCCAGGACCCAGGTGGGGCAGGG - Intronic
1060826900 9:126692949-126692971 ACCAGGGCCCAGATGAGGTAGGG + Intronic
1061806720 9:133141046-133141068 CCCATTTGACAGATGGGGCAAGG + Intronic
1062030506 9:134359943-134359965 CCCTGTTCCTAGGTGGGGCAAGG - Intronic
1062036731 9:134385783-134385805 CCCAGCACGCAGATGGGGAATGG + Intronic
1062083091 9:134634693-134634715 CTCTGTGCCCAGATGGGGTGGGG + Intergenic
1186485115 X:9928237-9928259 CACAGTTCCCAGAGGGGAGAGGG - Intronic
1190300914 X:49057073-49057095 CCCAGGGCCCAGCTGGGGTAGGG + Intronic
1191138866 X:57094664-57094686 CGCAGGGCCCTGATGGGGTAAGG - Intergenic
1197421224 X:126238327-126238349 CCCAATGCCTAGAGGGGGTAGGG - Intergenic
1197735479 X:129847691-129847713 CCCCAGTCCCAGGTGGGGTAGGG - Intergenic