ID: 1101169466

View in Genome Browser
Species Human (GRCh38)
Location 12:102075039-102075061
Sequence CACTGGTTATCCTGGCAAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101169466_1101169471 23 Left 1101169466 12:102075039-102075061 CCATTTTGCCAGGATAACCAGTG 0: 1
1: 0
2: 1
3: 13
4: 107
Right 1101169471 12:102075085-102075107 TGTGGACCACCTAAGAAATAAGG 0: 1
1: 0
2: 1
3: 8
4: 93
1101169466_1101169470 5 Left 1101169466 12:102075039-102075061 CCATTTTGCCAGGATAACCAGTG 0: 1
1: 0
2: 1
3: 13
4: 107
Right 1101169470 12:102075067-102075089 AAACAGATTTTCACTAATTGTGG 0: 1
1: 0
2: 1
3: 17
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101169466 Original CRISPR CACTGGTTATCCTGGCAAAA TGG (reversed) Exonic
902524976 1:17051031-17051053 CACTGGTTATAATGGCTAAAAGG - Intronic
906038975 1:42772125-42772147 CACTGGGTGTACTGGCAAACAGG - Intronic
911325927 1:96470107-96470129 CACTGGGTAGCCAGGCAGAAGGG + Intergenic
911583567 1:99663697-99663719 CAATTGTTATCCTTGCAGAATGG + Intronic
915276112 1:154789364-154789386 CCCTGGATATCCTGGCAAAAGGG - Intronic
915511736 1:156390416-156390438 CCCTGGAAATCCAGGCAAAAGGG - Intergenic
917302469 1:173590755-173590777 CAGTGGGTATGCTGGCCAAAGGG + Intronic
917926390 1:179792549-179792571 CACTTGTTCTCATGGCAGAAAGG + Intronic
919166538 1:193902258-193902280 CACTGATTCTCCTGTGAAAATGG + Intergenic
920700015 1:208210716-208210738 TCCTGGTTCTCCTGGCAGAAAGG - Intronic
923578321 1:235182392-235182414 AACTGGATCACCTGGCAAAAAGG - Exonic
1066519492 10:36199666-36199688 CCCTTGTTATCCTGGATAAATGG - Intergenic
1070965939 10:80530454-80530476 CAGTGGTTACCCTGGCACAGAGG + Exonic
1074502829 10:114042450-114042472 GAGTTGTTAACCTGGCAAAAAGG - Intergenic
1078394132 11:10964053-10964075 CACTGGTGATACCGGCAAACAGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1083455953 11:62778739-62778761 CCCTGGTTGTCCTGTCAGAAAGG + Intronic
1084733151 11:71087397-71087419 CAGGGGCTATTCTGGCAAAAGGG + Intronic
1087655537 11:100918438-100918460 AACTTGTTTACCTGGCAAAAAGG - Intronic
1091257364 11:134201283-134201305 CACCGGTAATCCTGGCACATTGG - Intronic
1097646763 12:62244501-62244523 CATTATTTATTCTGGCAAAATGG - Intronic
1101169466 12:102075039-102075061 CACTGGTTATCCTGGCAAAATGG - Exonic
1101328012 12:103733473-103733495 TCCTAGTTCTCCTGGCAAAATGG + Intronic
1108085292 13:46783106-46783128 CTCTGGTTTACCTGTCAAAAAGG + Intronic
1109456920 13:62605186-62605208 CACTGGATATTATGGCAGAATGG + Intergenic
1109652866 13:65352863-65352885 CTATGGTTAGCCTGGCACAAAGG - Intergenic
1109991755 13:70067811-70067833 CAATGGTTATGATGGCATAATGG - Intronic
1111339161 13:86861639-86861661 AACTTATAATCCTGGCAAAAGGG - Intergenic
1115374790 14:32662625-32662647 CAGTGGATAGCCTGGCATAATGG - Intronic
1118375401 14:65172576-65172598 CTGTGGTTTTCCTGCCAAAAAGG + Intergenic
1122795258 14:104202847-104202869 CACAGATGATGCTGGCAAAAAGG + Intergenic
1138256319 16:55565989-55566011 CAGTGGTTATCCTTGGAAGACGG + Intronic
1140631711 16:76861402-76861424 CACTGGATCTCATGGCAAGATGG - Intergenic
1140893634 16:79306287-79306309 CTCTGCTTCTCATGGCAAAATGG + Intergenic
1146530355 17:33603153-33603175 GACTGGTTGTCATGGCAACAGGG + Intronic
1148222873 17:45876623-45876645 CTCTGGATATCCTGGCATAGGGG - Intergenic
1149734123 17:58976233-58976255 CACTGCTTACCCTGAGAAAATGG + Intronic
1150232754 17:63566658-63566680 CACTGGTAATCCCAGCAATATGG + Intronic
1155441792 18:25870020-25870042 CACTGGAAACCATGGCAAAAGGG - Intergenic
1163473592 19:17512092-17512114 CACTGGGTATCATGCCAAGAGGG + Intronic
926979966 2:18558879-18558901 CATTGGTTCTCCTGGAAAAGTGG - Intronic
928209345 2:29312092-29312114 CCCTGGGTAGCCTGGCAATATGG - Intronic
928750749 2:34467347-34467369 CACTGGTGATCCAGGCAAACAGG + Intergenic
929706601 2:44219494-44219516 TAAAAGTTATCCTGGCAAAAAGG + Intronic
930269634 2:49241177-49241199 GACTGCTTATCCAGGCCAAAAGG - Intergenic
931838186 2:66121847-66121869 CACTGCTTATCCTGGTGCAATGG + Intergenic
936632193 2:114215640-114215662 CACTGGTCATGCTGACAAAGAGG - Intergenic
937466282 2:122135773-122135795 CACAGGTTAACAAGGCAAAAGGG - Intergenic
938450007 2:131409723-131409745 CACTGTTTTTCCTAGCAGAATGG - Intergenic
938604391 2:132877287-132877309 CACTGGTTACTCAAGCAAAATGG - Intronic
938796206 2:134719504-134719526 CACTGCTCATCCAGGGAAAAAGG + Intergenic
941756145 2:169188373-169188395 CACTGGTGATCTTGTCGAAATGG - Intronic
941836816 2:170031203-170031225 CACCGGTAATCCTAGCAACACGG - Intronic
943597629 2:189877198-189877220 AACATGTTATCCTGGCAAAAAGG - Intronic
944391228 2:199221862-199221884 CACTTGTAATCCTAGCACAATGG - Intergenic
947799906 2:232922388-232922410 CTCTGGTTACCTTGGCAGAAAGG - Intronic
1172286823 20:33746490-33746512 CACTTGTTATCCTGGCACTTTGG - Intronic
1173159496 20:40641873-40641895 GACTAGTTTTCGTGGCAAAATGG - Intergenic
1173589893 20:44216634-44216656 CTCTGGGTACCCTGACAAAATGG + Intergenic
1173661752 20:44739170-44739192 CGCTGGTTAGCCTGGCAAGCTGG - Intergenic
1176943462 21:14951868-14951890 CACTGGTTATCATGGCAGAGGGG - Intergenic
1178788011 21:35672464-35672486 CTGTAGTTATACTGGCAAAATGG - Intronic
1180892470 22:19299945-19299967 CACTGTTCATCCTGACCAAAAGG + Intergenic
1182304751 22:29360073-29360095 CACTGGACTTCCTGGTAAAAGGG + Intronic
1182864588 22:33592451-33592473 CTTTGATTATCCTGGAAAAAAGG - Intronic
1184876771 22:47281281-47281303 CAATTGTTATGCTGGGAAAATGG + Intergenic
950227725 3:11249600-11249622 CACTGGTTATATTGGCAATTGGG + Intronic
950890118 3:16397328-16397350 CACTGGTTACTATGGCAGAAAGG + Intronic
951840226 3:27026180-27026202 GACTGGTTAGCCTGCAAAAATGG + Intergenic
952179416 3:30902330-30902352 TACTGGTTTTCCAGGCAGAAGGG + Intergenic
953875612 3:46665006-46665028 CAGTGGTGCTCCTGGCAGAAGGG - Intergenic
955557102 3:60149950-60149972 CACTGGTTAGGCTGGATAAAAGG + Intronic
956055585 3:65295237-65295259 CAATGGTTATCCTAGCACAAGGG + Intergenic
962561130 3:136607967-136607989 CACTGGTTGGCCGGGCACAATGG + Intronic
966966477 3:184999866-184999888 GACTTGTTTTCGTGGCAAAATGG + Intronic
970656341 4:18234623-18234645 CACATGTTATCCTGGGAAAAGGG - Intergenic
971734441 4:30428144-30428166 CACTGCTTCCCCAGGCAAAAGGG + Intergenic
975695474 4:77008582-77008604 CACTGATCATTCTTGCAAAATGG - Intronic
976373536 4:84318112-84318134 AATTGGTTATTCTGGCATAAAGG - Intergenic
976569657 4:86594107-86594129 CACTGGTTGTCATGGCAACCGGG + Intronic
977687481 4:99864833-99864855 CATTGGTTTTCCTGATAAAAAGG - Intronic
978928614 4:114282791-114282813 CAATGGTTTACCTTGCAAAAGGG - Intergenic
980901264 4:138907591-138907613 CACTGCTTCTCCAGGGAAAAAGG + Intergenic
982830419 4:160053152-160053174 CAATGGTAATCATTGCAAAAAGG - Intergenic
982924723 4:161321104-161321126 TGCTGGTAATCCTGACAAAAGGG - Intergenic
982959654 4:161821296-161821318 CACTGGTCATCGTGGCAATTTGG - Intronic
986112115 5:4729809-4729831 AACTGGTTAACCTGCCAAGAGGG + Intergenic
993921336 5:93807831-93807853 CAATACTTATCCTTGCAAAAAGG + Intronic
998740588 5:145196293-145196315 CTCTGTTTATTCTGGCAAAATGG - Intergenic
999954616 5:156686955-156686977 CATTGGATATCCTTGAAAAATGG - Intronic
1000107107 5:158070247-158070269 CACTGGTCATGGTGGCAACATGG - Intergenic
1001074203 5:168613225-168613247 CACTGGTACTTCTGCCAAAAAGG + Intergenic
1001171252 5:169420876-169420898 CCCTGGTTGTCCTGGCAGGAGGG + Intergenic
1004175077 6:13332774-13332796 CATTGGTTCACCTGTCAAAACGG + Intergenic
1008442817 6:51552496-51552518 CATTGGTAATCTTGCCAAAATGG + Intergenic
1009378044 6:62995580-62995602 CTCTGTCTCTCCTGGCAAAATGG - Intergenic
1011142431 6:84173629-84173651 TAATGGTAATCCTGGCAAATAGG - Intronic
1015914865 6:138205521-138205543 AACTGGTTATCATTGCATAAAGG + Intronic
1019299223 7:295222-295244 CACTGGTTTTCCTGGGAGAGAGG + Intergenic
1020429649 7:8105960-8105982 GACTGTTTCTCCTGGCAAAATGG + Intergenic
1030267890 7:107639371-107639393 CACTGTTTCTCCTGGCCAAAAGG + Intergenic
1030402293 7:109067354-109067376 AACTGGTAGTCCTGGCAAGAAGG - Intergenic
1034004060 7:147449450-147449472 TAATGGTTATCCTGGCAAGACGG + Intronic
1049269907 8:141689421-141689443 CACTTGTGATGCGGGCAAAAAGG - Intergenic
1050826504 9:9952669-9952691 GAATAGTTATCCTGGCAAAATGG - Intronic
1051111772 9:13646894-13646916 CAGTAGTTATACTGGCAAGAAGG - Intergenic
1053012820 9:34644715-34644737 CACTGGTGTTCTTGGGAAAATGG + Intronic
1054858631 9:69927383-69927405 CATTGGTTATACTGGCAATTGGG + Intergenic
1055516341 9:77037253-77037275 TACTGGCTCTCCTGACAAAATGG + Intergenic
1059550625 9:115225388-115225410 CAGTGGTTTTCCTGGCCACATGG - Intronic
1060156989 9:121326854-121326876 CACTGGGTATCCTTGAAACAGGG - Intronic
1060858938 9:126938152-126938174 CACTGTTTATAGTGGCAAAAAGG + Intronic
1186116195 X:6307318-6307340 CACTCATTATCGTGGTAAAAAGG - Intergenic
1187185659 X:16982760-16982782 CAATGGTCATCATGGCAGAAAGG - Intronic
1188584910 X:31762149-31762171 CACTGGTTTTCCTTACAAACAGG + Intronic
1190091279 X:47439526-47439548 CACTGGTTGGCCAGGCACAATGG - Intergenic
1194357327 X:92901756-92901778 CACTGGTGATCCAGGCAAACAGG - Intergenic
1195845419 X:109222519-109222541 TACTTCTGATCCTGGCAAAATGG + Intergenic
1196482807 X:116169447-116169469 CACTCTTTGTCTTGGCAAAAAGG - Intergenic
1198650240 X:138855124-138855146 CACTGGTCATTCTGGCAACCTGG - Intronic
1200099734 X:153684670-153684692 GACTGGTTATCCTGGGAGGATGG - Intronic
1201911951 Y:19141766-19141788 CACTGGTTATATTGGCAATTGGG - Intergenic