ID: 1101168560

View in Genome Browser
Species Human (GRCh38)
Location 12:102063905-102063927
Sequence TAGCTGAAGCAGAGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 806
Summary {0: 1, 1: 4, 2: 36, 3: 175, 4: 590}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101168556_1101168560 3 Left 1101168556 12:102063879-102063901 CCCAGACCTTACATTGGAAGCCA 0: 1
1: 0
2: 1
3: 11
4: 118
Right 1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG 0: 1
1: 4
2: 36
3: 175
4: 590
1101168558_1101168560 -3 Left 1101168558 12:102063885-102063907 CCTTACATTGGAAGCCAGTATAG 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG 0: 1
1: 4
2: 36
3: 175
4: 590
1101168557_1101168560 2 Left 1101168557 12:102063880-102063902 CCAGACCTTACATTGGAAGCCAG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG 0: 1
1: 4
2: 36
3: 175
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101168560 Original CRISPR TAGCTGAAGCAGAGTGAGCA AGG Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
902560648 1:17275144-17275166 TAACAGAAGAAGAGTGGGCATGG + Intronic
902907076 1:19566279-19566301 TGCCTGTAGCAAAGTGAGCAAGG + Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903293503 1:22329298-22329320 TGGCTGGAGTAGAGTGGGCAAGG - Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903357630 1:22757883-22757905 TAGCTTACACATAGTGAGCATGG - Intronic
903502918 1:23811669-23811691 CAGCTGAGGCAGACAGAGCAAGG + Intronic
903838578 1:26222053-26222075 TAGCTGAAGTTTACTGAGCATGG - Intergenic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
905078441 1:35295399-35295421 TAGCTGAACATGAGTGAGCAAGG + Intronic
905785608 1:40754687-40754709 TAGCACAATGAGAGTGAGCAAGG - Intronic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906545009 1:46614384-46614406 TAGCTATAGCAGAGTGACCCAGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906883332 1:49617159-49617181 TAGCTGAAACAGAGTGAGTGAGG - Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907241090 1:53081494-53081516 TAGCTGAAGCACAGAGAGTGAGG + Intronic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907615750 1:55924556-55924578 TGGCTGGAGCAGAATGAACATGG + Intergenic
908342197 1:63193085-63193107 TAGCTGGAGCACAGTGAACAAGG + Intergenic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
910002173 1:82354242-82354264 TGGCTATAGCAGAGTGGGCAAGG - Intergenic
910198601 1:84673425-84673447 TATTTGAAGCACAGTAAGCAAGG + Intronic
910300817 1:85705555-85705577 TAACTGAAGCATAGTGAGTGAGG - Intronic
910672092 1:89783771-89783793 TAGCTGAAGTGGAGTGAACAAGG + Intronic
911681702 1:100723991-100724013 TAGCTGAAAGAGAATGAGCTGGG + Intronic
911686434 1:100782069-100782091 TGGCTGAAGTAGAGTAATCAGGG - Intergenic
912342975 1:108935886-108935908 TGGCTAAAGTAGAGTAAGCACGG + Intronic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913368985 1:118075743-118075765 TATCTGGAGTAGAATGAGCAAGG - Intronic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
916924159 1:169499833-169499855 TGGCTGAAGCCAAATGAGCAAGG - Intergenic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917471374 1:175328742-175328764 GAGCTGGAACAGAGGGAGCAAGG + Intronic
917926753 1:179795514-179795536 TGGCAGAAGGTGAGTGAGCAAGG - Intronic
917966871 1:180184301-180184323 AAGCTGAAGGAGCGTGGGCATGG - Intronic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919673860 1:200362165-200362187 TGGCTGAAACAGAGTGAGTGAGG - Intergenic
919754708 1:201059414-201059436 GAGCTAAAACAAAGTGAGCAGGG - Intronic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920796962 1:209148117-209148139 CAGTTGAACCAGAGTGGGCATGG - Intergenic
921004001 1:211075077-211075099 TAGCCGAATAAGAGTGAGCAAGG + Intronic
921153833 1:212422781-212422803 TAGCTGAATTAAAGTGACCATGG + Intergenic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921329666 1:214022947-214022969 AAGCTGCAGCAGAGTCACCAGGG - Intronic
921353278 1:214259844-214259866 TGGCTAGAGCTGAGTGAGCAAGG - Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922348709 1:224718386-224718408 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
922639790 1:227217720-227217742 TAGCTGGAGCATAGTGAACCAGG - Intronic
923300807 1:232638856-232638878 TTGCTGAAGAATAGGGAGCAAGG - Intergenic
923445421 1:234066384-234066406 TAGTTGGGGCAGAATGAGCAAGG - Intronic
923514204 1:234680961-234680983 AAGCTGCAGGGGAGTGAGCAAGG + Intergenic
924351153 1:243115735-243115757 AAGCTGCAGCAGAGTGTGCCTGG - Intergenic
1063186000 10:3652163-3652185 CAACTGAAGCAGAGTCATCAAGG + Intergenic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065229288 10:23580350-23580372 TTGCTGTAGCAGAGTGTGCTGGG + Intergenic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1067101988 10:43340535-43340557 TAGCTGGAACAGAGTGGACAAGG + Intergenic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1067666483 10:48283852-48283874 TGGCTGAGGTAGAGTGAGGAAGG - Intergenic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1068921482 10:62489296-62489318 CAGCTGGAGTGGAGTGAGCATGG + Intronic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1069904034 10:71721887-71721909 TAGCTGAAGTAGAGGCAGCTGGG - Intronic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071409650 10:85376417-85376439 TGGCTGAAGCATGGTGAACAGGG - Intergenic
1071587021 10:86833497-86833519 TAGATGAAGCAGAGGGAGGTGGG + Intronic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073241006 10:102058179-102058201 TAGCCGAAGCAGAGAGAGAGGGG - Intergenic
1073451148 10:103610132-103610154 GAGCTGAGGCAGAGTGAGTGAGG + Intronic
1073713300 10:106071154-106071176 TAGCTGAAGCAGACTAAGACAGG - Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1075085677 10:119412877-119412899 TCGCTGCAGCTGGGTGAGCAGGG + Intronic
1075876761 10:125813928-125813950 TACCTGGAGCAGAGTGGGCATGG - Intronic
1076849441 10:133085949-133085971 TAGGTGAAGGAGAGAGAGCCAGG - Intronic
1077032436 11:474537-474559 TGGCTGAGGCAGAGTGCGCTGGG - Intronic
1077581597 11:3420818-3420840 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1077846486 11:6030586-6030608 TGGCTGAAGCTCAGGGAGCAAGG - Intergenic
1078093495 11:8282492-8282514 TGGCTGAAGGGGAGGGAGCATGG - Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078795548 11:14588812-14588834 GAGCTGGAGTAGACTGAGCAAGG - Intronic
1078835512 11:15025743-15025765 CAGCTGTGGCAGAGGGAGCAGGG - Intronic
1079058891 11:17230264-17230286 TAGCTCCAGCAGAGGGAGCCAGG + Intronic
1079478206 11:20853888-20853910 TAACTGAGGCAGAGTGGGGAAGG + Intronic
1080214976 11:29830033-29830055 TAGCTAAAGCAGTGTGAAGAGGG + Intergenic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080549724 11:33362215-33362237 TAGATGAAGCAGACTGAGTGGGG + Intergenic
1080635646 11:34121030-34121052 GGGCTGAAGCAGGGTGAGTAGGG + Intronic
1080849942 11:36059510-36059532 GGGCTGAAGCAGAGTGCCCAGGG - Intronic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1081747291 11:45482153-45482175 CAGCTCAGGCAGAGTGGGCAAGG + Intergenic
1083172288 11:60930194-60930216 TAGCTGAAGCAGAGAGTGCATGG + Intronic
1083190698 11:61050026-61050048 GAGCTGGAGCAGAGGGAGCCAGG - Intergenic
1083853900 11:65382727-65382749 TGGCTGCAGCAGAGAAAGCAAGG - Intronic
1084238510 11:67803641-67803663 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1084833907 11:71789192-71789214 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
1085371480 11:76010795-76010817 CAGCTGGAGCATAGTGAGCGAGG + Intronic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1085862107 11:80246256-80246278 TGGCTGGAGCAGGATGAGCAGGG + Intergenic
1086395491 11:86411204-86411226 TGGCTGAGGCATAGTGACCAAGG - Intronic
1086592548 11:88533238-88533260 TAGATGAAGCAATGTGAGCAAGG - Intronic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1086989700 11:93289419-93289441 TAGCAGAAGCTGAGTAAGTAAGG - Intergenic
1087311913 11:96554519-96554541 TGGCTGAAGAATAGTGAGCATGG + Intergenic
1087657413 11:100941212-100941234 TAGCTGGAGCTGAGTGCACAAGG + Intronic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088527528 11:110772985-110773007 TGGTTGAAGCAGAGCAAGCAAGG - Intergenic
1088953610 11:114595842-114595864 TAGCTCAAGCAGAGGTAGGAAGG + Intergenic
1089152031 11:116371743-116371765 TAGCTGATTCAGACTCAGCATGG + Intergenic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1090641542 11:128733488-128733510 TGGCTGATGCTGAGTGAACACGG + Intronic
1090968644 11:131620531-131620553 TAGCTGGGGCTGAGTGAGCAAGG - Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091688748 12:2581778-2581800 TACCTGAAACACAGTGAGGAGGG - Exonic
1091763636 12:3104137-3104159 CAGCTGGAGGGGAGTGAGCAAGG + Intronic
1092072078 12:5639648-5639670 TGGCTGACACTGAGTGAGCAAGG + Intronic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092409198 12:8241266-8241288 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1092564879 12:9654192-9654214 TAGGTGAAGCAAAGTGAAGATGG + Intergenic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1093158829 12:15720756-15720778 CAGCTGGGGCAAAGTGAGCAAGG - Intronic
1093197248 12:16143939-16143961 TAGCTGAAGTGGAAGGAGCAAGG + Intergenic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093349544 12:18080987-18081009 TGTGTGAAGGAGAGTGAGCAGGG + Exonic
1093646188 12:21587881-21587903 AAGCTGGAGTAGAGTGTGCAAGG + Intronic
1093889162 12:24498848-24498870 TACCTGCAGCACAGTGAGCCAGG - Intergenic
1093913620 12:24775184-24775206 TAGCTAGAGCCGAGTGAGCGAGG - Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095580550 12:43792241-43792263 GAACTGAAGCAGACTGACCAAGG + Intergenic
1095821125 12:46479584-46479606 TAACTGAAGAATAGAGAGCAAGG - Intergenic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1096167853 12:49439225-49439247 TAGCTGAAGTGCATTGAGCAAGG + Intronic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1097826236 12:64177306-64177328 TCGCTAAAGGAGACTGAGCAGGG + Intergenic
1098128911 12:67327603-67327625 TAGCTTTAGCGGAGTGAACAAGG - Intergenic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1098287167 12:68919009-68919031 TGGCTGGAGCCCAGTGAGCAAGG - Intronic
1098445739 12:70564019-70564041 TGGCTGGAACAGAGTGAGCGAGG - Intronic
1099048800 12:77757991-77758013 TAGTTGAAGCAAAGTAAGCAAGG - Intergenic
1099302578 12:80916399-80916421 GAGCTGGAGCAGAGGGAACAAGG - Intronic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1100255144 12:92875787-92875809 TAGCTGTAGCATAGTGAGCAAGG - Intronic
1100275070 12:93064287-93064309 AGGCTGAAGCCGAGTGGGCAAGG - Intergenic
1100407687 12:94285489-94285511 GAGCTATAGGAGAGTGAGCACGG - Intronic
1100442215 12:94627550-94627572 TGGCTGGGGCAGTGTGAGCAGGG - Intronic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101201546 12:102441465-102441487 GAGCTGAAGCAAAGGGGGCAGGG + Intronic
1101484069 12:105133183-105133205 TACCTGAAGCACTGTGAGCAGGG - Intronic
1101579956 12:106033591-106033613 TGACTGAAGCTAAGTGAGCAAGG + Intergenic
1101714855 12:107301804-107301826 TGGATGCAGCAAAGTGAGCAAGG - Intergenic
1101878001 12:108608145-108608167 TAGCTGGAACAGAGTGAGTTAGG + Intergenic
1102015135 12:109643223-109643245 AAGCTGAGGGAGAGTGAGTAAGG - Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102247945 12:111367087-111367109 TGGCTGGAGCTGAGTGAACAAGG - Intronic
1102764678 12:115422479-115422501 TGGCTGGAGCAGAGAAAGCAGGG - Intergenic
1102807463 12:115794536-115794558 TGGCTGGAGAAGAGTGACCAAGG + Intergenic
1102976909 12:117213395-117213417 TATCTGTGGAAGAGTGAGCAGGG + Exonic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103953242 12:124563319-124563341 TAGCTGGAGCCAAGTGGGCAGGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104089912 12:125507657-125507679 TGGCTCAGGCAGAATGAGCAGGG + Intronic
1104121590 12:125805171-125805193 TGGCTGTAGAGGAGTGAGCAAGG + Intergenic
1104169007 12:126261639-126261661 CCGCTGGAGCAGAGTGAGCCAGG + Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104416123 12:128597939-128597961 TAGCTGGAGCGTAGTGATCAAGG + Intronic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1105390315 13:19971038-19971060 TAGCTGAAGCTTAATGAGCAAGG + Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106375498 13:29182910-29182932 CAGCTGAAGGGGAGGGAGCAGGG + Intronic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1107060653 13:36156265-36156287 TACGTGAAACAGATTGAGCAAGG + Intergenic
1107200817 13:37714646-37714668 TGGCTGGAGCACAGAGAGCAAGG - Intronic
1107760667 13:43674973-43674995 TGGCTAAAGCACAGTGAACAAGG + Intronic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1108574769 13:51781719-51781741 CAGCTGCAACCGAGTGAGCATGG + Intronic
1109226223 13:59699373-59699395 CAGCTGAAGGGGAGTGAGCCAGG + Intronic
1110103120 13:71634403-71634425 TACCTGGAGCACAGAGAGCAAGG - Intronic
1111048666 13:82848965-82848987 TAGCTGAACCAAAGTGTCCATGG - Intergenic
1111071046 13:83168118-83168140 TTCCTGAAGTAGAGTGAGCTAGG + Intergenic
1111162751 13:84417366-84417388 TAACTGGAGCTGAGTGAGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112138507 13:96611784-96611806 TGGCTCAGGCAGAGTGAGCATGG + Intronic
1112574922 13:100627175-100627197 TGGCTGGAGCACAGAGAGCAGGG + Intronic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1114465773 14:22921446-22921468 AGGCTGAAGCAGTGTAAGCAAGG + Intronic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1114862666 14:26544437-26544459 TAGGTGATGCACAGTGAGGAGGG + Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1116336606 14:43665565-43665587 CACCTGTAGCAGAGGGAGCATGG + Intergenic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117440562 14:55755278-55755300 TAGCTGAGGCAGAGATAGTAGGG - Intergenic
1118966853 14:70595124-70595146 TAGCTGAAGCCGAGTGACACTGG - Intronic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1120703373 14:87723131-87723153 TGGCTGGAGAAGAGTGGGCAAGG + Intergenic
1120962626 14:90139400-90139422 TAGCTAAGGCACAGTGAGCAAGG + Intronic
1121143184 14:91559574-91559596 TAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1123737184 15:23196650-23196672 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124288400 15:28425312-28425334 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124294824 15:28492002-28492024 TAGCTGGAGTAGAATGAGAAGGG - Intergenic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124604334 15:31159863-31159885 CCGCTGAAGCAGTGTGAGCCAGG - Intronic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1125935671 15:43633444-43633466 TGACTGGAGTAGAGTGAGCAGGG - Intronic
1125948442 15:43729908-43729930 TGACTGGAGTAGAGTGAGCAGGG - Intergenic
1125975494 15:43947771-43947793 TTGCTGAAGCAGAGGCAGCTGGG + Intronic
1127102943 15:55586597-55586619 TAACTGCAGCAAAGTGAGCAAGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128105763 15:65043569-65043591 TAGCTGAATCATAGTGATGAGGG - Intergenic
1128209067 15:65879911-65879933 CAACTGAAGCTCAGTGAGCAAGG - Intronic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1128523068 15:68388220-68388242 TGGCTGGAGTAGAGTGAGCTAGG - Intronic
1128622996 15:69167866-69167888 TGGCTGAAGGAAAGTAAGCAAGG - Intronic
1128625348 15:69196219-69196241 TGACTGAAGTGGAGTGAGCATGG + Intronic
1129108268 15:73323300-73323322 TGGCTGCAGCGGGGTGAGCAGGG + Exonic
1129113462 15:73351843-73351865 TGTCTGCAGCAGAGTGTGCAAGG - Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1130756344 15:86768438-86768460 TAGCTGGAGGACAGTGAACAAGG - Intronic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131934611 15:97489685-97489707 TAGCTGGAGTGGAGTGAGCAAGG - Intergenic
1132390287 15:101433689-101433711 TACCTGAGGCTGAGTGGGCAGGG + Intronic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1133350167 16:5096069-5096091 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134902891 16:17954544-17954566 TAGCTGAGCCAGAGTGAGTTGGG + Intergenic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136080659 16:27850569-27850591 AAGCTGAGGCAGAGTGGCCAGGG + Intronic
1137370748 16:47903694-47903716 TGACTGAGGCTGAGTGAGCAAGG + Intergenic
1138151111 16:54657980-54658002 AAACTGAAGCAGAGAGAGCTGGG - Intergenic
1138413813 16:56859774-56859796 TGGCTGGAGCAGAGGGACCAAGG - Intergenic
1138525464 16:57603575-57603597 AAGCTGAAGAAGTGTGAGAAGGG + Intergenic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1141034224 16:80613933-80613955 TGGCTCATGCACAGTGAGCAGGG - Intronic
1141072851 16:80973697-80973719 GAACTGGAGCACAGTGAGCAAGG - Exonic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1142789525 17:2253073-2253095 TAGCTGCAGCAGAGGGCACATGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144131476 17:12251044-12251066 CAGGTGAGGCAGGGTGAGCAGGG + Intergenic
1145092601 17:19998382-19998404 GAGCTGGAGTGGAGTGAGCAAGG + Intergenic
1145102409 17:20088053-20088075 CACATGAAGCACAGTGAGCAGGG + Intronic
1145769870 17:27485276-27485298 GAGCTGAGGCAGAGAGGGCAGGG + Intronic
1146165182 17:30582931-30582953 GAGCTGGAGTGGAGTGAGCAAGG + Intergenic
1146634513 17:34494233-34494255 TAGTGGAAGCAGAGTGAACATGG + Intergenic
1147355549 17:39893195-39893217 TGGCTGAAGCATTATGAGCAGGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1150005370 17:61465748-61465770 GAGATGGAACAGAGTGAGCAAGG - Intronic
1151097450 17:71514814-71514836 TAGAGGAAGCAGTGTGAGAAAGG + Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1153174334 18:2353823-2353845 TAACTGAAAAAGAGTGAGAATGG + Intergenic
1155148819 18:23106101-23106123 AACCTGAAGCAGAGAGGGCAAGG - Intergenic
1155171278 18:23268412-23268434 TAGCTGAAGCAGAATCACCTGGG + Intronic
1155616794 18:27730516-27730538 TAGCTTAAGTAGAGGGAGTAAGG - Intergenic
1155827673 18:30468547-30468569 TAGCTGGAGTGGAGTGAGGAAGG + Intergenic
1157267279 18:46237151-46237173 TAACAGAAGCTGACTGAGCATGG - Intronic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1157702247 18:49769187-49769209 CAGCTGGAGCAGAGTGAGTGGGG - Intergenic
1158278470 18:55794499-55794521 TTGATGAGGGAGAGTGAGCAGGG + Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159133268 18:64306025-64306047 TAGCTGGAGCTGAGTGAGAGGGG + Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1160104894 18:75964855-75964877 ATCCTGAACCAGAGTGAGCAGGG + Intergenic
1160433163 18:78826211-78826233 CGGCTGAACCAGGGTGAGCATGG - Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160687060 19:441985-442007 TACCTGGAGCAGGGAGAGCAAGG + Intronic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161274904 19:3410509-3410531 TGGCTAGAGCAGAGTGAGGAAGG + Intronic
1161283376 19:3457268-3457290 CGGCTGCAGCTGAGTGAGCATGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161302981 19:3551839-3551861 TGGCTGGAGCAGAGAGAGAAGGG - Intronic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161431290 19:4233705-4233727 TGGCCACAGCAGAGTGAGCAAGG - Intronic
1161451750 19:4350237-4350259 TGGCTGGAGCCGAGTGAGTAAGG + Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161533854 19:4806651-4806673 TGGCTGGAGCAGAGTGACAAAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161629354 19:5344490-5344512 TGGCGGGAGCAGAGTGAGCGAGG - Intergenic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161760584 19:6168176-6168198 TGGCTAGAACAGAGTGAGCAAGG - Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161854624 19:6756804-6756826 TAGCTGAAGCAGAGGGAATGAGG - Intronic
1161970783 19:7578778-7578800 TAGCTGAAACAGCCTGGGCACGG - Intergenic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162204571 19:9046130-9046152 CAGCTGAAACAGAGTGAACGAGG - Intergenic
1162304437 19:9863223-9863245 TGGCTGGAGCAGATTGAGTAAGG + Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162397780 19:10427421-10427443 TGTCTGAGGCAGAGTGAGCGAGG + Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1163025596 19:14509643-14509665 TAGCTCCAGAAGAGTGAGAAAGG + Intergenic
1163122113 19:15224162-15224184 TTGCTAAGGCAGAGTGAGCGAGG - Intergenic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1165064621 19:33221675-33221697 TGGCTGAGGCTGGGTGAGCAGGG + Intronic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165794092 19:38508698-38508720 TAGCTGAAGCAGAGTCATCGAGG + Intronic
1165891234 19:39113497-39113519 TGGCTGCAGCAGAGTGGGCGAGG - Intergenic
1165940249 19:39411336-39411358 TGGCTGGAGCAGAGTGGCCAAGG - Intergenic
1166051700 19:40264538-40264560 TGGCTGGAGCAGTGTGAGCTAGG - Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166673940 19:44727822-44727844 TAGCTGGAGCAGGATGAGCTGGG - Intergenic
1166787006 19:45373738-45373760 TAGCTGAAACAAAATGAGCTGGG - Intergenic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167112017 19:47468183-47468205 TGGCTGAGGCAGACTGGGCAAGG - Intronic
1167269710 19:48499925-48499947 GAGGTGGGGCAGAGTGAGCAGGG + Intronic
1167531896 19:50022970-50022992 TGGCTGACTCAGCGTGAGCAAGG - Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167880816 19:52455962-52455984 TAGCTACAGCAGAGGGAGCAAGG - Intronic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
1168516696 19:57015199-57015221 TGTCTGAAGAGGAGTGAGCAAGG - Intergenic
925533565 2:4891650-4891672 TAGGTGGAGCCGTGTGAGCAGGG + Intergenic
925796851 2:7554868-7554890 CAGCTGAAGCACAGGCAGCATGG + Intergenic
926306814 2:11643230-11643252 GAGCTGATGGGGAGTGAGCAAGG - Intergenic
926412072 2:12614955-12614977 TAGCTGAAACAGGGACAGCATGG - Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927769540 2:25847254-25847276 TAGATGTAGCAGAGAGATCAAGG - Intronic
928074454 2:28250277-28250299 TGGCTGGAGCACAGTGAGTAAGG + Intronic
929836404 2:45404834-45404856 TGGCCAGAGCAGAGTGAGCAAGG - Intronic
930511410 2:52349908-52349930 TGGCTGCAACAGAGTGGGCAAGG - Intergenic
930897926 2:56467111-56467133 CAGCTAAAGCAGGGTGAGAAGGG + Intergenic
931089395 2:58869280-58869302 TAGCTGAAGCAGGTGGAGCCAGG + Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931380743 2:61750964-61750986 TGGCTGGAGCAAAGTGATCAAGG + Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
932149730 2:69359526-69359548 TAGCTGAAGCAAACAGTGCAGGG + Intronic
932254288 2:70270496-70270518 CAGCTGAAGCAGAGTGATATGGG - Intronic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932527683 2:72488969-72488991 TAGCTGGAGTGGAGTGAGCAAGG - Intronic
932692908 2:73928612-73928634 TGACTGAAGTCGAGTGAGCAAGG + Intronic
932757166 2:74416969-74416991 ATGCTGCAGCAGAGAGAGCAAGG - Intronic
933183668 2:79254977-79254999 TAGCTGAAGCAGAATCACCCTGG + Intronic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934678191 2:96265061-96265083 TGGCTGAAGCAGAGATAGCCAGG - Intronic
935608030 2:104990360-104990382 TGGCTGGAGCAGTGTGAGTAAGG + Intergenic
936003769 2:108863454-108863476 TAGCTGAAGCAGAGTTAGTGAGG + Intronic
936893998 2:117406077-117406099 TGGGTGAAGCTAAGTGAGCATGG + Intergenic
939024680 2:136997942-136997964 AAGGTAAGGCAGAGTGAGCAAGG + Intronic
940012849 2:149073026-149073048 TGGCTGGAGAATAGTGAGCAGGG + Intronic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
941913745 2:170793616-170793638 TAACTGGAGCAGAATGAGCATGG + Intronic
942013473 2:171788111-171788133 TAGCTGTTGCAGTGTGATCAGGG + Intronic
942110939 2:172682242-172682264 TGGCTGTAGTAGAGAGAGCAGGG + Intergenic
942363063 2:175193136-175193158 TGTGTGAAGCAGAATGAGCAAGG - Intergenic
942504461 2:176626905-176626927 GGGCTGAAGCAGAAAGAGCAAGG - Intergenic
942771542 2:179526711-179526733 TAGGAGAAGCAGTGTCAGCAAGG - Intronic
943233776 2:185291628-185291650 TAGCTGAGGCAGAGAGAGAGAGG - Intergenic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945009168 2:205443525-205443547 TAGCTTAGGCAGAGTTAGAAAGG - Intronic
946162303 2:217842781-217842803 TGGCTGGAGTAGAGTGATCAAGG - Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946440837 2:219693762-219693784 TGGCTGGAGCAGAGAGTGCAGGG + Intergenic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
1168809407 20:694445-694467 TGGCTGGAGCACAGTGAACAAGG + Intergenic
1168964010 20:1888003-1888025 TAACTGGAGTGGAGTGAGCAAGG + Intergenic
1169000330 20:2163622-2163644 TGGCTGCAGCAGAGGAAGCAAGG + Intronic
1169104541 20:2983291-2983313 TGGCTGAAATTGAGTGAGCAAGG + Intronic
1169234962 20:3923387-3923409 TACCTGAAACAAAGTGAGAAAGG + Exonic
1169387871 20:5166465-5166487 TAGCTCAAGAAGAGACAGCAGGG + Intronic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170220360 20:13935609-13935631 TAACTGGAGCAGAGTGAGTGGGG + Intronic
1170707825 20:18761202-18761224 TAGCTGCAGCACACCGAGCAGGG - Intronic
1170852925 20:20020469-20020491 TGGCTGGTACAGAGTGAGCATGG + Intronic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173341558 20:42157070-42157092 TGGCAGAGGAAGAGTGAGCAAGG - Intronic
1173539422 20:43840494-43840516 GGGCTGGAGCAGAGTGATCAAGG + Intergenic
1173669352 20:44787174-44787196 TGGCTGGAGCAGACAGAGCAAGG + Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174080513 20:47968165-47968187 AAGCTGAGGCAGAGTGGTCAAGG + Intergenic
1174136911 20:48386091-48386113 AAGCTGAGGCAGAGTGCTCAAGG - Intergenic
1174278340 20:49419921-49419943 TGGCTGGAGGGGAGTGAGCAAGG - Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174387839 20:50197807-50197829 TGGCTGGAGCAGAGGCAGCAAGG + Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177094805 21:16819554-16819576 GAGGTGAAGCAGAGGAAGCAGGG - Intergenic
1177459228 21:21388475-21388497 TTGCTGAAGCTGAATAAGCAAGG + Intronic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1179224536 21:39442268-39442290 TGGCTGAAGCCCAGTGAGAAGGG + Intronic
1180125807 21:45789621-45789643 TGGCCGGAGCAGAGCGAGCAAGG + Intronic
1180186743 21:46144055-46144077 TAGCTGAGGCAGAGAGAGAGAGG - Intronic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1182889617 22:33806319-33806341 TAGCTGAAGCAAATGGAGCTAGG + Intronic
1182936464 22:34227443-34227465 GGGCTAAACCAGAGTGAGCAAGG - Intergenic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1183260843 22:36794905-36794927 TAGTTGAAGCAGAGAATGCAGGG + Intergenic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184320872 22:43741334-43741356 TAACTGAGGCAGAGTGAAAAGGG - Intronic
949252600 3:2005281-2005303 TGGCTGAAGCAGAGAAAGTAAGG + Intergenic
949328278 3:2891691-2891713 TAACTAAATCATAGTGAGCAAGG + Intronic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950455939 3:13092814-13092836 TGCCTGGAGCAGAGTGAGGAGGG - Intergenic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950649890 3:14400874-14400896 TAGCTGAAGCAGAGGGATGTGGG + Intergenic
950765974 3:15273245-15273267 TAACTGAAGCAGAGAGAACTGGG - Intronic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
951975691 3:28505256-28505278 TGGCTGAAGAAGAGAGTGCAGGG + Intronic
952086605 3:29829572-29829594 TAGCTGAAGCAGAATGGGGGAGG + Intronic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952254328 3:31682407-31682429 TGGCTGGAGCAGGGTGAACAGGG - Intronic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
953013319 3:39049428-39049450 CAGCGGAAGTACAGTGAGCAGGG + Intergenic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953468410 3:43145861-43145883 TGGCAGAAGCACTGTGAGCAGGG - Intergenic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953768679 3:45762717-45762739 TCACTGAAGCAAACTGAGCATGG + Intronic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
954199917 3:49018077-49018099 TGGCTCAAGCGGAGTGCGCAGGG + Exonic
954235445 3:49253540-49253562 TGGCTGAAACATGGTGAGCAAGG - Intronic
954419549 3:50411437-50411459 GAGCTGGGGGAGAGTGAGCATGG - Intronic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955088789 3:55729224-55729246 TGGCTGGCGTAGAGTGAGCAAGG - Intronic
955177498 3:56631321-56631343 TAGAGGAAGCAGAGGGACCATGG - Intronic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956829193 3:73028827-73028849 TGGCTGAAGTAGACTGATCAAGG + Intronic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957054459 3:75433432-75433454 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
957854827 3:85860953-85860975 TGTCTGAAGCAGAGTGAGCTAGG + Intronic
958192766 3:90204639-90204661 TGGTTAAAGCATAGTGAGCAAGG - Intergenic
958255649 3:91321753-91321775 TGGCTGAGGCAGAGCCAGCAGGG - Intergenic
958624562 3:96607320-96607342 TGGGTGCAGCACAGTGAGCATGG - Intergenic
958632469 3:96701040-96701062 TATCAGAAACAGAGTGGGCAGGG - Intergenic
958830331 3:99079610-99079632 TAGCTGAAGCATAGTTGTCAAGG + Intergenic
958830990 3:99088979-99089001 TAGCTGGAGCACTATGAGCAAGG + Intergenic
960147330 3:114217288-114217310 TACCTGGTGCAGAGTGAGTATGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960725607 3:120666800-120666822 TAGCTGTATCAGGGTGGGCATGG - Intronic
961947130 3:130703235-130703257 TGGCTGGAGCAAAGTGAGCGAGG - Intronic
962004174 3:131331638-131331660 GAGCCGAAGCAGGGCGAGCAAGG + Intronic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
962898629 3:139737646-139737668 CATGTGAAGCAGAGAGAGCAGGG + Intergenic
963280289 3:143377874-143377896 TGGCTGGAGCTGAGTAAGCAAGG - Intronic
963730152 3:148963414-148963436 TGGCTGGAGAAAAGTGAGCAAGG + Intergenic
964081407 3:152763078-152763100 TGGCTGGAGCAGAGTGATTAAGG - Intergenic
964248085 3:154677517-154677539 TAGCTGAGGTTGAGTGAGCAAGG + Intergenic
964361954 3:155907913-155907935 TGGTTGGAGCAGAGTAAGCATGG + Intronic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966108467 3:176365291-176365313 TTGCTGAACCAGACTAAGCAGGG + Intergenic
966323927 3:178733304-178733326 TGGCTGGAGTAGAGTGAGCTGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
967912315 3:194552511-194552533 TGGCCGCAGCAGAGTGGGCAAGG - Intergenic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968997272 4:3953742-3953764 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
969471123 4:7389893-7389915 AGGCTGAAGGACAGTGAGCAGGG + Intronic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969756742 4:9154940-9154962 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
969816712 4:9692509-9692531 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
971091951 4:23355958-23355980 TGGCTGGAGTAGAGTGAGAAAGG + Intergenic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972202729 4:36734661-36734683 TAGTTGAAACAGAGTGCGGAGGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972922776 4:43964888-43964910 CAGTTGGAGCAGAGTAAGCAAGG + Intergenic
972952503 4:44344925-44344947 AAGCTGAAGAACAGTGAGGAGGG - Intronic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973745110 4:53956487-53956509 TAGCTGAATCTGAGTGGACAGGG - Intronic
975173286 4:71258163-71258185 TATCTGGAGTAAAGTGAGCAAGG - Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
976229401 4:82825596-82825618 TAGCTGGAGCAGAGAGAACAAGG + Intronic
976254449 4:83085398-83085420 TAGCTGAAGCAGAGAGAAGGTGG - Intergenic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977086177 4:92601522-92601544 TAGCTGAAGCAGTGTCAAGAGGG + Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977370708 4:96131292-96131314 TGGCTGAAACAAAGTGAGTAAGG - Intergenic
977855553 4:101886318-101886340 TGGCTGAAGCAGAAACAGCAAGG + Intronic
978312409 4:107399039-107399061 TGGCTAAAACAGAGTGAACAAGG + Intergenic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
979250787 4:118564803-118564825 AAGCTGCAGCAGAGTGTGCCTGG + Intergenic
980091431 4:128447242-128447264 TGGCTGAAGCAGAGTGAATGAGG + Intergenic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
982042609 4:151410055-151410077 TAGCAGAAGCGGAGTTAACAAGG - Intronic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982072510 4:151707795-151707817 CAGCTGAAGCAGAGGGTCCATGG - Intronic
982090354 4:151875160-151875182 TGGCTGGAGTAGAGAGAGCAAGG + Intergenic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
984624949 4:181996486-181996508 CAGCTGAAGCAGAGAGTGAAAGG + Intergenic
985054006 4:186020320-186020342 TGGCTGAAGGAGAATGAGCCAGG + Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
988439704 5:31218890-31218912 TGACTGAAGCAGAGTGTGCTAGG - Intronic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
988901854 5:35741451-35741473 TGTCTGGAGCAGAGTGAGCTAGG + Intronic
988967504 5:36434001-36434023 TAGCTTGAGCAGAGTAAGCATGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
990029983 5:51246678-51246700 CAGCTGAAGCAGAGAAAGCATGG + Intergenic
990231650 5:53718965-53718987 TAGCTAAAGCAGAGTTAAGAGGG + Intergenic
990282341 5:54264609-54264631 TGGCTGAAGCAGAAAGAGTAGGG - Intronic
991442299 5:66663666-66663688 TAGCTGGAATAGAGTGGGCAAGG + Intronic
991507245 5:67338093-67338115 TAGGTAGAGAAGAGTGAGCATGG - Intergenic
992222534 5:74586984-74587006 TAGCTGATGAAGATTGAGGAGGG + Intergenic
992388656 5:76310462-76310484 TGGCTGGAGCAGAATGACCAAGG + Intronic
992498865 5:77322056-77322078 TGGGTGAGGCAGGGTGAGCAGGG + Intronic
992664562 5:78994439-78994461 CAGGTGAAGCAGAGTGGTCATGG - Intergenic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
994052688 5:95380610-95380632 TGGCTGGAGGAGAGTAAGCAAGG + Intergenic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
994300619 5:98142702-98142724 CAGCTGGGACAGAGTGAGCATGG - Intergenic
996139418 5:119887747-119887769 AGGCTGGAGCAGAGTAAGCAAGG - Intergenic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997222773 5:132182705-132182727 TGACTGAAGCAGAGGGAGCTGGG + Intergenic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
998177183 5:139909033-139909055 AACCTCATGCAGAGTGAGCAGGG + Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
999576840 5:152988297-152988319 TGACTGAGGCAGAGTGTGCAGGG + Intergenic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
999693807 5:154170843-154170865 TGGCTGAAGCTGAATGACCAGGG - Intronic
999793545 5:154966141-154966163 ATGCTGAAGCATAGTAAGCAAGG - Intronic
999857721 5:155613445-155613467 TGGATGGAGCAGAGTGAGCCAGG + Intergenic
999992250 5:157060326-157060348 TAGCTGGGGCTGAGTCAGCAGGG - Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000166151 5:158650624-158650646 TGGCTGGAGAAGAATGAGCAGGG - Intergenic
1000186617 5:158864821-158864843 TGGCTGCAGCACAGTGAGCGAGG + Intronic
1000839637 5:166201851-166201873 AAAATGAAGCAGAGAGAGCAGGG - Intergenic
1000963829 5:167631464-167631486 TGGCTGAAGCATAGGGAGTAAGG + Intronic
1001016869 5:168149806-168149828 TGGCTGTAGCAGAGTGAGTGAGG - Intronic
1001265837 5:170274099-170274121 TAGCTGAGACAGAGAGTGCATGG + Intronic
1001345481 5:170893394-170893416 TATCTGAATCATACTGAGCAAGG - Intronic
1001449707 5:171815191-171815213 GAGCTGAGGCTGAGTGTGCAAGG + Intergenic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001751795 5:174137062-174137084 TGGCTGGAACTGAGTGAGCAAGG + Intronic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002643663 5:180642460-180642482 TAGATGGAGCAGATGGAGCATGG + Intronic
1003413325 6:5885508-5885530 CAGCTGACGTGGAGTGAGCAAGG - Intergenic
1003519078 6:6842198-6842220 TAAGTGAAAGAGAGTGAGCAAGG - Intergenic
1004077922 6:12362257-12362279 TAGCTGAAGCAGAGGGAGCTGGG + Intergenic
1004774391 6:18826593-18826615 TAGCTGAAGCTGATTGAGTAAGG - Intergenic
1006127096 6:31846035-31846057 TGGCTGAAGCAGAGTGGAAATGG - Intergenic
1006178350 6:32137713-32137735 TGAGTGGAGCAGAGTGAGCAAGG + Intergenic
1006466820 6:34200536-34200558 TGGCTAGAGCAGAGTAAGCAAGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007238980 6:40411575-40411597 TGGCTGAAGCACAGAGTGCAGGG - Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007322186 6:41035332-41035354 GTTCTGAAGCAGAGTGAGCTTGG + Intronic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008291935 6:49726109-49726131 TAGCTGGAGTAGAGGGAGCATGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008815170 6:55556491-55556513 TAGATGGAGAAGAGTGAGCAAGG + Intronic
1009279092 6:61723853-61723875 TACCTGAAGGAGAGGGAGAATGG + Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1010114563 6:72287478-72287500 TAGATGAAGGAGAGTAGGCATGG + Intronic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1011388922 6:86829397-86829419 TACCTGAAGCAGAGTGAATGAGG + Intergenic
1011417304 6:87135920-87135942 TACCAGAGGCAGAGTGAACATGG - Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011894103 6:92202317-92202339 TAGCTGAAGCAGGGTAGACAAGG + Intergenic
1012398502 6:98825573-98825595 TTGCTGATGGAGAGGGAGCAGGG - Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1012489369 6:99763756-99763778 TGGCTGGAGCATAGTGAGCTAGG + Intergenic
1012491303 6:99785196-99785218 TAGCTGATGATAAGTGAGCAGGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013774183 6:113660849-113660871 AAGCTGGAGCAGATTGAGTATGG + Intergenic
1013965837 6:115954224-115954246 TGGCTGACGAAGACTGAGCAAGG + Intronic
1014599490 6:123392076-123392098 TTGATGAAGCACAGTGAACAAGG - Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1017539771 6:155388747-155388769 TTGATGAAGCATGGTGAGCAGGG + Intergenic
1017898428 6:158701189-158701211 TAGATGAAGGAGTGTGAGCTGGG + Intronic
1017898432 6:158701215-158701237 TAGATGAAGGAGTGTGAGCTGGG + Intronic
1017898436 6:158701241-158701263 TAGATGAAGGAGTGTGAGCTGGG + Intronic
1017898440 6:158701267-158701289 TAGATGAAGGAGTGTGAGCTGGG + Intronic
1017898444 6:158701293-158701315 TAGATGAAGGAGTGTGAGCTGGG + Intronic
1017898448 6:158701319-158701341 TAGATGAAGGAGTGTGAGCTGGG + Intronic
1017898452 6:158701345-158701367 TAGATGAAGGAGTGTGAGCTGGG + Intronic
1017898456 6:158701371-158701393 TAGATGAAGGAGTGTGAGCTGGG + Intronic
1018896105 6:168018712-168018734 TAGCTGAAGGAGGATGAGCAGGG - Intronic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019487497 7:1296086-1296108 GGGCTGAGGCTGAGTGAGCAGGG + Intergenic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1020583179 7:10031541-10031563 TAGCAGAAGCATTGTGTGCAGGG + Intergenic
1020909608 7:14112047-14112069 TGGTTGAAACAAAGTGAGCAAGG - Intergenic
1020921873 7:14275617-14275639 TATCTGAGGCAGAGGAAGCATGG - Intronic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021276186 7:18654515-18654537 GGGCTGAAGTAGATTGAGCAAGG + Intronic
1021514929 7:21473814-21473836 TATCAGGTGCAGAGTGAGCAAGG + Intronic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022559274 7:31332578-31332600 GAGTTGAAGAAGAGTGAACAAGG + Intergenic
1023483764 7:40662504-40662526 TGGCAGAAGCACAGTGAACAAGG - Intronic
1023787222 7:43719846-43719868 AAGCTGGAGCACAGTGAACAAGG + Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1024340953 7:48258763-48258785 TAGCTAAAGCAGTGTGAAGAGGG - Intronic
1024955523 7:54915282-54915304 CAGCTTAAGCAAAATGAGCAAGG - Intergenic
1027798866 7:82726604-82726626 TGGCCACAGCAGAGTGAGCAAGG + Intergenic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1028850339 7:95530616-95530638 TGGCTGAAGTGGAGTGAGCAAGG + Intronic
1029869758 7:103677952-103677974 TAGTTGGACCAGAGAGAGCAGGG - Intronic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1032445138 7:131975889-131975911 TGGATGGAGCAGAGTGAACAAGG - Intergenic
1032632703 7:133671087-133671109 TACCTGAAGACAAGTGAGCAAGG + Intronic
1032760215 7:134933560-134933582 GAGCTGAGGCAGAGAGGGCAAGG + Exonic
1033562434 7:142545211-142545233 TGGCTGGAGCAGAGAGAGCCAGG - Intergenic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033801587 7:144908388-144908410 AAGGTGAAGCAGAGAGAGAAAGG + Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035761993 8:2075331-2075353 TTGCTGGTGCTGAGTGAGCAAGG - Intronic
1036606321 8:10308684-10308706 TAACTGAAGCACAGTGAGCATGG - Intronic
1036849583 8:12192402-12192424 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1036870945 8:12434675-12434697 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037274749 8:17165967-17165989 TGGCTGAAGTGTAGTGAGCAAGG + Intronic
1037431407 8:18817080-18817102 TGGCTGGAGAGGAGTGAGCAAGG + Intronic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1038127981 8:24695818-24695840 TAGCTGAACCAGAGTTACCTGGG - Intergenic
1038379552 8:27079860-27079882 TACTTGAAGCAGAGAGAGGATGG - Intergenic
1038576892 8:28712267-28712289 TGGCTGAAGCTGAGAGAGCAAGG + Intronic
1039458856 8:37726972-37726994 TAGCTGAAGGAGGGAGAGAAGGG + Intergenic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1042567218 8:70124233-70124255 TTGCTGAAGCCGAGACAGCAGGG + Intronic
1043959529 8:86400765-86400787 TATCTGCTGCAAAGTGAGCAAGG + Intronic
1044159834 8:88899365-88899387 TAGCTGAGGCAGAGAGAGAGAGG - Intergenic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044701418 8:94968571-94968593 TGCCTGGAGCTGAGTGAGCAAGG + Intronic
1044871639 8:96625726-96625748 TAGATGAAGCTGATCGAGCAAGG - Intergenic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045915344 8:107463235-107463257 AAGCTGAATCCGAGTGAGCTTGG + Intronic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047325569 8:123832614-123832636 TAAATGGAGCAAAGTGAGCATGG + Intergenic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047463277 8:125088933-125088955 TGGCTGGAGCAGAGTCAGCTAGG + Intronic
1047817724 8:128483211-128483233 AAGCTAAAGCATAGTGAGCTAGG + Intergenic
1048040937 8:130728138-130728160 TAGCTAGGGCAGAGTGAACAAGG + Intergenic
1048047404 8:130785850-130785872 CAGCTGGAGCAGAGTGAGAGAGG - Intronic
1048059088 8:130899034-130899056 TGGCTAGAGCATAGTGAGCAGGG - Intronic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048668557 8:136691348-136691370 CAGCTGGAGCAGAGTGTACAGGG - Intergenic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049407411 8:142457878-142457900 TACCGGAAGCAGAGGCAGCACGG - Intronic
1049664261 8:143836013-143836035 CACCAGAAGCAGAGTGAGCTGGG + Exonic
1049953013 9:663729-663751 CAGCTGGAGCAGAGCCAGCACGG + Intronic
1050333150 9:4565501-4565523 TGGCTGCAGGAGAGAGAGCAAGG + Intronic
1051100541 9:13515881-13515903 TAGCTGGAGCAGAGAGAATAAGG + Intergenic
1051220390 9:14842676-14842698 GAGATGGAGCAGATTGAGCAAGG + Intronic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052088755 9:24300216-24300238 TAGCTGAAATATAGTGAGAAAGG + Intergenic
1052507526 9:29375140-29375162 TAATTGGAGCAGAGAGAGCATGG + Intergenic
1052760134 9:32581811-32581833 GAGCTAAAGCACAGTGGGCAGGG + Intergenic
1053350407 9:37410312-37410334 TAGATGAGGCAGAGTGAGGGAGG + Intergenic
1054749176 9:68886921-68886943 TGGCTGTAGCAGAGAGGGCAAGG - Intronic
1055350601 9:75382870-75382892 TGGTTGAGACAGAGTGAGCAAGG + Intergenic
1055921864 9:81469350-81469372 TAGATGGAGTATAGTGAGCAAGG + Intergenic
1057500180 9:95590622-95590644 TGGCTGGAGCAGAGTAAACAAGG - Intergenic
1057567495 9:96178419-96178441 TCCCTGAAGCAAAGTCAGCATGG - Intergenic
1058201667 9:102050012-102050034 TGCCTGAAGCACAGTGAGAAAGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058675878 9:107399550-107399572 AAGCTGAAAGAGAGTGAACAAGG - Intergenic
1058862245 9:109127723-109127745 GAGGTGAGGCAGAGTGAGCAGGG - Intergenic
1059189490 9:112310909-112310931 TGGCTGAAAGAGAATGAGCAAGG + Intronic
1059453150 9:114383391-114383413 AAGCTGACCCAGAGTGGGCACGG + Intronic
1060851260 9:126878498-126878520 TCACTGAAGGAGACTGAGCATGG + Intronic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1061350566 9:130061486-130061508 TGGCTGGAGCAGAGTGATCTAGG + Intronic
1062152737 9:135030272-135030294 TACCTGCAGGAGGGTGAGCAGGG + Intergenic
1186839547 X:13471423-13471445 GAGCTACAGCAGAGTGAGCCTGG + Intergenic
1187055006 X:15734652-15734674 TAGGTGGATCAGAGTGAGAAAGG + Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187572540 X:20519470-20519492 GGGCTGAAGTAGAGAGAGCAAGG - Intergenic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1188020688 X:25153897-25153919 TAGCTGAATCAGAGTGAATTAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189044382 X:37574749-37574771 TGGTTGAAGAAGAATGAGCAAGG - Intronic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1189715500 X:43860794-43860816 TGGCTGTAGTAGAATGAGCAAGG - Intronic
1189952790 X:46249490-46249512 TAGATCAAGTAGAGTGAGCAAGG + Intergenic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190458558 X:50647894-50647916 GAGCTGGAGCACAGTGAGCAAGG + Intronic
1191025220 X:55907265-55907287 TAGCTACAGCAGTGTGAACAAGG + Intergenic
1191099369 X:56708902-56708924 TAGCTGAAGTAGTGTTAGGAGGG - Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1191713879 X:64180569-64180591 TGGCTGAAGTAGAGTGAGTGAGG - Intergenic
1191871255 X:65747490-65747512 TGGCTGAAGCATAGTAAGCCAGG - Intergenic
1192055171 X:67766477-67766499 TCCCTGAGGCAGAGTGAGCAAGG - Intergenic
1192273824 X:69610115-69610137 TGACTGGAGCAGAGTGAACAAGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1193043308 X:77026124-77026146 TAGTTGGAGCAGAGCTAGCAAGG + Intergenic
1194375273 X:93124937-93124959 TAACTGCTGCTGAGTGAGCAAGG + Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195006919 X:100694344-100694366 AATCTGAAACTGAGTGAGCAAGG - Intronic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195576637 X:106459135-106459157 TGACTGGAGCTGAGTGAGCAAGG - Intergenic
1195696179 X:107669329-107669351 TAGCTAAAGCATAAGGAGCAAGG - Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196377609 X:115051513-115051535 TTGCTGGGGCAGAGTAAGCAAGG + Intergenic
1196704522 X:118705411-118705433 TAGCTGCAGCAGAGAGTGTATGG - Intergenic
1196764645 X:119231877-119231899 TAGCTGTAGTAGAGTGACCAGGG + Intergenic
1196776773 X:119345276-119345298 TGGCTGAAGTGGAGTAAGCAAGG - Intergenic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1197881736 X:131173772-131173794 TGGCTAAAGCAGAGTGATTAAGG + Intergenic
1197891008 X:131270367-131270389 TGGCTGGAGCATAGTAAGCAAGG - Intergenic
1197916608 X:131542473-131542495 TGACTGGAGCAAAGTGAGCAAGG + Intergenic
1198928680 X:141827834-141827856 TAGCTAGAGCAGAGAGATCAAGG - Intergenic
1199177060 X:144801633-144801655 TGGCTGAAGCATAATGAGAAAGG - Intergenic
1199222569 X:145334337-145334359 TAGCTGCAGCAGACTAAGTAAGG + Intergenic
1199538707 X:148933249-148933271 CAGCTGAAGCAGAGTAAGCAAGG + Intronic
1200022855 X:153226397-153226419 GAGGTGAAGGAGAGAGAGCAAGG + Intergenic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200259262 X:154603508-154603530 TGGCTGCATCAGCGTGAGCAAGG + Intergenic
1200335581 X:155347837-155347859 TGGCTGGAGCTGAGTAAGCAAGG - Intergenic
1200350887 X:155493388-155493410 TGGCTGGAGCTGAGTAAGCAAGG + Intronic
1201608957 Y:15819036-15819058 TAGCTAAAGCAGTGTGTACAGGG + Intergenic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic